ClinVar Miner

List of variants in gene ATM studied for Ataxia-telangiectasia syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2613
Download table as spreadsheet
HGVS dbSNP
NC_000011.9:g.(?_108098171)_(108124564_?)del
NC_000011.9:g.(?_108098342)_(108100060_?)del
NC_000011.9:g.(?_108098342)_(108117864_?)dup
NC_000011.9:g.(?_108098346)_(108098621_?)del
NC_000011.9:g.(?_108098346)_(108138075_?)del
NC_000011.9:g.(?_108098346)_(108151901_?)dup
NC_000011.9:g.(?_108106391)_(108106567_?)del
NC_000011.9:g.(?_108117681)_(108117864_?)del
NC_000011.9:g.(?_108119654)_(108119835_?)del
NC_000011.9:g.(?_108126936)_(108129808_?)dup
NC_000011.9:g.(?_108128198)_(108129812_?)del
NC_000011.9:g.(?_108137888)_(108143589_?)del
NC_000011.9:g.(?_108143253)_(108153612_?)dup
NC_000011.9:g.(?_108150212)_(108216641_?)del
NC_000011.9:g.(?_108151722)_(108160528_?)del
NC_000011.9:g.(?_108153427)_(108158452_?)del
NC_000011.9:g.(?_108158321)_(108158448_?)del
NC_000011.9:g.(?_108160309)_(108160548_?)del
NC_000011.9:g.(?_108160319)_(108160538_?)del
NC_000011.9:g.(?_108160329)_(108160528_?)del
NC_000011.9:g.(?_108163346)_(108170612_?)del
NC_000011.9:g.(?_108178618)_(108236241_?)del
NC_000011.9:g.(?_108206566)_(108206694_?)del
NM_000051.3(ATM):c.(?_-1)_4109+?dup
NM_000051.3(ATM):c.-111G>A rs189037
NM_000051.3(ATM):c.-111_-109delGCGinsAC rs1555051087
NM_000051.3(ATM):c.-186G>A rs879725890
NM_000051.3(ATM):c.-218T>A rs886047609
NM_000051.3(ATM):c.-222T>A rs557953523
NM_000051.3(ATM):c.-229C>G rs886047608
NM_000051.3(ATM):c.-235delC rs886047607
NM_000051.3(ATM):c.-274G>A rs886047606
NM_000051.3(ATM):c.-31+595G>A rs1555051574
NM_000051.3(ATM):c.-328A>T rs4987880
NM_000051.3(ATM):c.-74G>A rs3205808
NM_000051.3(ATM):c.-94G>A rs766115348
NM_000051.3(ATM):c.1003G>T (p.Gly335Ter) rs1555068471
NM_000051.3(ATM):c.1004G>A (p.Gly335Glu)
NM_000051.3(ATM):c.1007T>G (p.Phe336Cys) rs1018587967
NM_000051.3(ATM):c.1009C>T (p.Arg337Cys) rs138398778
NM_000051.3(ATM):c.1010G>A (p.Arg337His) rs202160435
NM_000051.3(ATM):c.1014T>C (p.Asn338=) rs1555068510
NM_000051.3(ATM):c.1017del (p.Ile339fs) rs1469427343
NM_000051.3(ATM):c.1019C>G (p.Ala340Gly) rs730881387
NM_000051.3(ATM):c.1019C>T (p.Ala340Val)
NM_000051.3(ATM):c.1020C>A (p.Ala340=) rs546927781
NM_000051.3(ATM):c.1020C>T (p.Ala340=) rs546927781
NM_000051.3(ATM):c.1021G>A (p.Val341Ile) rs200601781
NM_000051.3(ATM):c.1025A>G (p.Lys342Arg) rs1064794119
NM_000051.3(ATM):c.1027_1030delGAAA rs587780612
NM_000051.3(ATM):c.1030A>T (p.Asn344Tyr) rs587782526
NM_000051.3(ATM):c.1036A>G (p.Ile346Val) rs1565375699
NM_000051.3(ATM):c.1036del (p.Ile346fs) rs1565375710
NM_000051.3(ATM):c.1037T>A (p.Ile346Asn) rs1060501526
NM_000051.3(ATM):c.1038T>G (p.Ile346Met) rs749950833
NM_000051.3(ATM):c.1039G>C (p.Glu347Gln) rs529202615
NM_000051.3(ATM):c.1039_1040delinsTT (p.Glu347Leu) rs1555068567
NM_000051.3(ATM):c.103C>A (p.Arg35=) rs55861249
NM_000051.3(ATM):c.103C>T (p.Arg35Ter) rs55861249
NM_000051.3(ATM):c.1045_1052del (p.Met349fs) rs1565375817
NM_000051.3(ATM):c.1046T>C (p.Met349Thr) rs1555068577
NM_000051.3(ATM):c.1047G>A (p.Met349Ile) rs768480943
NM_000051.3(ATM):c.1049C>T (p.Ala350Val) rs375049090
NM_000051.3(ATM):c.104G>A (p.Arg35Gln) rs876659324
NM_000051.3(ATM):c.1051G>A (p.Asp351Asn) rs876659092
NM_000051.3(ATM):c.1052A>T (p.Asp351Val) rs1057521618
NM_000051.3(ATM):c.1053dup (p.Ile352fs) rs587781984
NM_000051.3(ATM):c.1055T>C (p.Ile352Thr) rs369203092
NM_000051.3(ATM):c.1056C>G (p.Ile352Met) rs1555068605
NM_000051.3(ATM):c.105A>C (p.Arg35=) rs1060504270
NM_000051.3(ATM):c.1065+1G>C rs201089102
NM_000051.3(ATM):c.1065+1G>T rs201089102
NM_000051.3(ATM):c.1065+5A>T rs1204741025
NM_000051.3(ATM):c.1066-1G>T rs876660038
NM_000051.3(ATM):c.1066-2A>C rs1555069514
NM_000051.3(ATM):c.1066-3_1072delCAGGTTTTTA
NM_000051.3(ATM):c.1066-6T>G rs201686625
NM_000051.3(ATM):c.1068T>C (p.Val356=) rs1462038794
NM_000051.3(ATM):c.1073A>G (p.Asn358Ser) rs149636614
NM_000051.3(ATM):c.1079A>G (p.Asp360Gly) rs775767808
NM_000051.3(ATM):c.107A>G (p.Asp36Gly) rs1488019755
NM_000051.3(ATM):c.1080T>G (p.Asp360Glu) rs199869975
NM_000051.3(ATM):c.1082C>A (p.Thr361Asn) rs1565378803
NM_000051.3(ATM):c.1082C>G (p.Thr361Ser)
NM_000051.3(ATM):c.1086A>G (p.Arg362=) rs142591268
NM_000051.3(ATM):c.1088C>T (p.Ser363Phe) rs1555069560
NM_000051.3(ATM):c.1092_1235+363del
NM_000051.3(ATM):c.1093G>T (p.Glu365Ter) rs1555069577
NM_000051.3(ATM):c.1095_1101delinsA (p.Ile366_Ser367del) rs878853481
NM_000051.3(ATM):c.1096A>G (p.Ile366Val) rs879254198
NM_000051.3(ATM):c.10G>A (p.Val4Ile) rs1438588853
NM_000051.3(ATM):c.1102C>G (p.Gln368Glu) rs1565378912
NM_000051.3(ATM):c.1106C>T (p.Ser369Phe) rs762557654
NM_000051.3(ATM):c.1110C>G (p.Tyr370Ter) rs376170600
NM_000051.3(ATM):c.1111A>G (p.Thr371Ala) rs1565378985
NM_000051.3(ATM):c.1112C>G (p.Thr371Ser)
NM_000051.3(ATM):c.1112C>T (p.Thr371Ile) rs879254289
NM_000051.3(ATM):c.1116T>C (p.Thr372=) rs371985921
NM_000051.3(ATM):c.1118C>G (p.Thr373Arg) rs876659275
NM_000051.3(ATM):c.1119A>T (p.Thr373=) rs754889105
NM_000051.3(ATM):c.1120C>T (p.Gln374Ter) rs1185204988
NM_000051.3(ATM):c.1124del (p.Arg375fs) rs1555069653
NM_000051.3(ATM):c.1126G>T (p.Glu376Ter) rs1555069657
NM_000051.3(ATM):c.112G>A (p.Glu38Lys)
NM_000051.3(ATM):c.1130C>G (p.Ser377Cys) rs1555069665
NM_000051.3(ATM):c.1132A>G (p.Ser378Gly) rs587779811
NM_000051.3(ATM):c.1133G>A (p.Ser378Asn)
NM_000051.3(ATM):c.1135G>A (p.Asp379Asn)
NM_000051.3(ATM):c.1138T>A (p.Tyr380Asn) rs34083085
NM_000051.3(ATM):c.1139A>G (p.Tyr380Cys) rs786203855
NM_000051.3(ATM):c.1139_1142dup (p.Ser381fs) rs886041340
NM_000051.3(ATM):c.1140_1141del (p.Tyr380_Ser381delinsTer) rs1555069677
NM_000051.3(ATM):c.1147C>T (p.Pro383Ser) rs864622650
NM_000051.3(ATM):c.1148C>G (p.Pro383Arg) rs1555069702
NM_000051.3(ATM):c.1149T>C (p.Pro383=) rs786201409
NM_000051.3(ATM):c.1152C>G (p.Cys384Trp) rs777755997
NM_000051.3(ATM):c.1157G>A (p.Arg386Lys) rs878853484
NM_000051.3(ATM):c.1158del (p.Lys387fs) rs587782085
NM_000051.3(ATM):c.1159A>C (p.Lys387Gln) rs786202686
NM_000051.3(ATM):c.115A>G (p.Thr39Ala) rs779297339
NM_000051.3(ATM):c.1160A>G (p.Lys387Arg) rs876659755
NM_000051.3(ATM):c.1161G>A (p.Lys387=) rs786202369
NM_000051.3(ATM):c.1162A>G (p.Lys388Glu) rs876659570
NM_000051.3(ATM):c.1163A>G (p.Lys388Arg) rs1060501618
NM_000051.3(ATM):c.1165A>C (p.Ile389Leu) rs1060501704
NM_000051.3(ATM):c.1165A>G (p.Ile389Val) rs1060501704
NM_000051.3(ATM):c.1166T>C (p.Ile389Thr) rs757486696
NM_000051.3(ATM):c.1166T>G (p.Ile389Arg)
NM_000051.3(ATM):c.1175G>T (p.Gly392Val) rs779035681
NM_000051.3(ATM):c.1176C>G (p.Gly392=) rs1800727
NM_000051.3(ATM):c.1178G>T (p.Trp393Leu) rs1025339570
NM_000051.3(ATM):c.1179_1180del (p.Trp393_Glu394delinsTer) rs876659450
NM_000051.3(ATM):c.118A>G (p.Ile40Val) rs1064796002
NM_000051.3(ATM):c.1192G>A (p.Asp398Asn) rs876658833
NM_000051.3(ATM):c.1192del (p.Asp398fs) rs1057519330
NM_000051.3(ATM):c.1197C>G (p.His399Gln)
NM_000051.3(ATM):c.1197C>T (p.His399=) rs786201131
NM_000051.3(ATM):c.11T>C (p.Val4Ala) rs1555053873
NM_000051.3(ATM):c.1208C>A (p.Ser403Ter) rs747563556
NM_000051.3(ATM):c.1210C>G (p.Gln404Glu) rs730881340
NM_000051.3(ATM):c.1212G>A (p.Gln404=) rs786201519
NM_000051.3(ATM):c.1212_1213del (p.Gln404_Asn405insTer) rs1060501609
NM_000051.3(ATM):c.1215del (p.Asn405fs) rs1555069815
NM_000051.3(ATM):c.1219_1221dup (p.Phe407dup) rs1064792998
NM_000051.3(ATM):c.121A>G (p.Lys41Glu) rs1060501672
NM_000051.3(ATM):c.1221dup (p.Asp408Ter) rs1064792998
NM_000051.3(ATM):c.1222G>A (p.Asp408Asn) rs864622548
NM_000051.3(ATM):c.1223A>G (p.Asp408Gly) rs587781582
NM_000051.3(ATM):c.1225C>T (p.Leu409Phe) rs786203815
NM_000051.3(ATM):c.1227T>C (p.Leu409=) rs1060504273
NM_000051.3(ATM):c.1228G>A (p.Val410Met) rs863224555
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1230G>A (p.Val410=) rs1555069869
NM_000051.3(ATM):c.1234T>C (p.Trp412Arg) rs587779812
NM_000051.3(ATM):c.1235+1G>A rs1555069881
NM_000051.3(ATM):c.1235+3A>G rs1417190414
NM_000051.3(ATM):c.1235+4_1235+5delAA rs770033355
NM_000051.3(ATM):c.1235+5A>C rs1064793679
NM_000051.3(ATM):c.1235+5A>T rs1064793679
NM_000051.3(ATM):c.1236-1G>A rs1408719214
NM_000051.3(ATM):c.1236-2A>G rs80159221
NM_000051.3(ATM):c.1236-2delA rs1565381646
NM_000051.3(ATM):c.1236-3T>A rs763976313
NM_000051.3(ATM):c.1236-3T>C rs763976313
NM_000051.3(ATM):c.1236-3delT rs34325032
NM_000051.3(ATM):c.1236-6_1236-5insC rs878853483
NM_000051.3(ATM):c.1236-8T>C rs756160331
NM_000051.3(ATM):c.1236-9_1236-8insG rs863224290
NM_000051.3(ATM):c.1236G>T (p.Trp412Cys)
NM_000051.3(ATM):c.1240C>T (p.Gln414Ter) rs866521873
NM_000051.3(ATM):c.1242G>A (p.Gln414=) rs786203667
NM_000051.3(ATM):c.1244T>A (p.Ile415Asn) rs1565381748
NM_000051.3(ATM):c.1245T>G (p.Ile415Met) rs1060501554
NM_000051.3(ATM):c.1249A>G (p.Thr417Ala) rs863224556
NM_000051.3(ATM):c.1254A>G (p.Gln418=) rs4987943
NM_000051.3(ATM):c.1258A>C (p.Ile420Leu) rs1565381867
NM_000051.3(ATM):c.1259_1264del (p.Ile420_Ser421del) rs1555070659
NM_000051.3(ATM):c.125A>G (p.His42Arg) rs201773026
NM_000051.3(ATM):c.1261T>C (p.Ser421Pro) rs376196220
NM_000051.3(ATM):c.1263A>G (p.Ser421=) rs1060504285
NM_000051.3(ATM):c.1271C>A (p.Pro424His) rs147472613
NM_000051.3(ATM):c.1271C>T (p.Pro424Leu) rs147472613
NM_000051.3(ATM):c.1272T>C (p.Pro424=) rs35578748
NM_000051.3(ATM):c.1273G>T (p.Ala425Ser)
NM_000051.3(ATM):c.1277G>A (p.Ser426Asn) rs1350528190
NM_000051.3(ATM):c.127C>A (p.Leu43Ile)
NM_000051.3(ATM):c.127C>G (p.Leu43Val) rs772591447
NM_000051.3(ATM):c.1284_1291del (p.Asn429fs) rs863224460
NM_000051.3(ATM):c.1288_1289TG[1] (p.Cys430_Glu431delinsTer) rs587781598
NM_000051.3(ATM):c.1295T>A (p.Leu432Gln) rs546621356
NM_000051.3(ATM):c.1300C>G (p.Pro434Ala) rs1064795171
NM_000051.3(ATM):c.1300C>T (p.Pro434Ser) rs1064795171
NM_000051.3(ATM):c.1303T>C (p.Leu435=) rs748469311
NM_000051.3(ATM):c.1304T>G (p.Leu435Ter)
NM_000051.3(ATM):c.1305del (p.Leu435fs) rs1555070719
NM_000051.3(ATM):c.1307T>A (p.Leu436Gln) rs1060501608
NM_000051.3(ATM):c.130G>T (p.Asp44Tyr) rs1320733816
NM_000051.3(ATM):c.1318_1319TC[1] (p.Gln441fs) rs1555070745
NM_000051.3(ATM):c.131A>G (p.Asp44Gly) rs150143957
NM_000051.3(ATM):c.1324C>T (p.Leu442Phe) rs1060501574
NM_000051.3(ATM):c.1329A>G (p.Leu443=) rs201460863
NM_000051.3(ATM):c.1332C>A (p.Pro444=) rs763361384
NM_000051.3(ATM):c.1333del (p.Gln445fs) rs1060501701
NM_000051.3(ATM):c.1334A>G (p.Gln445Arg)
NM_000051.3(ATM):c.1335A>G (p.Gln445=) rs1385656085
NM_000051.3(ATM):c.1339C>T (p.Arg447Ter) rs587779815
NM_000051.3(ATM):c.133C>T (p.Arg45Trp) rs3218684
NM_000051.3(ATM):c.1340G>A (p.Arg447Gln) rs760676955
NM_000051.3(ATM):c.1340G>T (p.Arg447Leu) rs760676955
NM_000051.3(ATM):c.1346G>A (p.Gly449Glu) rs1163918420
NM_000051.3(ATM):c.1348G>A (p.Glu450Lys) rs1555070786
NM_000051.3(ATM):c.1348del (p.Glu450fs) rs758004668
NM_000051.3(ATM):c.134G>A (p.Arg45Gln) rs762382111
NM_000051.3(ATM):c.1351C>T (p.Arg451Cys) rs201719927
NM_000051.3(ATM):c.1352G>A (p.Arg451His) rs554805703
NM_000051.3(ATM):c.1354A>T (p.Thr452Ser)
NM_000051.3(ATM):c.1355del (p.Thr452fs) rs587781776
NM_000051.3(ATM):c.1358C>T (p.Pro453Leu) rs786204124
NM_000051.3(ATM):c.1359A>G (p.Pro453=) rs786203693
NM_000051.3(ATM):c.135G>A (p.Arg45=) rs970407823
NM_000051.3(ATM):c.1360T>C (p.Tyr454His) rs1555070814
NM_000051.3(ATM):c.1363G>A (p.Val455Met) rs368879876
NM_000051.3(ATM):c.1364T>C (p.Val455Ala) rs876658772
NM_000051.3(ATM):c.1368A>G (p.Leu456=) rs750579940
NM_000051.3(ATM):c.1368dup (p.Arg457fs) rs1565382593
NM_000051.3(ATM):c.1369C>G (p.Arg457Gly) rs749036865
NM_000051.3(ATM):c.1369C>T (p.Arg457Ter) rs749036865
NM_000051.3(ATM):c.1370G>A (p.Arg457Gln) rs780097986
NM_000051.3(ATM):c.1370G>T (p.Arg457Leu) rs780097986
NM_000051.3(ATM):c.1372T>C (p.Cys458Arg) rs876660619
NM_000051.3(ATM):c.1373G>A (p.Cys458Tyr) rs1064796013
NM_000051.3(ATM):c.1378A>C (p.Thr460Pro) rs587782729
NM_000051.3(ATM):c.1379C>T (p.Thr460Met) rs587781841
NM_000051.3(ATM):c.137A>C (p.His46Pro)
NM_000051.3(ATM):c.1380G>A (p.Thr460=) rs145333518
NM_000051.3(ATM):c.1380G>C (p.Thr460=) rs145333518
NM_000051.3(ATM):c.1381G>A (p.Glu461Lys)
NM_000051.3(ATM):c.1385T>C (p.Val462Ala) rs1555070869
NM_000051.3(ATM):c.1387G>A (p.Ala463Thr) rs1565382695
NM_000051.3(ATM):c.138T>C (p.His46=) rs770834907
NM_000051.3(ATM):c.138_141del (p.His46fs) rs786203370
NM_000051.3(ATM):c.1392G>A (p.Leu464=) rs760191806
NM_000051.3(ATM):c.1396C>T (p.Gln466Ter) rs876660485
NM_000051.3(ATM):c.1398A>G (p.Gln466=)
NM_000051.3(ATM):c.1402_1403del (p.Lys468fs) rs587781347
NM_000051.3(ATM):c.1403A>G (p.Lys468Arg) rs1060501628
NM_000051.3(ATM):c.140C>G (p.Ser47Ter) rs774185390
NM_000051.3(ATM):c.1410A>C (p.Ser470=) rs939650649
NM_000051.3(ATM):c.1417G>A (p.Glu473Lys) rs1565382834
NM_000051.3(ATM):c.1418A>G (p.Glu473Gly) rs1555070923
NM_000051.3(ATM):c.1421G>A (p.Ser474Asn)
NM_000051.3(ATM):c.1421G>T (p.Ser474Ile) rs876659240
NM_000051.3(ATM):c.1427A>G (p.Gln476Arg) rs1397399631
NM_000051.3(ATM):c.1428A>G (p.Gln476=) rs745509434
NM_000051.3(ATM):c.1431G>A (p.Lys477=) rs1555070941
NM_000051.3(ATM):c.1431G>C (p.Lys477Asn) rs1555070941
NM_000051.3(ATM):c.1435G>T (p.Asp479Tyr) rs1555070953
NM_000051.3(ATM):c.1435_1436del (p.Asp479fs) rs1555070947
NM_000051.3(ATM):c.1436A>G (p.Asp479Gly) rs1555070958
NM_000051.3(ATM):c.1440A>C (p.Leu480Phe) rs370240037
NM_000051.3(ATM):c.1440A>T (p.Leu480Phe) rs370240037
NM_000051.3(ATM):c.1442T>G (p.Leu481Ter) rs1555070980
NM_000051.3(ATM):c.1443A>C (p.Leu481Phe) rs753808755
NM_000051.3(ATM):c.1444A>C (p.Lys482Gln) rs202173660
NM_000051.3(ATM):c.1446del (p.Lys482fs) rs1060501670
NM_000051.3(ATM):c.1455T>C (p.Asn485=) rs1385019623
NM_000051.3(ATM):c.1455T>G (p.Asn485Lys) rs1385019623
NM_000051.3(ATM):c.1463G>A (p.Trp488Ter) rs879254093
NM_000051.3(ATM):c.1464G>T (p.Trp488Cys) rs377597949
NM_000051.3(ATM):c.1466G>T (p.Cys489Phe) rs776412334
NM_000051.3(ATM):c.1468A>G (p.Ile490Val) rs761850075
NM_000051.3(ATM):c.1469T>C (p.Ile490Thr) rs1565383172
NM_000051.3(ATM):c.146C>G (p.Ser49Cys) rs1800054
NM_000051.3(ATM):c.146C>T (p.Ser49Phe) rs1800054
NM_000051.3(ATM):c.1473C>G (p.Thr491=) rs764937436
NM_000051.3(ATM):c.1477C>T (p.Arg493Cys) rs750280306
NM_000051.3(ATM):c.1478G>A (p.Arg493His) rs1565383235
NM_000051.3(ATM):c.1481G>A (p.Gly494Asp) rs786202233
NM_000051.3(ATM):c.1481G>T (p.Gly494Val) rs786202233
NM_000051.3(ATM):c.1483A>G (p.Ile495Val) rs786201969
NM_000051.3(ATM):c.1485A>G (p.Ile495Met) rs1565383283
NM_000051.3(ATM):c.1487G>A (p.Ser496Asn) rs778890679
NM_000051.3(ATM):c.1487G>T (p.Ser496Ile) rs778890679
NM_000051.3(ATM):c.1491T>A (p.Ser497=) rs1555071057
NM_000051.3(ATM):c.1492G>C (p.Glu498Gln) rs1555071060
NM_000051.3(ATM):c.1494G>A (p.Glu498=) rs763108858
NM_000051.3(ATM):c.1495C>T (p.Gln499Ter) rs1555071075
NM_000051.3(ATM):c.149A>G (p.Lys50Arg) rs1479478300
NM_000051.3(ATM):c.1501C>T (p.Gln501Ter) rs1281817400
NM_000051.3(ATM):c.1505C>G (p.Ala502Gly) rs766595156
NM_000051.3(ATM):c.1511A>G (p.Asn504Ser) rs56365018
NM_000051.3(ATM):c.1513T>C (p.Phe505Leu)
NM_000051.3(ATM):c.1514_1515del (p.Phe505fs) rs1060501529
NM_000051.3(ATM):c.1515T>C (p.Phe505=) rs1057520521
NM_000051.3(ATM):c.1516G>T (p.Gly506Cys) rs587779816
NM_000051.3(ATM):c.1518C>T (p.Gly506=) rs864622528
NM_000051.3(ATM):c.1522C>T (p.Leu508Phe) rs1011518082
NM_000051.3(ATM):c.1524del (p.Gly509fs) rs786204737
NM_000051.3(ATM):c.1531A>G (p.Ile511Val)
NM_000051.3(ATM):c.1536T>A (p.Ile512=) rs1060504296
NM_000051.3(ATM):c.1538A>G (p.Gln513Arg) rs753109010
NM_000051.3(ATM):c.1538A>T (p.Gln513Leu) rs753109010
NM_000051.3(ATM):c.153dup (p.Gly52fs) rs1555054197
NM_000051.3(ATM):c.1541G>A (p.Gly514Asp) rs2235000
NM_000051.3(ATM):c.1542T>C (p.Gly514=) rs572567674
NM_000051.3(ATM):c.1547T>A (p.Leu516Ter)
NM_000051.3(ATM):c.1547T>G (p.Leu516Ter) rs786202195
NM_000051.3(ATM):c.1547_1550delinsA (p.Leu516_Val517delinsTyr) rs1555071174
NM_000051.3(ATM):c.1550T>C (p.Val517Ala) rs777986229
NM_000051.3(ATM):c.1550T>G (p.Val517Gly) rs777986229
NM_000051.3(ATM):c.1555G>A (p.Val519Ile) rs758056561
NM_000051.3(ATM):c.1555G>T (p.Val519Phe)
NM_000051.3(ATM):c.1556T>C (p.Val519Ala) rs574458765
NM_000051.3(ATM):c.1562_1563GA[1] (p.Glu522fs) rs587779817
NM_000051.3(ATM):c.1572G>C (p.Trp524Cys) rs1060501667
NM_000051.3(ATM):c.1573A>T (p.Lys525Ter) rs1565383766
NM_000051.3(ATM):c.1575G>C (p.Lys525Asn) rs587780613
NM_000051.3(ATM):c.1579T>C (p.Phe527Leu) rs864622262
NM_000051.3(ATM):c.157A>C (p.Lys53Gln) rs876659078
NM_000051.3(ATM):c.157A>T (p.Lys53Ter) rs876659078
NM_000051.3(ATM):c.1584T>C (p.Thr528=) rs864622408
NM_000051.3(ATM):c.1586G>A (p.Gly529Glu) rs1555071242
NM_000051.3(ATM):c.1587G>A (p.Gly529=) rs1060504276
NM_000051.3(ATM):c.1595G>A (p.Cys532Tyr) rs35963548
NM_000051.3(ATM):c.1596C>T (p.Cys532=) rs564050785
NM_000051.3(ATM):c.1597_1600dup (p.Pro534fs) rs1131691166
NM_000051.3(ATM):c.159A>G (p.Lys53=) rs1060504281
NM_000051.3(ATM):c.1601C>T (p.Pro534Leu)
NM_000051.3(ATM):c.1605A>G (p.Ser535=) rs1060504290
NM_000051.3(ATM):c.1607+1G>T rs772926890
NM_000051.3(ATM):c.1607+5G>A rs766535949
NM_000051.3(ATM):c.1608-1G>A rs1565385010
NM_000051.3(ATM):c.1608-1G>C rs1565385010
NM_000051.3(ATM):c.1608-3T>C rs774196176
NM_000051.3(ATM):c.1610C>A (p.Pro537His) rs587782463
NM_000051.3(ATM):c.1613C>T (p.Ala538Val) rs1565385040
NM_000051.3(ATM):c.1614A>G (p.Ala538=) rs876659636
NM_000051.3(ATM):c.1617A>G (p.Val539=) rs1060504300
NM_000051.3(ATM):c.1622G>C (p.Cys541Ser) rs1555071682
NM_000051.3(ATM):c.1624T>G (p.Leu542Val) rs587781366
NM_000051.3(ATM):c.1628C>T (p.Thr543Ile) rs772874616
NM_000051.3(ATM):c.1629T>G (p.Thr543=) rs760285673
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1631T>C (p.Leu544Ser) rs375754332
NM_000051.3(ATM):c.1633G>A (p.Ala545Thr) rs1565385130
NM_000051.3(ATM):c.1634C>T (p.Ala545Val) rs878853485
NM_000051.3(ATM):c.1636C>G (p.Leu546Val) rs2227924
NM_000051.3(ATM):c.1637T>C (p.Leu546Pro) rs1565385177
NM_000051.3(ATM):c.1640C>T (p.Thr547Ile) rs786203572
NM_000051.3(ATM):c.1641C>A (p.Thr547=) rs864622141
NM_000051.3(ATM):c.1642A>G (p.Thr548Ala) rs878853486
NM_000051.3(ATM):c.1648A>G (p.Ile550Val) rs202144949
NM_000051.3(ATM):c.1649T>G (p.Ile550Arg) rs864622285
NM_000051.3(ATM):c.164T>G (p.Leu55Trp) rs1565344888
NM_000051.3(ATM):c.1650A>G (p.Ile550Met) rs1060501606
NM_000051.3(ATM):c.1655del (p.Pro552fs) rs1057516876
NM_000051.3(ATM):c.1656A>G (p.Pro552=) rs1060504275
NM_000051.3(ATM):c.165G>C (p.Leu55Phe) rs1555054230
NM_000051.3(ATM):c.1660del (p.Thr554fs) rs876658572
NM_000051.3(ATM):c.1661C>T (p.Thr554Met) rs1060501694
NM_000051.3(ATM):c.1662G>A (p.Thr554=) rs764646531
NM_000051.3(ATM):c.1669A>G (p.Met557Val) rs1427517965
NM_000051.3(ATM):c.1670T>C (p.Met557Thr) rs786202770
NM_000051.3(ATM):c.1670T>G (p.Met557Arg) rs786202770
NM_000051.3(ATM):c.1671G>A (p.Met557Ile) rs730881341
NM_000051.3(ATM):c.1675A>G (p.Ile559Val) rs1060501545
NM_000051.3(ATM):c.1685A>C (p.Asn562Thr)
NM_000051.3(ATM):c.1685A>G (p.Asn562Ser) rs368209025
NM_000051.3(ATM):c.1688T>G (p.Met563Arg) rs750815208
NM_000051.3(ATM):c.1689G>A (p.Met563Ile) rs786202469
NM_000051.3(ATM):c.1695A>G (p.Glu565=) rs780932013
NM_000051.3(ATM):c.1701T>C (p.Asn567=) rs878853487
NM_000051.3(ATM):c.1702A>G (p.Arg568Gly) rs876659425
NM_000051.3(ATM):c.1703G>A (p.Arg568Lys) rs200381392
NM_000051.3(ATM):c.1703G>T (p.Arg568Ile) rs200381392
NM_000051.3(ATM):c.1704A>C (p.Arg568Ser) rs878853488
NM_000051.3(ATM):c.1709T>C (p.Phe570Ser)
NM_000051.3(ATM):c.170G>A (p.Trp57Ter) rs587779818
NM_000051.3(ATM):c.1720G>C (p.Glu574Gln)
NM_000051.3(ATM):c.1721A>C (p.Glu574Ala) rs1565385690
NM_000051.3(ATM):c.1722A>C (p.Glu574Asp) rs372334891
NM_000051.3(ATM):c.1722A>G (p.Glu574=) rs372334891
NM_000051.3(ATM):c.1723T>A (p.Ser575Thr) rs1565385720
NM_000051.3(ATM):c.1726A>G (p.Ile576Val) rs1064795170
NM_000051.3(ATM):c.1727T>C (p.Ile576Thr) rs730881342
NM_000051.3(ATM):c.172G>T (p.Asp58Tyr) rs876660661
NM_000051.3(ATM):c.1733A>G (p.Lys578Arg)
NM_000051.3(ATM):c.1739T>C (p.Leu580Pro)
NM_000051.3(ATM):c.1740C>T (p.Leu580=) rs1060504269
NM_000051.3(ATM):c.1741T>G (p.Leu581Val) rs876659822
NM_000051.3(ATM):c.1741_1742del (p.Leu581fs) rs1057516721
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1745_1749del (p.Phe582fs) rs1565385883
NM_000051.3(ATM):c.1746C>T (p.Phe582=) rs145629926
NM_000051.3(ATM):c.1748A>C (p.Tyr583Ser) rs587780614
NM_000051.3(ATM):c.1748A>G (p.Tyr583Cys) rs587780614
NM_000051.3(ATM):c.1753_1756del (p.Leu585fs) rs1555072008
NM_000051.3(ATM):c.1754dup (p.Leu585fs) rs1555072012
NM_000051.3(ATM):c.1756G>C (p.Glu586Gln) rs1565386004
NM_000051.3(ATM):c.175G>T (p.Ala59Ser) rs752527112
NM_000051.3(ATM):c.1760G>A (p.Gly587Asp) rs1060501553
NM_000051.3(ATM):c.1760G>T (p.Gly587Val)
NM_000051.3(ATM):c.1768G>C (p.Glu590Gln) rs876659283
NM_000051.3(ATM):c.1772dup (p.Asn591fs)
NM_000051.3(ATM):c.1773T>C (p.Asn591=) rs61734356
NM_000051.3(ATM):c.1774A>G (p.Ser592Gly) rs1060501558
NM_000051.3(ATM):c.1775G>A (p.Ser592Asn) rs776911505
NM_000051.3(ATM):c.1779A>G (p.Thr593=) rs876660493
NM_000051.3(ATM):c.1783_1802+91del rs1555072063
NM_000051.3(ATM):c.1789C>G (p.Pro597Ala) rs1555072070
NM_000051.3(ATM):c.178G>C (p.Val60Leu) rs1166668199
NM_000051.3(ATM):c.1790C>T (p.Pro597Leu) rs765847854
NM_000051.3(ATM):c.1792A>C (p.Ile598Leu) rs730881343
NM_000051.3(ATM):c.1792A>G (p.Ile598Val) rs730881343
NM_000051.3(ATM):c.1794T>C (p.Ile598=) rs786201830
NM_000051.3(ATM):c.1795C>T (p.Leu599Phe) rs1312313805
NM_000051.3(ATM):c.1796T>C (p.Leu599Pro) rs1555072082
NM_000051.3(ATM):c.1798C>A (p.His600Asn) rs1555072089
NM_000051.3(ATM):c.179T>C (p.Val60Ala) rs988441570
NM_000051.3(ATM):c.1802+3A>G
NM_000051.3(ATM):c.1802+7T>G rs1057521381
NM_000051.3(ATM):c.1803-10T>C rs1555072423
NM_000051.3(ATM):c.1803-2A>G rs1057517358
NM_000051.3(ATM):c.1805A>G (p.Asn602Ser) rs1173305253
NM_000051.3(ATM):c.180T>G (p.Val60=) rs786201375
NM_000051.3(ATM):c.1810C>T (p.Pro604Ser) rs2227922
NM_000051.3(ATM):c.1811C>T (p.Pro604Leu) rs1565387411
NM_000051.3(ATM):c.1813C>G (p.His605Asp) rs786202928
NM_000051.3(ATM):c.1814A>G (p.His605Arg) rs771877351
NM_000051.3(ATM):c.1819G>A (p.Val607Ile) rs878853489
NM_000051.3(ATM):c.1825G>C (p.Glu609Gln)
NM_000051.3(ATM):c.1827G>A (p.Glu609=) rs1555072460
NM_000051.3(ATM):c.1829A>G (p.Lys610Arg) rs1555072464
NM_000051.3(ATM):c.1834C>T (p.Leu612Phe) rs747242300
NM_000051.3(ATM):c.1835T>A (p.Leu612His)
NM_000051.3(ATM):c.1835T>C (p.Leu612Pro) rs1555072474
NM_000051.3(ATM):c.1837G>T (p.Val613Leu) rs200124136
NM_000051.3(ATM):c.1838T>G (p.Val613Gly) rs762018538
NM_000051.3(ATM):c.1838dup (p.Ser614fs) rs1555072492
NM_000051.3(ATM):c.1839_1842del (p.Leu615_Thr616insTer) rs1555072480
NM_000051.3(ATM):c.1841G>C (p.Ser614Thr) rs770377706
NM_000051.3(ATM):c.1841G>T (p.Ser614Ile)
NM_000051.3(ATM):c.1842T>A (p.Ser614Arg) rs1060501523
NM_000051.3(ATM):c.1844T>C (p.Leu615Pro) rs786203783
NM_000051.3(ATM):c.1846A>G (p.Thr616Ala) rs587780615
NM_000051.3(ATM):c.1847C>T (p.Thr616Ile)
NM_000051.3(ATM):c.1849A>G (p.Met617Val) rs1555072530
NM_000051.3(ATM):c.184A>G (p.Arg62Gly) rs876659407
NM_000051.3(ATM):c.185+1G>A rs112805604
NM_000051.3(ATM):c.185+4T>A rs1060501685
NM_000051.3(ATM):c.185+4T>G
NM_000051.3(ATM):c.185+7T>C rs143404880
NM_000051.3(ATM):c.185+8A>G rs753891198
NM_000051.3(ATM):c.1855A>C (p.Asn619His) rs140882609
NM_000051.3(ATM):c.1856del (p.Asn619fs) rs1057517300
NM_000051.3(ATM):c.186-17A>G rs4987907
NM_000051.3(ATM):c.186-1G>A rs1259911051
NM_000051.3(ATM):c.186-7C>T rs55674039
NM_000051.3(ATM):c.186A>G (p.Arg62=) rs876658224
NM_000051.3(ATM):c.1870A>G (p.Met624Val) rs863224557
NM_000051.3(ATM):c.1872G>C (p.Met624Ile) rs1060501530
NM_000051.3(ATM):c.1880T>G (p.Phe627Cys) rs546087885
NM_000051.3(ATM):c.1880dup (p.Gln628fs) rs786202474
NM_000051.3(ATM):c.1881C>T (p.Phe627=) rs1555072574
NM_000051.3(ATM):c.1884A>G (p.Gln628=) rs1555072578
NM_000051.3(ATM):c.1887C>T (p.Ser629=) rs143097772
NM_000051.3(ATM):c.1888G>A (p.Val630Met) rs148191382
NM_000051.3(ATM):c.1889T>C (p.Val630Ala) rs587782226
NM_000051.3(ATM):c.1892C>T (p.Pro631Leu) rs756782634
NM_000051.3(ATM):c.1893A>G (p.Pro631=) rs764702196
NM_000051.3(ATM):c.1898+1G>A
NM_000051.3(ATM):c.1898+1G>T rs758325274
NM_000051.3(ATM):c.1898+2T>G rs587782124
NM_000051.3(ATM):c.1898+3A>G rs200169643
NM_000051.3(ATM):c.1898+9T>C rs1057520836
NM_000051.3(ATM):c.1899-10T>G rs763685190
NM_000051.3(ATM):c.1899-1G>T
NM_000051.3(ATM):c.1899-55T>G rs4987951
NM_000051.3(ATM):c.1899-7C>A rs1060501584
NM_000051.3(ATM):c.1899-7C>T rs1060501584
NM_000051.3(ATM):c.1899T>G (p.Cys633Trp) rs1040176168
NM_000051.3(ATM):c.1901A>G (p.Glu634Gly)
NM_000051.3(ATM):c.1902A>G (p.Glu634=) rs1060501633
NM_000051.3(ATM):c.1903C>T (p.His635Tyr) rs761491947
NM_000051.3(ATM):c.1905C>A (p.His635Gln)
NM_000051.3(ATM):c.1905_1910del (p.His635_His636del) rs587781635
NM_000051.3(ATM):c.1906C>T (p.His636Tyr) rs786203654
NM_000051.3(ATM):c.1907A>G (p.His636Arg) rs1333990758
NM_000051.3(ATM):c.1910A>G (p.Gln637Arg) rs1565389611
NM_000051.3(ATM):c.1911A>G (p.Gln637=) rs764790965
NM_000051.3(ATM):c.1914A>C (p.Lys638Asn) rs587781753
NM_000051.3(ATM):c.1914_1929dup (p.Ser644delinsArgTer) rs864622415
NM_000051.3(ATM):c.1915_1916insT (p.Asp639fs) rs1060501610
NM_000051.3(ATM):c.1918A>G (p.Lys640Glu)
NM_000051.3(ATM):c.191T>G (p.Leu64Ter)
NM_000051.3(ATM):c.1920_1923del (p.Glu641fs) rs1555073111
NM_000051.3(ATM):c.1921_1923GAA[1] (p.Glu642del) rs876659575
NM_000051.3(ATM):c.1929T>G (p.Leu643=) rs876659911
NM_000051.3(ATM):c.192A>G (p.Leu64=) rs587780616
NM_000051.3(ATM):c.192del (p.Leu64fs) rs878853490
NM_000051.3(ATM):c.1930T>A (p.Ser644Thr) rs1555073128
NM_000051.3(ATM):c.1931C>A (p.Ser644Ter) rs768362387
NM_000051.3(ATM):c.1931C>G (p.Ser644Ter)
NM_000051.3(ATM):c.1935C>G (p.Phe645Leu) rs876659709
NM_000051.3(ATM):c.1939G>T (p.Glu647Ter) rs1060501599
NM_000051.3(ATM):c.193C>G (p.Gln65Glu) rs775248597
NM_000051.3(ATM):c.1943T>C (p.Val648Ala) rs141175037
NM_000051.3(ATM):c.1944A>C (p.Val648=) rs1555073161
NM_000051.3(ATM):c.1945G>A (p.Glu649Lys) rs786202511
NM_000051.3(ATM):c.1945_1947GAA[1] (p.Glu650del) rs1555073166
NM_000051.3(ATM):c.194A>G (p.Gln65Arg) rs760471526
NM_000051.3(ATM):c.1951C>T (p.Leu651=) rs1057521751
NM_000051.3(ATM):c.1952T>A (p.Leu651Gln)
NM_000051.3(ATM):c.1952T>C (p.Leu651Pro) rs1555073179
NM_000051.3(ATM):c.1953A>G (p.Leu651=) rs730881283
NM_000051.3(ATM):c.1954T>C (p.Phe652Leu) rs1565389902
NM_000051.3(ATM):c.195G>C (p.Gln65His) rs1555055072
NM_000051.3(ATM):c.1960C>A (p.Gln654Lys) rs528165789
NM_000051.3(ATM):c.1961A>C (p.Gln654Pro) rs876659966
NM_000051.3(ATM):c.1966A>G (p.Thr656Ala) rs1064793032
NM_000051.3(ATM):c.1967C>T (p.Thr656Ile)
NM_000051.3(ATM):c.196A>G (p.Lys66Glu) rs1565346656
NM_000051.3(ATM):c.1972G>A (p.Asp658Asn)
NM_000051.3(ATM):c.1973A>T (p.Asp658Val) rs1177954052
NM_000051.3(ATM):c.1974C>G (p.Asp658Glu) rs1555073229
NM_000051.3(ATM):c.1977G>T (p.Lys659Asn) rs1060501565
NM_000051.3(ATM):c.1979T>A (p.Met660Lys) rs1298234172
NM_000051.3(ATM):c.1979T>C (p.Met660Thr) rs1298234172
NM_000051.3(ATM):c.1981G>A (p.Asp661Asn) rs1029931261
NM_000051.3(ATM):c.1982A>C (p.Asp661Ala) rs1565390124
NM_000051.3(ATM):c.1986T>C (p.Phe662=) rs1800055
NM_000051.3(ATM):c.198A>G (p.Lys66=) rs540920248
NM_000051.3(ATM):c.1993A>G (p.Ile665Val) rs1060501645
NM_000051.3(ATM):c.1994T>C (p.Ile665Thr) rs1064793789
NM_000051.3(ATM):c.1995T>C (p.Ile665=) rs1555073271
NM_000051.3(ATM):c.1995del (p.Ile665fs)
NM_000051.3(ATM):c.1998G>A (p.Val666=) rs748380150
NM_000051.3(ATM):c.1A>C (p.Met1Leu) rs730881359
NM_000051.3(ATM):c.1A>G (p.Met1Val) rs730881359
NM_000051.3(ATM):c.2005T>C (p.Cys669Arg) rs587782141
NM_000051.3(ATM):c.2009G>A (p.Gly670Asp) rs887944555
NM_000051.3(ATM):c.200A>G (p.Tyr67Cys) rs754033733
NM_000051.3(ATM):c.2011A>G (p.Ile671Val) rs730881344
NM_000051.3(ATM):c.2012T>A (p.Ile671Lys) rs750897021
NM_000051.3(ATM):c.2019G>A (p.Lys673=) rs786203021
NM_000051.3(ATM):c.2019del (p.Lys673fs)
NM_000051.3(ATM):c.2021A>G (p.His674Arg) rs201762714
NM_000051.3(ATM):c.2023C>T (p.Gln675Ter) rs777849257
NM_000051.3(ATM):c.2027C>A (p.Ser676Tyr)
NM_000051.3(ATM):c.202A>G (p.Ile68Val) rs35389822
NM_000051.3(ATM):c.2034T>C (p.Ile678=) rs1013513956
NM_000051.3(ATM):c.2036G>T (p.Gly679Val) rs544123518
NM_000051.3(ATM):c.203T>C (p.Ile68Thr)
NM_000051.3(ATM):c.2040C>T (p.Phe680=) rs587780855
NM_000051.3(ATM):c.2042C>G (p.Ser681Cys) rs1060501585
NM_000051.3(ATM):c.2042C>T (p.Ser681Phe) rs1060501585
NM_000051.3(ATM):c.2043T>A (p.Ser681=) rs746422877
NM_000051.3(ATM):c.2050C>G (p.Gln684Glu) rs1060501691
NM_000051.3(ATM):c.2051A>G (p.Gln684Arg) rs772393149
NM_000051.3(ATM):c.2052G>C (p.Gln684His) rs775890872
NM_000051.3(ATM):c.2054A>G (p.Asn685Ser) rs1412443702
NM_000051.3(ATM):c.2056C>A (p.Leu686Ile) rs1335638362
NM_000051.3(ATM):c.2057T>A (p.Leu686His) rs1239416977
NM_000051.3(ATM):c.2058C>G (p.Leu686=) rs761397203
NM_000051.3(ATM):c.205C>A (p.Gln69Lys)
NM_000051.3(ATM):c.2062G>A (p.Glu688Lys) rs769338089
NM_000051.3(ATM):c.2062G>C (p.Glu688Gln) rs769338089
NM_000051.3(ATM):c.2069T>C (p.Leu690Pro) rs1555073438
NM_000051.3(ATM):c.2071G>C (p.Asp691His)
NM_000051.3(ATM):c.2074C>T (p.Arg692Cys) rs765965513
NM_000051.3(ATM):c.2075G>A (p.Arg692His) rs751515818
NM_000051.3(ATM):c.2082T>C (p.Leu694=) rs369642243
NM_000051.3(ATM):c.2085G>A (p.Leu695=) rs786202229
NM_000051.3(ATM):c.2095G>C (p.Glu699Gln) rs1060501539
NM_000051.3(ATM):c.2096A>G (p.Glu699Gly) rs147934285
NM_000051.3(ATM):c.2098C>T (p.Gln700Ter) rs786202743
NM_000051.3(ATM):c.2104C>G (p.Leu702Val) rs1555073490
NM_000051.3(ATM):c.210A>G (p.Lys70=) rs1064793030
NM_000051.3(ATM):c.210A>T (p.Lys70Asn) rs1064793030
NM_000051.3(ATM):c.2111A>G (p.Asn704Ser) rs753903558
NM_000051.3(ATM):c.2113del (p.Tyr705fs) rs863224822
NM_000051.3(ATM):c.2115C>T (p.Tyr705=) rs876659149
NM_000051.3(ATM):c.2116T>C (p.Ser706Pro) rs536609092
NM_000051.3(ATM):c.2116_2117del (p.Ser706fs)
NM_000051.3(ATM):c.2117C>T (p.Ser706Leu) rs779004090
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2124+1G>T rs1555073553
NM_000051.3(ATM):c.2124+6A>T rs550998406
NM_000051.3(ATM):c.2125-15_2128delGTGGTTTACTTTAAGATTA rs1064792940
NM_000051.3(ATM):c.2125-1G>A rs1402299151
NM_000051.3(ATM):c.2125-2A>C rs1565394403
NM_000051.3(ATM):c.2125-48T>C
NM_000051.3(ATM):c.2125-7_2125-3delCTTTA rs1060504272
NM_000051.3(ATM):c.2125A>G (p.Ile709Val) rs864622259
NM_000051.3(ATM):c.2125del (p.Ile709fs) rs1057517248
NM_000051.3(ATM):c.2127T>C (p.Ile709=) rs56252953
NM_000051.3(ATM):c.2127T>G (p.Ile709Met) rs56252953
NM_000051.3(ATM):c.2129C>A (p.Thr710Lys) rs1565394456
NM_000051.3(ATM):c.2131A>G (p.Asn711Asp) rs587781654
NM_000051.3(ATM):c.2134T>G (p.Ser712Ala) rs1565394509
NM_000051.3(ATM):c.2134del (p.Ser712fs)
NM_000051.3(ATM):c.2135C>G (p.Ser712Ter) rs1057516620
NM_000051.3(ATM):c.2141C>T (p.Thr714Ile) rs1555074846
NM_000051.3(ATM):c.2144T>C (p.Leu715Pro) rs1555074855
NM_000051.3(ATM):c.2147T>G (p.Val716Gly) rs864622294
NM_000051.3(ATM):c.2148C>G (p.Val716=) rs1800701
NM_000051.3(ATM):c.2149C>T (p.Arg717Trp) rs147515380
NM_000051.3(ATM):c.2150G>A (p.Arg717Gln) rs768874297
NM_000051.3(ATM):c.2150G>C (p.Arg717Pro) rs768874297
NM_000051.3(ATM):c.2158C>T (p.Arg720Cys) rs565622131
NM_000051.3(ATM):c.2159G>A (p.Arg720His) rs55830714
NM_000051.3(ATM):c.215C>G (p.Thr72Arg)
NM_000051.3(ATM):c.2165dup (p.Leu722fs) rs1057516393
NM_000051.3(ATM):c.2167G>T (p.Val723Leu) rs1419404231
NM_000051.3(ATM):c.2168T>C (p.Val723Ala) rs745399310
NM_000051.3(ATM):c.2169G>T (p.Val723=) rs878853491
NM_000051.3(ATM):c.2170G>A (p.Gly724Ser) rs887317346
NM_000051.3(ATM):c.2174T>A (p.Val725Asp) rs1565394761
NM_000051.3(ATM):c.2175C>T (p.Val725=) rs140110298
NM_000051.3(ATM):c.217_218del (p.Glu73fs) rs762089971
NM_000051.3(ATM):c.2181C>T (p.Gly727=) rs876658836
NM_000051.3(ATM):c.2182T>A (p.Cys728Ser) rs1565394820
NM_000051.3(ATM):c.2184C>T (p.Cys728=) rs1555074933
NM_000051.3(ATM):c.2187C>T (p.Tyr729=) rs373430058
NM_000051.3(ATM):c.2189G>A (p.Cys730Tyr) rs587781595
NM_000051.3(ATM):c.2190T>C (p.Cys730=) rs876659949
NM_000051.3(ATM):c.2192A>T (p.Tyr731Phe) rs730881345
NM_000051.3(ATM):c.2192dup (p.Tyr731Ter) rs1478081526
NM_000051.3(ATM):c.2193C>A (p.Tyr731Ter) rs2229019
NM_000051.3(ATM):c.2193C>T (p.Tyr731=) rs2229019
NM_000051.3(ATM):c.2194A>G (p.Met732Val)
NM_000051.3(ATM):c.2201_2202insC (p.Ile735fs) rs1459299108
NM_000051.3(ATM):c.2204T>C (p.Ile735Thr) rs1565395012
NM_000051.3(ATM):c.2207C>T (p.Ala736Val) rs587780617
NM_000051.3(ATM):c.2208T>C (p.Ala736=) rs761874856
NM_000051.3(ATM):c.2208T>G (p.Ala736=) rs761874856
NM_000051.3(ATM):c.220T>A (p.Cys74Ser) rs1565346819
NM_000051.3(ATM):c.2215G>A (p.Glu739Lys) rs1565395076
NM_000051.3(ATM):c.2218G>A (p.Ala740Thr) rs786201866
NM_000051.3(ATM):c.221G>A (p.Cys74Tyr) rs864622515
NM_000051.3(ATM):c.2220A>G (p.Ala740=) rs56353517
NM_000051.3(ATM):c.2222A>C (p.Tyr741Ser)
NM_000051.3(ATM):c.2222A>G (p.Tyr741Cys) rs878853492
NM_000051.3(ATM):c.2236T>C (p.Phe746Leu)
NM_000051.3(ATM):c.2238C>T (p.Phe746=) rs786203595
NM_000051.3(ATM):c.2244A>T (p.Lys748Asn)
NM_000051.3(ATM):c.2249A>C (p.Lys750Thr) rs1060501540
NM_000051.3(ATM):c.2250+1G>A rs1565395193
NM_000051.3(ATM):c.2250+2T>C rs1555075037
NM_000051.3(ATM):c.2250+7G>A rs752009031
NM_000051.3(ATM):c.2250G>A (p.Lys750=) rs1137887
NM_000051.3(ATM):c.2251-10T>G rs730881346
NM_000051.3(ATM):c.2251-14T>A rs751677125
NM_000051.3(ATM):c.2251-1G>C rs876659710
NM_000051.3(ATM):c.2251-4A>G rs786202935
NM_000051.3(ATM):c.2251-7A>G rs879254103
NM_000051.3(ATM):c.2254C>G (p.Leu752Val) rs756522395
NM_000051.3(ATM):c.2254C>T (p.Leu752=) rs756522395
NM_000051.3(ATM):c.2258T>C (p.Met753Thr) rs587781607
NM_000051.3(ATM):c.225G>A (p.Leu75=) rs1060504306
NM_000051.3(ATM):c.2260C>A (p.Gln754Lys) rs3205809
NM_000051.3(ATM):c.2262A>G (p.Gln754=) rs778320952
NM_000051.3(ATM):c.2263T>C (p.Cys755Arg) rs1060501646
NM_000051.3(ATM):c.2269G>A (p.Gly757Arg) rs587779819
NM_000051.3(ATM):c.2270del (p.Gly757fs) rs1565397022
NM_000051.3(ATM):c.2272G>T (p.Glu758Ter) rs1555075658
NM_000051.3(ATM):c.2275A>G (p.Ser759Gly) rs148705269
NM_000051.3(ATM):c.2276G>A (p.Ser759Asn) rs786202270
NM_000051.3(ATM):c.2281A>G (p.Thr761Ala) rs2235011
NM_000051.3(ATM):c.2281A>T (p.Thr761Ser) rs2235011
NM_000051.3(ATM):c.2282_2283CT[1] (p.Leu762fs) rs587781658
NM_000051.3(ATM):c.2284C>G (p.Leu762Val) rs876659401
NM_000051.3(ATM):c.2289T>A (p.Phe763Leu) rs34231402
NM_000051.3(ATM):c.2289_2295del (p.Phe763fs) rs1555075690
NM_000051.3(ATM):c.228A>C (p.Arg76Ser)
NM_000051.3(ATM):c.2295del (p.Asn765fs) rs876658583
NM_000051.3(ATM):c.229A>G (p.Ile77Val) rs1064796032
NM_000051.3(ATM):c.229dup (p.Ile77fs) rs1565346867
NM_000051.3(ATM):c.2301_2304del (p.Asn768fs) rs1565397179
NM_000051.3(ATM):c.2305G>A (p.Glu769Lys)
NM_000051.3(ATM):c.2308G>T (p.Glu770Ter) rs1555075721
NM_000051.3(ATM):c.2314A>G (p.Arg772Gly) rs1565397219
NM_000051.3(ATM):c.2317A>C (p.Ile773Leu) rs876659084
NM_000051.3(ATM):c.2321G>T (p.Gly774Val) rs1555075727
NM_000051.3(ATM):c.2322T>C (p.Gly774=) rs769575297
NM_000051.3(ATM):c.232G>A (p.Ala78Thr) rs878853493
NM_000051.3(ATM):c.2333A>G (p.Asn778Ser) rs587779820
NM_000051.3(ATM):c.2334T>C (p.Asn778=) rs1555075758
NM_000051.3(ATM):c.2336T>C (p.Met779Thr) rs587778066
NM_000051.3(ATM):c.2338A>T (p.Met780Leu) rs587781446
NM_000051.3(ATM):c.233C>G (p.Ala78Gly) rs876659669
NM_000051.3(ATM):c.2341C>T (p.Gln781Ter) rs1555075781
NM_000051.3(ATM):c.2346A>G (p.Leu782=) rs730881285
NM_000051.3(ATM):c.2347T>G (p.Cys783Gly) rs1555075786
NM_000051.3(ATM):c.2353C>T (p.Arg785Cys) rs587778065
NM_000051.3(ATM):c.2354G>A (p.Arg785His) rs587782128
NM_000051.3(ATM):c.2356T>C (p.Cys786Arg) rs1565397441
NM_000051.3(ATM):c.2362A>C (p.Ser788Arg) rs641252
NM_000051.3(ATM):c.2363G>A (p.Ser788Asn) rs1555075809
NM_000051.3(ATM):c.2366A>G (p.Asn789Ser)
NM_000051.3(ATM):c.2369G>C (p.Cys790Ser) rs764538548
NM_000051.3(ATM):c.2373C>T (p.Thr791=) rs878853494
NM_000051.3(ATM):c.2376+17_2376+19delCTT rs757318914
NM_000051.3(ATM):c.2376+1G>T rs730881347
NM_000051.3(ATM):c.2376+3A>G rs758083563
NM_000051.3(ATM):c.2376+3A>T rs758083563
NM_000051.3(ATM):c.2376+6A>C
NM_000051.3(ATM):c.2377-2A>G rs1057516553
NM_000051.3(ATM):c.2377-5T>C rs754206007
NM_000051.3(ATM):c.2377-6T>A rs876660963
NM_000051.3(ATM):c.2377A>G (p.Lys793Glu) rs587781583
NM_000051.3(ATM):c.2377_2378dup (p.Ser794fs) rs1057516980
NM_000051.3(ATM):c.237del (p.Lys79fs) rs730881303
NM_000051.3(ATM):c.2382T>A (p.Ser794Arg) rs1555076601
NM_000051.3(ATM):c.2383C>T (p.Pro795Ser) rs1060501651
NM_000051.3(ATM):c.2386A>C (p.Asn796His) rs201793499
NM_000051.3(ATM):c.2386A>T (p.Asn796Tyr) rs201793499
NM_000051.3(ATM):c.2394T>C (p.Ile798=) rs876659882
NM_000051.3(ATM):c.2395G>A (p.Ala799Thr)
NM_000051.3(ATM):c.2396C>T (p.Ala799Val) rs199954262
NM_000051.3(ATM):c.2397A>G (p.Ala799=) rs1060504279
NM_000051.3(ATM):c.239C>T (p.Pro80Leu) rs876659996
NM_000051.3(ATM):c.23T>C (p.Leu8Pro)
NM_000051.3(ATM):c.2401G>A (p.Gly801Ser) rs1565399865
NM_000051.3(ATM):c.2406T>C (p.Phe802=) rs1472760933
NM_000051.3(ATM):c.2408T>C (p.Phe803Ser) rs751218526
NM_000051.3(ATM):c.2413C>G (p.Arg805Gly) rs780619951
NM_000051.3(ATM):c.2413C>T (p.Arg805Ter) rs780619951
NM_000051.3(ATM):c.2414G>A (p.Arg805Gln) rs587782255
NM_000051.3(ATM):c.2417T>G (p.Leu806Trp) rs1565399936
NM_000051.3(ATM):c.2418G>T (p.Leu806Phe) rs587781296
NM_000051.3(ATM):c.2419T>C (p.Leu807=) rs1555076667
NM_000051.3(ATM):c.241A>G (p.Asn81Asp) rs758962678
NM_000051.3(ATM):c.2425T>G (p.Ser809Ala) rs926246315
NM_000051.3(ATM):c.2426C>A (p.Ser809Ter) rs730881348
NM_000051.3(ATM):c.2428A>G (p.Lys810Glu) rs201909756
NM_000051.3(ATM):c.2430G>A (p.Lys810=) rs1555076689
NM_000051.3(ATM):c.2434A>G (p.Met812Val) rs112357985
NM_000051.3(ATM):c.2436G>A (p.Met812Ile) rs876658688
NM_000051.3(ATM):c.2441A>T (p.Asp814Val) rs1565400035
NM_000051.3(ATM):c.2442C>A (p.Asp814Glu) rs3218695
NM_000051.3(ATM):c.2442C>T (p.Asp814=) rs3218695
NM_000051.3(ATM):c.2443A>G (p.Ile815Val) rs746090916
NM_000051.3(ATM):c.2446_2447delinsCT (p.Ala816Leu) rs587781956
NM_000051.3(ATM):c.2449G>A (p.Asp817Asn) rs587778067
NM_000051.3(ATM):c.2449G>C (p.Asp817His) rs587778067
NM_000051.3(ATM):c.2450A>G (p.Asp817Gly) rs587779821
NM_000051.3(ATM):c.2450A>T (p.Asp817Val) rs587779821
NM_000051.3(ATM):c.2453T>C (p.Ile818Thr)
NM_000051.3(ATM):c.2455T>C (p.Cys819Arg) rs775644968
NM_000051.3(ATM):c.2459A>G (p.Lys820Arg) rs952566855
NM_000051.3(ATM):c.2463T>G (p.Ser821Arg) rs864622412
NM_000051.3(ATM):c.2466+1G>A rs914092098
NM_000051.3(ATM):c.2466+1delG rs786202783
NM_000051.3(ATM):c.2466+2T>A rs878853495
NM_000051.3(ATM):c.2466+2T>G rs878853495
NM_000051.3(ATM):c.2466+4A>G rs563482577
NM_000051.3(ATM):c.2466+5G>C rs1064795969
NM_000051.3(ATM):c.2466+5G>T
NM_000051.3(ATM):c.2466+7A>G rs55812024
NM_000051.3(ATM):c.2466+8T>A rs765619483
NM_000051.3(ATM):c.2466+8T>C rs765619483
NM_000051.3(ATM):c.2466A>G (p.Leu822=) rs747108452
NM_000051.3(ATM):c.2467-1G>A rs1328985852
NM_000051.3(ATM):c.2467-2A>C rs1555082050
NM_000051.3(ATM):c.2467-2A>T rs1555082050
NM_000051.3(ATM):c.2467-4G>T rs1555082048
NM_000051.3(ATM):c.2467-7C>T rs768850329
NM_000051.3(ATM):c.2467-8C>G rs1425701157
NM_000051.3(ATM):c.2467G>A (p.Ala823Thr)
NM_000051.3(ATM):c.2467G>T (p.Ala823Ser) rs786202895
NM_000051.3(ATM):c.246A>G (p.Val82=) rs757944864
NM_000051.3(ATM):c.2474T>G (p.Phe825Cys) rs1060501648
NM_000051.3(ATM):c.2476A>C (p.Ile826Leu) rs587782397
NM_000051.3(ATM):c.2480A>G (p.Lys827Arg) rs372230498
NM_000051.3(ATM):c.2485C>G (p.Pro829Ala) rs1060501546
NM_000051.3(ATM):c.2486C>A (p.Pro829Gln) rs1565416001
NM_000051.3(ATM):c.2487A>G (p.Pro829=) rs1330586139
NM_000051.3(ATM):c.2491G>A (p.Asp831Asn) rs1060501595
NM_000051.3(ATM):c.2491G>T (p.Asp831Tyr) rs1060501595
NM_000051.3(ATM):c.2492A>G (p.Asp831Gly) rs587781352
NM_000051.3(ATM):c.2494C>A (p.Arg832Ser) rs2229022
NM_000051.3(ATM):c.2494C>G (p.Arg832Gly)
NM_000051.3(ATM):c.2494C>T (p.Arg832Cys) rs2229022
NM_000051.3(ATM):c.2495G>A (p.Arg832His) rs199875915
NM_000051.3(ATM):c.2495G>T (p.Arg832Leu) rs199875915
NM_000051.3(ATM):c.2497G>A (p.Gly833Arg)
NM_000051.3(ATM):c.2499A>C (p.Gly833=) rs1060504263
NM_000051.3(ATM):c.2500G>T (p.Glu834Ter) rs876660430
NM_000051.3(ATM):c.2501A>T (p.Glu834Val) rs730881349
NM_000051.3(ATM):c.2502dup (p.Val835fs) rs587779822
NM_000051.3(ATM):c.2506G>A (p.Glu836Lys) rs141054982
NM_000051.3(ATM):c.2508dup (p.Ser837fs)
NM_000051.3(ATM):c.2512A>G (p.Met838Val) rs1555082132
NM_000051.3(ATM):c.2516A>C (p.Glu839Ala)
NM_000051.3(ATM):c.2517A>T (p.Glu839Asp) rs1060501697
NM_000051.3(ATM):c.2519A>G (p.Asp840Gly) rs786202605
NM_000051.3(ATM):c.2519A>T (p.Asp840Val) rs786202605
NM_000051.3(ATM):c.251C>T (p.Ala84Val) rs587781937
NM_000051.3(ATM):c.2521del (p.Asp841fs) rs1175457710
NM_000051.3(ATM):c.2522A>C (p.Asp841Ala) rs587781812
NM_000051.3(ATM):c.2522A>G (p.Asp841Gly) rs587781812
NM_000051.3(ATM):c.2524dup (p.Thr842fs) rs1555082160
NM_000051.3(ATM):c.2525C>G (p.Thr842Ser) rs1555082164
NM_000051.3(ATM):c.2531G>A (p.Gly844Glu) rs587781808
NM_000051.3(ATM):c.2531G>C (p.Gly844Ala) rs587781808
NM_000051.3(ATM):c.2534A>G (p.Asn845Ser) rs1060501591
NM_000051.3(ATM):c.2534del (p.Asn845fs)
NM_000051.3(ATM):c.2536C>G (p.Leu846Val) rs1555082186
NM_000051.3(ATM):c.2538A>C (p.Leu846=) rs567045160
NM_000051.3(ATM):c.2539A>G (p.Met847Val) rs587779823
NM_000051.3(ATM):c.2539A>T (p.Met847Leu) rs587779823
NM_000051.3(ATM):c.2540T>A (p.Met847Lys) rs1382712243
NM_000051.3(ATM):c.2541G>A (p.Met847Ile) rs864622131
NM_000051.3(ATM):c.2542G>T (p.Glu848Ter) rs879254046
NM_000051.3(ATM):c.2543A>G (p.Glu848Gly) rs1060501555
NM_000051.3(ATM):c.2544G>C (p.Glu848Asp) rs1060501601
NM_000051.3(ATM):c.2546T>C (p.Val849Ala) rs1555082209
NM_000051.3(ATM):c.2547G>A (p.Val849=) rs1060504262
NM_000051.3(ATM):c.2550G>A (p.Glu850=) rs1399925352
NM_000051.3(ATM):c.2551G>A (p.Asp851Asn) rs1555082218
NM_000051.3(ATM):c.2552A>G (p.Asp851Gly) rs748203812
NM_000051.3(ATM):c.2553T>A (p.Asp851Glu) rs1064793513
NM_000051.3(ATM):c.2553T>G (p.Asp851Glu) rs1064793513
NM_000051.3(ATM):c.2554C>T (p.Gln852Ter) rs758081262
NM_000051.3(ATM):c.2557T>C (p.Ser853Pro) rs876658913
NM_000051.3(ATM):c.2558C>T (p.Ser853Leu) rs1555082235
NM_000051.3(ATM):c.2560T>C (p.Ser854Pro) rs1060501632
NM_000051.3(ATM):c.2561C>A (p.Ser854Tyr) rs778123895
NM_000051.3(ATM):c.2563A>T (p.Met855Leu)
NM_000051.3(ATM):c.2564T>C (p.Met855Thr) rs587779824
NM_000051.3(ATM):c.256A>G (p.Thr86Ala) rs1565347018
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2576A>G (p.Asn859Ser) rs1565416655
NM_000051.3(ATM):c.2577C>T (p.Asn859=) rs730881286
NM_000051.3(ATM):c.2578G>A (p.Asp860Asn) rs587779825
NM_000051.3(ATM):c.2579A>G (p.Asp860Gly) rs761251711
NM_000051.3(ATM):c.2579A>T (p.Asp860Val) rs761251711
NM_000051.3(ATM):c.2581T>A (p.Tyr861Asn)
NM_000051.3(ATM):c.2583C>A (p.Tyr861Ter) rs886039633
NM_000051.3(ATM):c.2585C>A (p.Pro862His) rs1565416725
NM_000051.3(ATM):c.2589T>C (p.Asp863=) rs1057520227
NM_000051.3(ATM):c.2590A>C (p.Ser864Arg) rs764842086
NM_000051.3(ATM):c.2590_2592AGT[1] (p.Ser865del) rs863224823
NM_000051.3(ATM):c.2591G>A (p.Ser864Asn) rs1555082306
NM_000051.3(ATM):c.2600G>A (p.Ser867Asn)
NM_000051.3(ATM):c.2603A>G (p.Asp868Gly) rs750322758
NM_000051.3(ATM):c.2606C>A (p.Ala869Glu)
NM_000051.3(ATM):c.2606C>G (p.Ala869Gly) rs145513717
NM_000051.3(ATM):c.2606C>T (p.Ala869Val) rs145513717
NM_000051.3(ATM):c.2606_2607del (p.Ala869fs) rs1057516944
NM_000051.3(ATM):c.2608A>G (p.Asn870Asp) rs61734354
NM_000051.3(ATM):c.2610C>G (p.Asn870Lys)
NM_000051.3(ATM):c.2610C>T (p.Asn870=) rs587780618
NM_000051.3(ATM):c.2613dup (p.Pro872fs)
NM_000051.3(ATM):c.2614C>T (p.Pro872Ser) rs3218673
NM_000051.3(ATM):c.2615C>T (p.Pro872Leu) rs786202977
NM_000051.3(ATM):c.2619A>G (p.Gly873=) rs777979257
NM_000051.3(ATM):c.2620G>T (p.Glu874Ter) rs1565416901
NM_000051.3(ATM):c.2621A>G (p.Glu874Gly) rs1555082338
NM_000051.3(ATM):c.2627A>G (p.Gln876Arg) rs1555082348
NM_000051.3(ATM):c.2630G>C (p.Ser877Thr) rs370269552
NM_000051.3(ATM):c.2634C>G (p.Thr878=) rs771444818
NM_000051.3(ATM):c.2635A>G (p.Ile879Val) rs556598169
NM_000051.3(ATM):c.2636T>C (p.Ile879Thr) rs746265230
NM_000051.3(ATM):c.2638+2T>C rs587779826
NM_000051.3(ATM):c.2638+3A>G rs876660552
NM_000051.3(ATM):c.2638+6T>C rs768305533
NM_000051.3(ATM):c.2638+7A>G rs1555082379
NM_000051.3(ATM):c.2638+8C>T rs776116433
NM_000051.3(ATM):c.2638+9A>G rs761592414
NM_000051.3(ATM):c.2639-3T>C rs1410247657
NM_000051.3(ATM):c.2639-4_2639-3delTT rs1555083075
NM_000051.3(ATM):c.2639-7T>C rs912886321
NM_000051.3(ATM):c.2649T>G (p.Asn883Lys) rs1555083093
NM_000051.3(ATM):c.2650C>G (p.Pro884Ala)
NM_000051.3(ATM):c.2654T>G (p.Leu885Ter) rs1555083096
NM_000051.3(ATM):c.2654_2656delinsAA (p.Leu885_Ala886delinsTer) rs1060501679
NM_000051.3(ATM):c.2655A>T (p.Leu885Phe) rs730881351
NM_000051.3(ATM):c.2662G>C (p.Glu888Gln) rs879254083
NM_000051.3(ATM):c.2668C>G (p.Leu890Val)
NM_000051.3(ATM):c.2672C>G (p.Ser891Ter) rs876660780
NM_000051.3(ATM):c.2676G>T (p.Lys892Asn) rs1555083128
NM_000051.3(ATM):c.2677C>T (p.Gln893Ter) rs1555083131
NM_000051.3(ATM):c.2678A>G (p.Gln893Arg) rs876659776
NM_000051.3(ATM):c.2679A>G (p.Gln893=) rs139316519
NM_000051.3(ATM):c.2681A>G (p.Asp894Gly) rs113482790
NM_000051.3(ATM):c.2681A>T (p.Asp894Val) rs113482790
NM_000051.3(ATM):c.2683C>A (p.Leu895Ile) rs1299030225
NM_000051.3(ATM):c.2685A>G (p.Leu895=) rs3218687
NM_000051.3(ATM):c.2686C>G (p.Leu896Val)
NM_000051.3(ATM):c.2689T>A (p.Phe897Ile) rs147122522
NM_000051.3(ATM):c.268A>G (p.Arg90Gly) rs868748140
NM_000051.3(ATM):c.2691C>G (p.Phe897Leu) rs878853496
NM_000051.3(ATM):c.2693T>G (p.Leu898Ter) rs770610463
NM_000051.3(ATM):c.2694A>C (p.Leu898Phe) rs774395596
NM_000051.3(ATM):c.2694A>T (p.Leu898Phe) rs774395596
NM_000051.3(ATM):c.2696A>G (p.Asp899Gly) rs1555083190
NM_000051.3(ATM):c.2698A>G (p.Met900Val) rs138468963
NM_000051.3(ATM):c.2699T>C (p.Met900Thr) rs863224558
NM_000051.3(ATM):c.2700G>A (p.Met900Ile)
NM_000051.3(ATM):c.2700dup (p.Leu901fs) rs1555083198
NM_000051.3(ATM):c.2701C>T (p.Leu901Phe) rs863224559
NM_000051.3(ATM):c.2708T>G (p.Phe903Cys) rs1555083208
NM_000051.3(ATM):c.2716T>A (p.Leu906Met) rs368047468
NM_000051.3(ATM):c.2717T>C (p.Leu906Ser) rs1064794688
NM_000051.3(ATM):c.2718_2719GT[1] (p.Leu906_Cys907insTer) rs786202695
NM_000051.3(ATM):c.2720G>A (p.Cys907Tyr)
NM_000051.3(ATM):c.2720G>T (p.Cys907Phe) rs775371838
NM_000051.3(ATM):c.2723T>C (p.Val908Ala) rs754738085
NM_000051.3(ATM):c.2724A>T (p.Val908=) rs1555083247
NM_000051.3(ATM):c.2725A>T (p.Thr909Ser) rs786203175
NM_000051.3(ATM):c.2726C>T (p.Thr909Ile) rs1555083259
NM_000051.3(ATM):c.2727del (p.Thr910fs) rs1555083267
NM_000051.3(ATM):c.2728A>G (p.Thr910Ala) rs1265391373
NM_000051.3(ATM):c.2735A>G (p.Gln912Arg) rs730881353
NM_000051.3(ATM):c.2736G>A (p.Gln912=) rs757305928
NM_000051.3(ATM):c.2738C>A (p.Thr913Asn) rs1266220962
NM_000051.3(ATM):c.2738C>T (p.Thr913Ile)
NM_000051.3(ATM):c.2740A>G (p.Asn914Asp)
NM_000051.3(ATM):c.2741A>G (p.Asn914Ser)
NM_000051.3(ATM):c.2743A>G (p.Thr915Ala) rs786203106
NM_000051.3(ATM):c.2748G>T (p.Val916=) rs1050470790
NM_000051.3(ATM):c.2751C>T (p.Ser917=) rs876659611
NM_000051.3(ATM):c.2752T>C (p.Phe918Leu) rs1060501549
NM_000051.3(ATM):c.2754del (p.Phe918fs) rs786202608
NM_000051.3(ATM):c.2758G>A (p.Ala920Thr) rs1555083326
NM_000051.3(ATM):c.275A>C (p.Lys92Thr) rs200151849
NM_000051.3(ATM):c.2761G>A (p.Ala921Thr) rs1565419701
NM_000051.3(ATM):c.2764G>C (p.Asp922His) rs786201670
NM_000051.3(ATM):c.2765A>T (p.Asp922Val) rs1555083339
NM_000051.3(ATM):c.2770C>T (p.Arg924Trp) rs55723361
NM_000051.3(ATM):c.2771G>A (p.Arg924Gln) rs587782298
NM_000051.3(ATM):c.2775del (p.Lys926fs) rs1060501702
NM_000051.3(ATM):c.2778A>G (p.Lys926=) rs372569168
NM_000051.3(ATM):c.2781G>T (p.Leu927Phe) rs770565353
NM_000051.3(ATM):c.2786T>C (p.Met929Thr) rs745737218
NM_000051.3(ATM):c.2786T>G (p.Met929Arg) rs745737218
NM_000051.3(ATM):c.2789T>G (p.Leu930Ter) rs786203309
NM_000051.3(ATM):c.2791A>G (p.Ile931Val) rs1308253602
NM_000051.3(ATM):c.2795A>G (p.Asp932Gly) rs1060501623
NM_000051.3(ATM):c.2797T>A (p.Ser933Thr) rs1060501698
NM_000051.3(ATM):c.2798C>G (p.Ser933Cys) rs56087610
NM_000051.3(ATM):c.279G>A (p.Lys93=) rs368196317
NM_000051.3(ATM):c.2801G>C (p.Ser934Thr) rs1555083387
NM_000051.3(ATM):c.2803A>C (p.Thr935Pro) rs35813135
NM_000051.3(ATM):c.2803A>G (p.Thr935Ala) rs35813135
NM_000051.3(ATM):c.2804C>A (p.Thr935Lys)
NM_000051.3(ATM):c.2804C>G (p.Thr935Arg) rs3218708
NM_000051.3(ATM):c.2804C>T (p.Thr935Met) rs3218708
NM_000051.3(ATM):c.2805G>A (p.Thr935=) rs55934812
NM_000051.3(ATM):c.2805G>C (p.Thr935=) rs55934812
NM_000051.3(ATM):c.2805G>T (p.Thr935=) rs55934812
NM_000051.3(ATM):c.2806C>G (p.Leu936Val)
NM_000051.3(ATM):c.2806_2809dup (p.Glu937fs) rs757237504
NM_000051.3(ATM):c.2809G>C (p.Glu937Gln) rs1565420027
NM_000051.3(ATM):c.280A>G (p.Met94Val) rs864622758
NM_000051.3(ATM):c.2811A>C (p.Glu937Asp) rs1060501705
NM_000051.3(ATM):c.2815A>G (p.Thr939Ala) rs864622606
NM_000051.3(ATM):c.2818A>G (p.Lys940Glu) rs1064795896
NM_000051.3(ATM):c.2819A>C (p.Lys940Thr)
NM_000051.3(ATM):c.2819A>G (p.Lys940Arg) rs762078586
NM_000051.3(ATM):c.2819A>T (p.Lys940Ile) rs762078586
NM_000051.3(ATM):c.2823C>A (p.Ser941=) rs750504746
NM_000051.3(ATM):c.2824C>T (p.Leu942Phe) rs3218688
NM_000051.3(ATM):c.2831T>G (p.Leu944Arg) rs565886680
NM_000051.3(ATM):c.2834A>G (p.His945Arg)
NM_000051.3(ATM):c.2836A>C (p.Met946Leu) rs587781992
NM_000051.3(ATM):c.2836A>G (p.Met946Val) rs587781992
NM_000051.3(ATM):c.2838+1G>T rs1555083469
NM_000051.3(ATM):c.2838+5G>A rs1555083472
NM_000051.3(ATM):c.2838+8dupA rs1364656453
NM_000051.3(ATM):c.2838+9C>A rs370160823
NM_000051.3(ATM):c.2838+9C>G rs370160823
NM_000051.3(ATM):c.2838+9C>T rs370160823
NM_000051.3(ATM):c.2839-18_2839-17insT rs730881287
NM_000051.3(ATM):c.2839-2A>G rs1060501703
NM_000051.3(ATM):c.2839-3_2839delinsGATACTA rs786202148
NM_000051.3(ATM):c.2839-4T>C rs1057522619
NM_000051.3(ATM):c.2839-579_2839-576del rs587776552
NM_000051.3(ATM):c.2839-5C>A rs876660205
NM_000051.3(ATM):c.2839-?_4109+?del
NM_000051.3(ATM):c.283C>A (p.Gln95Lys) rs587781545
NM_000051.3(ATM):c.2848C>G (p.Leu950Val)
NM_000051.3(ATM):c.2848C>T (p.Leu950Phe) rs763064034
NM_000051.3(ATM):c.2849T>A (p.Leu950His)
NM_000051.3(ATM):c.2849T>G (p.Leu950Arg) rs786203054
NM_000051.3(ATM):c.2857G>A (p.Glu953Lys)
NM_000051.3(ATM):c.2859G>A (p.Glu953=) rs569489729
NM_000051.3(ATM):c.2861T>A (p.Leu954His) rs1555084648
NM_000051.3(ATM):c.2862T>C (p.Leu954=) rs1426256662
NM_000051.3(ATM):c.2864C>A (p.Pro955His)
NM_000051.3(ATM):c.2867G>A (p.Gly956Glu) rs752099312
NM_000051.3(ATM):c.2871A>G (p.Glu957=) rs863224291
NM_000051.3(ATM):c.2873A>G (p.Glu958Gly) rs587778069
NM_000051.3(ATM):c.2876A>C (p.Tyr959Ser)
NM_000051.3(ATM):c.2877C>A (p.Tyr959Ter)
NM_000051.3(ATM):c.2877C>G (p.Tyr959Ter) rs1057517253
NM_000051.3(ATM):c.2878C>A (p.Pro960Thr) rs876659412
NM_000051.3(ATM):c.2879C>A (p.Pro960His) rs587779828
NM_000051.3(ATM):c.2879C>T (p.Pro960Leu) rs587779828
NM_000051.3(ATM):c.2880del (p.Leu961fs) rs730881300
NM_000051.3(ATM):c.2887A>G (p.Met963Val) rs374353016
NM_000051.3(ATM):c.2894A>T (p.Asp965Val) rs876658628
NM_000051.3(ATM):c.2896G>A (p.Val966Ile) rs1060501598
NM_000051.3(ATM):c.289del (p.Ile97fs) rs878853497
NM_000051.3(ATM):c.2901T>G (p.Leu967=) rs778731866
NM_000051.3(ATM):c.2908C>T (p.Leu970=) rs1060504260
NM_000051.3(ATM):c.2909T>C (p.Leu970Pro) rs587782521
NM_000051.3(ATM):c.290T>C (p.Ile97Thr) rs786203011
NM_000051.3(ATM):c.2913A>G (p.Lys971=) rs1057522291
NM_000051.3(ATM):c.2915C>T (p.Pro972Leu) rs750093937
NM_000051.3(ATM):c.2918T>C (p.Leu973Pro) rs1555084757
NM_000051.3(ATM):c.2919A>G (p.Leu973=) rs587779829
NM_000051.3(ATM):c.2921+10T>G rs1060504278
NM_000051.3(ATM):c.2921+1G>A rs587781558
NM_000051.3(ATM):c.2921+1G>C rs587781558
NM_000051.3(ATM):c.2921+1G>T rs587781558
NM_000051.3(ATM):c.2921+2dup rs1565424654
NM_000051.3(ATM):c.2921+4A>C rs1565424660
NM_000051.3(ATM):c.2921C>A (p.Ser974Tyr)
NM_000051.3(ATM):c.2921C>G (p.Ser974Cys) rs538105098
NM_000051.3(ATM):c.2921C>T (p.Ser974Phe) rs538105098
NM_000051.3(ATM):c.2922-1G>T rs1555084931
NM_000051.3(ATM):c.2922-3C>T
NM_000051.3(ATM):c.2922-50_2938del67 rs1555084836
NM_000051.3(ATM):c.2922-50_2940delGTGTTCTGTTAAGCTTATAAAGTTGAACTTTTTTTTTTTTTTTACCACAGCAATGTGTGTTCTTTGTAT rs1555084832
NM_000051.3(ATM):c.2922-7dup rs932219783
NM_000051.3(ATM):c.2922-8T>A rs545892367
NM_000051.3(ATM):c.2924A>G (p.Asn975Ser) rs730881354
NM_000051.3(ATM):c.2925T>C (p.Asn975=) rs765848319
NM_000051.3(ATM):c.2926G>T (p.Val976Leu)
NM_000051.3(ATM):c.2926_2927GT[2] (p.Cys977fs) rs1555084947
NM_000051.3(ATM):c.2927T>C (p.Val976Ala) rs146145357
NM_000051.3(ATM):c.292A>C (p.Ser98Arg) rs768318076
NM_000051.3(ATM):c.2930G>A (p.Cys977Tyr) rs876660628
NM_000051.3(ATM):c.2932T>C (p.Ser978Pro) rs139552233
NM_000051.3(ATM):c.2934T>G (p.Ser978=) rs368678134
NM_000051.3(ATM):c.2937G>T (p.Leu979Phe) rs1166904824
NM_000051.3(ATM):c.2938del (p.Tyr980fs) rs1565425118
NM_000051.3(ATM):c.2941C>T (p.Arg981Cys) rs587780619
NM_000051.3(ATM):c.2942G>A (p.Arg981His) rs755896387
NM_000051.3(ATM):c.2944C>T (p.Arg982Cys) rs587779830
NM_000051.3(ATM):c.2945G>A (p.Arg982His) rs749471737
NM_000051.3(ATM):c.2945G>C (p.Arg982Pro)
NM_000051.3(ATM):c.2947G>A (p.Asp983Asn) rs1060501560
NM_000051.3(ATM):c.2949C>T (p.Asp983=) rs1555085022
NM_000051.3(ATM):c.2951A>G (p.Gln984Arg)
NM_000051.3(ATM):c.2954A>G (p.Asp985Gly) rs864622159
NM_000051.3(ATM):c.2954A>T (p.Asp985Val) rs864622159
NM_000051.3(ATM):c.2955T>C (p.Asp985=) rs1555085034
NM_000051.3(ATM):c.2958T>G (p.Val986=) rs745971584
NM_000051.3(ATM):c.2959T>G (p.Cys987Gly)
NM_000051.3(ATM):c.295A>G (p.Ser99Gly) rs137882485
NM_000051.3(ATM):c.2960G>A (p.Cys987Tyr) rs1555085052
NM_000051.3(ATM):c.2966dup (p.Ile990fs) rs1555085060
NM_000051.3(ATM):c.2967T>C (p.Thr989=) rs144145128
NM_000051.3(ATM):c.2975A>G (p.Asn992Ser) rs1060501589
NM_000051.3(ATM):c.2976C>G (p.Asn992Lys) rs1283172338
NM_000051.3(ATM):c.2978A>G (p.His993Arg) rs878853498
NM_000051.3(ATM):c.2978A>T (p.His993Leu) rs878853498
NM_000051.3(ATM):c.2982C>T (p.Val994=) rs200541844
NM_000051.3(ATM):c.2983C>T (p.Leu995Phe) rs587779831
NM_000051.3(ATM):c.2985T>A (p.Leu995=) rs1555085087
NM_000051.3(ATM):c.2985_2988del (p.Leu995_His996insTer) rs1060501600
NM_000051.3(ATM):c.2987A>C (p.His996Pro)
NM_000051.3(ATM):c.2987A>G (p.His996Arg) rs876660034
NM_000051.3(ATM):c.2989G>A (p.Val997Ile) rs1487902875
NM_000051.3(ATM):c.2992G>A (p.Val998Met)
NM_000051.3(ATM):c.2999dup (p.Asn1000fs) rs1057516250
NM_000051.3(ATM):c.299T>A (p.Leu100Ter)
NM_000051.3(ATM):c.2T>C (p.Met1Thr) rs786203606
NM_000051.3(ATM):c.3003A>C (p.Leu1001=) rs765969190
NM_000051.3(ATM):c.3003A>G (p.Leu1001=) rs765969190
NM_000051.3(ATM):c.3004G>C (p.Gly1002Arg) rs1565425547
NM_000051.3(ATM):c.300G>A (p.Leu100=) rs878853499
NM_000051.3(ATM):c.3011G>A (p.Ser1004Asn) rs1060501696
NM_000051.3(ATM):c.3012C>T (p.Ser1004=) rs751260996
NM_000051.3(ATM):c.3014A>G (p.Asn1005Ser) rs146531614
NM_000051.3(ATM):c.3016A>G (p.Met1006Val) rs139893395
NM_000051.3(ATM):c.3017T>C (p.Met1006Thr) rs1421074475
NM_000051.3(ATM):c.301G>A (p.Val101Ile) rs758483894
NM_000051.3(ATM):c.3024T>G (p.Ser1008=) rs1060504274
NM_000051.3(ATM):c.3024dup (p.Glu1009Ter) rs1555085172
NM_000051.3(ATM):c.3025G>C (p.Glu1009Gln) rs1064794039
NM_000051.3(ATM):c.3027G>A (p.Glu1009=) rs1060504299
NM_000051.3(ATM):c.3030C>T (p.Asn1010=) rs876660913
NM_000051.3(ATM):c.3035G>A (p.Arg1012Lys) rs1565425752
NM_000051.3(ATM):c.3040G>A (p.Ala1014Thr) rs587782163
NM_000051.3(ATM):c.3042T>C (p.Ala1014=) rs1555085205
NM_000051.3(ATM):c.3044A>G (p.Gln1015Arg) rs587778070
NM_000051.3(ATM):c.3044_3045del (p.Gln1015fs) rs1555085217
NM_000051.3(ATM):c.3047G>T (p.Gly1016Val) rs1565425832
NM_000051.3(ATM):c.3048A>G (p.Gly1016=) rs786203820
NM_000051.3(ATM):c.3049C>T (p.Gln1017Ter) rs730881388
NM_000051.3(ATM):c.3055C>G (p.Leu1019Val) rs863224560
NM_000051.3(ATM):c.3059C>A (p.Thr1020Lys)
NM_000051.3(ATM):c.3059C>T (p.Thr1020Ile) rs186626274
NM_000051.3(ATM):c.305A>T (p.Lys102Ile) rs1555055293
NM_000051.3(ATM):c.3064A>G (p.Ile1022Val) rs786202470
NM_000051.3(ATM):c.3064A>T (p.Ile1022Phe)
NM_000051.3(ATM):c.3067G>A (p.Gly1023Arg) rs730882129
NM_000051.3(ATM):c.3068del (p.Gly1023fs) rs1057516590
NM_000051.3(ATM):c.306A>G (p.Lys102=) rs1060501626
NM_000051.3(ATM):c.3070G>A (p.Ala1024Thr) rs1397754737
NM_000051.3(ATM):c.3070G>C (p.Ala1024Pro)
NM_000051.3(ATM):c.3071C>T (p.Ala1024Val) rs746133264
NM_000051.3(ATM):c.3074T>G (p.Phe1025Cys) rs1555085266
NM_000051.3(ATM):c.3075T>G (p.Phe1025Leu)
NM_000051.3(ATM):c.3077+1G>A rs192810283
NM_000051.3(ATM):c.3077+4G>A rs201222237
NM_000051.3(ATM):c.3077+5G>A rs777003996
NM_000051.3(ATM):c.3077+6T>A rs1565426002
NM_000051.3(ATM):c.3077+8C>A
NM_000051.3(ATM):c.3077+8C>G rs752601608
NM_000051.3(ATM):c.3077G>A (p.Trp1026Ter) rs587782103
NM_000051.3(ATM):c.3078-1G>A rs750663117
NM_000051.3(ATM):c.3078-5T>G rs1565427457
NM_000051.3(ATM):c.3078G>A (p.Trp1026Ter) rs876660869
NM_000051.3(ATM):c.3078G>T (p.Trp1026Cys) rs876660869
NM_000051.3(ATM):c.3080A>G (p.His1027Arg) rs786204217
NM_000051.3(ATM):c.3081T>A (p.His1027Gln) rs864622587
NM_000051.3(ATM):c.3081T>C (p.His1027=) rs864622587
NM_000051.3(ATM):c.3082C>G (p.Leu1028Val) rs1263930458
NM_000051.3(ATM):c.3083T>G (p.Leu1028Arg) rs1555085776
NM_000051.3(ATM):c.3085A>T (p.Thr1029Ser) rs730881355
NM_000051.3(ATM):c.3085dup (p.Thr1029fs) rs876658502
NM_000051.3(ATM):c.3087A>C (p.Thr1029=) rs1555085787
NM_000051.3(ATM):c.3088A>G (p.Lys1030Glu) rs863224561
NM_000051.3(ATM):c.3092A>T (p.Glu1031Val) rs758708495
NM_000051.3(ATM):c.3096G>A (p.Arg1032=) rs1555085805
NM_000051.3(ATM):c.3102T>C (p.Tyr1034=) rs780240314
NM_000051.3(ATM):c.3102T>G (p.Tyr1034Ter) rs780240314
NM_000051.3(ATM):c.3105A>G (p.Ile1035Met) rs1565427678
NM_000051.3(ATM):c.3106T>C (p.Phe1036Leu) rs747079458
NM_000051.3(ATM):c.3108C>T (p.Phe1036=) rs867514913
NM_000051.3(ATM):c.3112G>A (p.Val1038Ile)
NM_000051.3(ATM):c.3112G>C (p.Val1038Leu) rs876659877
NM_000051.3(ATM):c.3115A>C (p.Arg1039=) rs1060504309
NM_000051.3(ATM):c.3117A>G (p.Arg1039=) rs55784207
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.311del (p.Phe104fs) rs1555055309
NM_000051.3(ATM):c.3120G>C (p.Met1040Ile) rs781519408
NM_000051.3(ATM):c.3126A>G (p.Leu1042=) rs770038542
NM_000051.3(ATM):c.312C>T (p.Phe104=) rs1060504310
NM_000051.3(ATM):c.3131A>G (p.Asn1044Ser) rs1565427876
NM_000051.3(ATM):c.3135C>T (p.Cys1045=) rs773577455
NM_000051.3(ATM):c.3137T>C (p.Leu1046Pro) rs568461905
NM_000051.3(ATM):c.3138T>G (p.Leu1046=) rs3092858
NM_000051.3(ATM):c.3143C>T (p.Thr1048Ile) rs1565427949
NM_000051.3(ATM):c.3146T>C (p.Leu1049Ser) rs1373504805
NM_000051.3(ATM):c.3146_3153+2del
NM_000051.3(ATM):c.3147G>T (p.Leu1049Phe) rs1060501686
NM_000051.3(ATM):c.3149T>C (p.Leu1050Pro) rs1555085890
NM_000051.3(ATM):c.3150T>C (p.Leu1050=) rs3092859
NM_000051.3(ATM):c.3152A>C (p.Glu1051Ala) rs876659217
NM_000051.3(ATM):c.3153+4A>T rs1060501620
NM_000051.3(ATM):c.3153+7_3153+8insA rs878853500
NM_000051.3(ATM):c.3153+9T>C rs770464168
NM_000051.3(ATM):c.3154-1G>A rs1555085973
NM_000051.3(ATM):c.3154-2A>G rs730881357
NM_000051.3(ATM):c.3154-4G>A rs199543313
NM_000051.3(ATM):c.3154-4G>T rs199543313
NM_000051.3(ATM):c.3154-5C>T rs55719759
NM_000051.3(ATM):c.3155C>T (p.Ala1052Val) rs876660350
NM_000051.3(ATM):c.3161C>A (p.Pro1054His) rs1800057
NM_000051.3(ATM):c.3161C>G (p.Pro1054Arg) rs1800057
NM_000051.3(ATM):c.3167C>A (p.Ser1056Ter) rs1565428419
NM_000051.3(ATM):c.3174G>C (p.Trp1058Cys) rs1064796080
NM_000051.3(ATM):c.3175G>A (p.Ala1059Thr) rs370282831
NM_000051.3(ATM):c.3176C>T (p.Ala1059Val) rs761590782
NM_000051.3(ATM):c.317A>G (p.Lys106Arg) rs878853501
NM_000051.3(ATM):c.318A>C (p.Lys106Asn) rs1555055319
NM_000051.3(ATM):c.3190A>G (p.Met1064Val) rs79431304
NM_000051.3(ATM):c.3191T>C (p.Met1064Thr)
NM_000051.3(ATM):c.3194G>A (p.Gly1065Glu) rs762810180
NM_000051.3(ATM):c.3194G>T (p.Gly1065Val) rs762810180
NM_000051.3(ATM):c.3197A>C (p.Lys1066Thr) rs926564671
NM_000051.3(ATM):c.3198A>C (p.Lys1066Asn)
NM_000051.3(ATM):c.319T>C (p.Cys107Arg) rs864622508
NM_000051.3(ATM):c.3200A>G (p.Asp1067Gly)
NM_000051.3(ATM):c.3204T>C (p.Phe1068=) rs1555086059
NM_000051.3(ATM):c.3206del (p.Pro1069fs) rs1060501677
NM_000051.3(ATM):c.3207T>C (p.Pro1069=) rs878853502
NM_000051.3(ATM):c.3208G>A (p.Val1070Ile) rs587780620
NM_000051.3(ATM):c.320G>A (p.Cys107Tyr) rs142358238
NM_000051.3(ATM):c.3212A>G (p.Asn1071Ser) rs755237639
NM_000051.3(ATM):c.3214G>T (p.Glu1072Ter) rs1060501687
NM_000051.3(ATM):c.3216A>G (p.Glu1072=) rs373699194
NM_000051.3(ATM):c.3218dup (p.Phe1074fs) rs876660741
NM_000051.3(ATM):c.3219A>G (p.Val1073=) rs752849892
NM_000051.3(ATM):c.3225A>G (p.Thr1075=) rs1555086107
NM_000051.3(ATM):c.322G>A (p.Ala108Thr) rs730881370
NM_000051.3(ATM):c.3231dup (p.Leu1078fs) rs1057517097
NM_000051.3(ATM):c.3235_3236delinsTT (p.Ala1079Phe) rs1555086120
NM_000051.3(ATM):c.3236C>G (p.Ala1079Gly) rs778233602
NM_000051.3(ATM):c.3237T>C (p.Ala1079=) rs564238520
NM_000051.3(ATM):c.3239A>T (p.Asp1080Val) rs757617016
NM_000051.3(ATM):c.323C>G (p.Ala108Gly) rs766951228
NM_000051.3(ATM):c.3240C>A (p.Asp1080Glu) rs149911447
NM_000051.3(ATM):c.3242A>G (p.Asn1081Ser) rs368111672
NM_000051.3(ATM):c.3242_3245del (p.Asn1081fs) rs1060501587
NM_000051.3(ATM):c.3244C>T (p.His1082Tyr) rs1302626569
NM_000051.3(ATM):c.3245A>G (p.His1082Arg) rs1009749513
NM_000051.3(ATM):c.3245_3247delinsTGAT (p.His1082fs) rs587776549
NM_000051.3(ATM):c.3249C>G (p.His1083Gln) rs1246816005
NM_000051.3(ATM):c.3250C>T (p.Gln1084Ter)
NM_000051.3(ATM):c.3252_3259del (p.Gln1084fs) rs876658402
NM_000051.3(ATM):c.3253G>A (p.Val1085Ile) rs1555086177
NM_000051.3(ATM):c.3256C>T (p.Arg1086Cys) rs201780199
NM_000051.3(ATM):c.3257G>A (p.Arg1086His) rs769857066
NM_000051.3(ATM):c.3257G>T (p.Arg1086Leu) rs769857066
NM_000051.3(ATM):c.3261del (p.Met1087fs) rs1565429054
NM_000051.3(ATM):c.3265G>T (p.Ala1089Ser) rs730881358
NM_000051.3(ATM):c.3269C>T (p.Ala1090Val)
NM_000051.3(ATM):c.3270_3271AG[1] (p.Glu1091fs) rs1565429102
NM_000051.3(ATM):c.3273G>A (p.Glu1091=) rs762860946
NM_000051.3(ATM):c.3275C>A (p.Ser1092Ter)
NM_000051.3(ATM):c.3275C>T (p.Ser1092Leu)
NM_000051.3(ATM):c.3277A>G (p.Ile1093Val) rs876659667
NM_000051.3(ATM):c.3280A>C (p.Asn1094His)
NM_000051.3(ATM):c.3281A>G (p.Asn1094Ser) rs199883473
NM_000051.3(ATM):c.3281del (p.Asn1094fs) rs776516754
NM_000051.3(ATM):c.3283A>C (p.Arg1095=) rs876660302
NM_000051.3(ATM):c.3284+1G>A rs864622129
NM_000051.3(ATM):c.3284+1G>C rs864622129
NM_000051.3(ATM):c.3284+3A>G
NM_000051.3(ATM):c.3284+4A>G
NM_000051.3(ATM):c.3284+6G>C rs1228954245
NM_000051.3(ATM):c.3284+7G>A rs371629629
NM_000051.3(ATM):c.3284+7G>C rs371629629
NM_000051.3(ATM):c.3284+8dupG rs886047611
NM_000051.3(ATM):c.3285-2A>G
NM_000051.3(ATM):c.3285-2_3296dup
NM_000051.3(ATM):c.3285-9delT rs1799757
NM_000051.3(ATM):c.3291C>G (p.Phe1097Leu) rs876658491
NM_000051.3(ATM):c.3292del (p.Gln1098fs) rs1555090075
NM_000051.3(ATM):c.3293A>G (p.Gln1098Arg) rs1060501590
NM_000051.3(ATM):c.3295G>A (p.Asp1099Asn) rs372966951
NM_000051.3(ATM):c.3295G>T (p.Asp1099Tyr) rs372966951
NM_000051.3(ATM):c.3299C>T (p.Thr1100Met) rs189445371
NM_000051.3(ATM):c.3300G>A (p.Thr1100=) rs587780621
NM_000051.3(ATM):c.3303G>A (p.Lys1101=) rs925487325
NM_000051.3(ATM):c.3304G>A (p.Gly1102Arg) rs147557621
NM_000051.3(ATM):c.3307G>A (p.Asp1103Asn) rs1555090114
NM_000051.3(ATM):c.3307G>C (p.Asp1103His) rs1555090114
NM_000051.3(ATM):c.3308A>G (p.Asp1103Gly) rs1555090118
NM_000051.3(ATM):c.3308A>T (p.Asp1103Val)
NM_000051.3(ATM):c.330A>C (p.Arg110Ser) rs1555055350
NM_000051.3(ATM):c.331+1G>A rs1555055356
NM_000051.3(ATM):c.331+2T>G rs1555055358
NM_000051.3(ATM):c.331+5G>A rs752135143
NM_000051.3(ATM):c.331+7G>A rs1184757004
NM_000051.3(ATM):c.331+8A>G rs878853503
NM_000051.3(ATM):c.3311C>A (p.Ser1104Tyr)
NM_000051.3(ATM):c.3311C>G (p.Ser1104Cys) rs1555090126
NM_000051.3(ATM):c.3315dup (p.Arg1106fs) rs1057516301
NM_000051.3(ATM):c.332-3T>C rs376116157
NM_000051.3(ATM):c.3320T>A (p.Leu1107Ter) rs1060501711
NM_000051.3(ATM):c.3320_3323del (p.Arg1106_Leu1107insTer) rs1555090139
NM_000051.3(ATM):c.3324G>C (p.Leu1108=) rs762269034
NM_000051.3(ATM):c.3328G>A (p.Ala1110Thr) rs147112946
NM_000051.3(ATM):c.332_334delGAG rs1060501621
NM_000051.3(ATM):c.3331C>G (p.Leu1111Val) rs587779832
NM_000051.3(ATM):c.3336T>A (p.Pro1112=) rs758784434
NM_000051.3(ATM):c.3337T>A (p.Leu1113Met)
NM_000051.3(ATM):c.3338T>C (p.Leu1113Ser)
NM_000051.3(ATM):c.3341A>G (p.Lys1114Arg) rs777705500
NM_000051.3(ATM):c.3341A>T (p.Lys1114Met)
NM_000051.3(ATM):c.3342G>A (p.Lys1114=) rs138393322
NM_000051.3(ATM):c.3347A>C (p.Gln1116Pro) rs1555090213
NM_000051.3(ATM):c.3349C>T (p.Gln1117Ter) rs786201957
NM_000051.3(ATM):c.334G>A (p.Ala112Thr) rs146382972
NM_000051.3(ATM):c.3351_3354del (p.Thr1118fs) rs1057516446
NM_000051.3(ATM):c.3352A>G (p.Thr1118Ala) rs572564322
NM_000051.3(ATM):c.3353C>T (p.Thr1118Ile) rs539847847
NM_000051.3(ATM):c.3354A>G (p.Thr1118=) rs377316982
NM_000051.3(ATM):c.3355G>T (p.Ala1119Ser) rs786201956
NM_000051.3(ATM):c.3362A>G (p.Glu1121Gly) rs876660607
NM_000051.3(ATM):c.3367G>C (p.Ala1123Pro) rs1060501581
NM_000051.3(ATM):c.3369A>G (p.Ala1123=) rs587780543
NM_000051.3(ATM):c.3371A>G (p.Tyr1124Cys) rs876660498
NM_000051.3(ATM):c.3371A>T (p.Tyr1124Phe) rs876660498
NM_000051.3(ATM):c.3372C>G (p.Tyr1124Ter) rs587779833
NM_000051.3(ATM):c.3376A>G (p.Lys1126Glu)
NM_000051.3(ATM):c.3378A>G (p.Lys1126=) rs149182949
NM_000051.3(ATM):c.337C>T (p.Pro113Ser) rs1060501678
NM_000051.3(ATM):c.3380C>A (p.Ala1127Asp) rs1555090340
NM_000051.3(ATM):c.3381_3384del (p.Gln1128fs) rs587781971
NM_000051.3(ATM):c.3382C>G (p.Gln1128Glu) rs876659825
NM_000051.3(ATM):c.3382C>T (p.Gln1128Ter) rs876659825
NM_000051.3(ATM):c.3383A>G (p.Gln1128Arg) rs2229020
NM_000051.3(ATM):c.3388G>A (p.Gly1130Arg)
NM_000051.3(ATM):c.3389G>C (p.Gly1130Ala) rs1060501544
NM_000051.3(ATM):c.3398A>T (p.Glu1133Val) rs1565439583
NM_000051.3(ATM):c.3399A>C (p.Glu1133Asp) rs1555090364
NM_000051.3(ATM):c.339T>C (p.Pro113=) rs1555059023
NM_000051.3(ATM):c.3400A>C (p.Met1134Leu)
NM_000051.3(ATM):c.3400A>G (p.Met1134Val)
NM_000051.3(ATM):c.3402+3A>G rs786203688
NM_000051.3(ATM):c.3402+5T>C rs1057520229
NM_000051.3(ATM):c.3403-15T>A rs79701258
NM_000051.3(ATM):c.3403-16_3403-15insA rs569564716
NM_000051.3(ATM):c.3403-3A>C rs374866638
NM_000051.3(ATM):c.3407A>G (p.His1136Arg) rs768490475
NM_000051.3(ATM):c.3408T>G (p.His1136Gln) rs1565441369
NM_000051.3(ATM):c.3411T>C (p.Ser1137=) rs369518512
NM_000051.3(ATM):c.3415G>A (p.Glu1139Lys) rs786203048
NM_000051.3(ATM):c.3427A>T (p.Thr1143Ser) rs1555091146
NM_000051.3(ATM):c.342G>A (p.Arg114=) rs1555059036
NM_000051.3(ATM):c.3432G>A (p.Leu1144=) rs1060501625
NM_000051.3(ATM):c.3436G>T (p.Glu1146Ter) rs1565441511
NM_000051.3(ATM):c.3437A>G (p.Glu1146Gly) rs1555091169
NM_000051.3(ATM):c.3439A>G (p.Ile1147Val) rs769853739
NM_000051.3(ATM):c.343C>G (p.Leu115Val)
NM_000051.3(ATM):c.3446A>G (p.Asn1149Ser) rs1414846775
NM_000051.3(ATM):c.3449G>C (p.Arg1150Thr) rs555219189
NM_000051.3(ATM):c.3450_3454del (p.Arg1150fs) rs1060501676
NM_000051.3(ATM):c.3454T>G (p.Ser1152Ala) rs1176188506
NM_000051.3(ATM):c.3457G>C (p.Val1153Leu) rs863224562
NM_000051.3(ATM):c.3467C>T (p.Thr1156Met) rs759951393
NM_000051.3(ATM):c.3468G>A (p.Thr1156=) rs148358896
NM_000051.3(ATM):c.3471G>A (p.Leu1157=) rs878853504
NM_000051.3(ATM):c.3473T>C (p.Ile1158Thr) rs1060501588
NM_000051.3(ATM):c.3478G>C (p.Val1160Leu) rs567344545
NM_000051.3(ATM):c.3480G>T (p.Val1160=) rs1001303564
NM_000051.3(ATM):c.3480_3492dup (p.Ser1165delinsGlyPheIleLeuTer) rs1555091238
NM_000051.3(ATM):c.3481G>A (p.Val1161Ile) rs1565441792
NM_000051.3(ATM):c.3488C>A (p.Ser1163Tyr) rs372766122
NM_000051.3(ATM):c.3489C>T (p.Ser1163=) rs864622097
NM_000051.3(ATM):c.3493A>T (p.Ser1165Cys) rs1351059730
NM_000051.3(ATM):c.3495C>A (p.Ser1165Arg) rs878853505
NM_000051.3(ATM):c.3499A>G (p.Ile1167Val) rs1222634243
NM_000051.3(ATM):c.34T>C (p.Cys12Arg) rs1060501597
NM_000051.3(ATM):c.3501C>T (p.Ile1167=) rs1555091279
NM_000051.3(ATM):c.3502T>C (p.Cys1168Arg) rs749933079
NM_000051.3(ATM):c.3504C>T (p.Cys1168=) rs876658368
NM_000051.3(ATM):c.3505G>A (p.Glu1169Lys) rs200765255
NM_000051.3(ATM):c.3509A>C (p.Lys1170Thr)
NM_000051.3(ATM):c.350G>T (p.Cys117Phe) rs1555059066
NM_000051.3(ATM):c.3510dup (p.Gln1171fs) rs876658899
NM_000051.3(ATM):c.3511C>T (p.Gln1171Ter) rs876659067
NM_000051.3(ATM):c.3511_3512dup (p.Gln1171fs) rs1555091302
NM_000051.3(ATM):c.3513G>T (p.Gln1171His)
NM_000051.3(ATM):c.3514G>C (p.Ala1172Pro) rs779946941
NM_000051.3(ATM):c.3516_3519TTTG[1] (p.Phe1174fs) rs1394502687
NM_000051.3(ATM):c.3517T>C (p.Leu1173=) rs141460670
NM_000051.3(ATM):c.3517T>G (p.Leu1173Val)
NM_000051.3(ATM):c.3519G>C (p.Leu1173Phe) rs1565442034
NM_000051.3(ATM):c.3526del (p.Leu1176fs) rs730881302
NM_000051.3(ATM):c.3528G>T (p.Leu1176=) rs748335454
NM_000051.3(ATM):c.3530G>C (p.Cys1177Ser) rs587782470
NM_000051.3(ATM):c.3532A>G (p.Lys1178Glu) rs1555091359
NM_000051.3(ATM):c.3537_3538TG[1] (p.Val1180fs) rs1555091367
NM_000051.3(ATM):c.3538G>A (p.Val1180Met) rs1060501531
NM_000051.3(ATM):c.353A>G (p.Gln118Arg) rs1555059070
NM_000051.3(ATM):c.3541A>T (p.Lys1181Ter) rs1057516981
NM_000051.3(ATM):c.3543A>G (p.Lys1181=) rs1555091382
NM_000051.3(ATM):c.3544G>C (p.Glu1182Gln) rs377349886
NM_000051.3(ATM):c.3549T>C (p.Asn1183=) rs767377764
NM_000051.3(ATM):c.3558A>C (p.Glu1186Asp) rs12786957
NM_000051.3(ATM):c.3565C>T (p.Leu1189Phe) rs370602633
NM_000051.3(ATM):c.3569T>C (p.Val1190Ala) rs1060501708
NM_000051.3(ATM):c.3576+4T>C
NM_000051.3(ATM):c.3576G>A (p.Lys1192=) rs587776551
NM_000051.3(ATM):c.3577-13T>C rs587780856
NM_000051.3(ATM):c.3577-1G>C rs1057517226
NM_000051.3(ATM):c.3577-6G>A rs56006345
NM_000051.3(ATM):c.3577-7C>T rs558667657
NM_000051.3(ATM):c.3577-9_3583del rs1555092219
NM_000051.3(ATM):c.3577G>A (p.Val1193Ile) rs779148780
NM_000051.3(ATM):c.3578T>C (p.Val1193Ala)
NM_000051.3(ATM):c.357dup (p.Leu120fs)
NM_000051.3(ATM):c.3584A>G (p.Glu1195Gly) rs1167713135
NM_000051.3(ATM):c.3588A>G (p.Lys1196=) rs376524625
NM_000051.3(ATM):c.3589G>C (p.Val1197Leu) rs879254024
NM_000051.3(ATM):c.3590T>C (p.Val1197Ala) rs1555092259
NM_000051.3(ATM):c.3592T>C (p.Ser1198Pro) rs1555092260
NM_000051.3(ATM):c.3596A>G (p.Glu1199Gly) rs876660855
NM_000051.3(ATM):c.3601T>A (p.Phe1201Ile) rs576884305
NM_000051.3(ATM):c.3602T>C (p.Phe1201Ser) rs1565444496
NM_000051.3(ATM):c.3602_3603del (p.Phe1201fs) rs1057517129
NM_000051.3(ATM):c.3603del (p.Phe1201fs) rs1057517129
NM_000051.3(ATM):c.3606A>G (p.Gly1202=) rs1189826741
NM_000051.3(ATM):c.3608A>G (p.Tyr1203Cys) rs1453849799
NM_000051.3(ATM):c.3609del (p.Gly1202_Tyr1203insTer) rs1555092297
NM_000051.3(ATM):c.3613C>T (p.Arg1205Cys) rs760928285
NM_000051.3(ATM):c.3614G>A (p.Arg1205His) rs769106895
NM_000051.3(ATM):c.3617T>C (p.Leu1206Ser) rs1555092317
NM_000051.3(ATM):c.3618A>G (p.Leu1206=) rs786201151
NM_000051.3(ATM):c.361T>A (p.Leu121Ile) rs587782178
NM_000051.3(ATM):c.3620A>G (p.Glu1207Gly) rs1555092330
NM_000051.3(ATM):c.3626_3627del (p.Phe1209fs) rs587782861
NM_000051.3(ATM):c.3627T>C (p.Phe1209=) rs762605020
NM_000051.3(ATM):c.3627del (p.Phe1209fs) rs587782861
NM_000051.3(ATM):c.3628A>G (p.Met1210Val) rs138212452
NM_000051.3(ATM):c.3630G>A (p.Met1210Ile) rs587778073
NM_000051.3(ATM):c.3631G>A (p.Ala1211Thr)
NM_000051.3(ATM):c.3639T>C (p.His1213=) rs142766756
NM_000051.3(ATM):c.3639T>G (p.His1213Gln) rs142766756
NM_000051.3(ATM):c.3658G>C (p.Glu1220Gln) rs1565444811
NM_000051.3(ATM):c.365A>C (p.Asn122Thr) rs1060501596
NM_000051.3(ATM):c.3660A>G (p.Glu1220=) rs876660835
NM_000051.3(ATM):c.3663G>A (p.Trp1221Ter) rs864622490
NM_000051.3(ATM):c.3665T>C (p.Leu1222Pro) rs863224563
NM_000051.3(ATM):c.366T>C (p.Asn122=) rs1178025248
NM_000051.3(ATM):c.3673C>T (p.Gln1225Ter) rs1555092430
NM_000051.3(ATM):c.3676G>C (p.Asp1226His) rs370974808
NM_000051.3(ATM):c.3677A>G (p.Asp1226Gly) rs1555092445
NM_000051.3(ATM):c.3679A>G (p.Thr1227Ala) rs1047871047
NM_000051.3(ATM):c.3689A>G (p.Asn1230Ser) rs587782195
NM_000051.3(ATM):c.368A>G (p.Tyr123Cys) rs759673348
NM_000051.3(ATM):c.368del (p.Tyr123fs) rs730881296
NM_000051.3(ATM):c.3693_3695del (p.Leu1231_Ser1232delinsPhe) rs786203389
NM_000051.3(ATM):c.3693_3697del (p.Leu1231fs) rs1555092477
NM_000051.3(ATM):c.3694T>C (p.Ser1232Pro)
NM_000051.3(ATM):c.3695C>G (p.Ser1232Cys) rs367603277
NM_000051.3(ATM):c.3695_3697CTT[1] (p.Ser1233del) rs1555092499
NM_000051.3(ATM):c.3702T>G (p.Phe1234Leu) rs876659605
NM_000051.3(ATM):c.3707_3711TTATT[1] (p.Leu1238fs) rs786201675
NM_000051.3(ATM):c.3709A>T (p.Ile1237Phe) rs1555092528
NM_000051.3(ATM):c.370A>G (p.Ile124Val) rs148590073
NM_000051.3(ATM):c.3710T>G (p.Ile1237Ser) rs786202897
NM_000051.3(ATM):c.371T>C (p.Ile124Thr) rs1555059132
NM_000051.3(ATM):c.3723C>T (p.Tyr1241=) rs772331389
NM_000051.3(ATM):c.3725C>A (p.Thr1242Lys) rs1266811647
NM_000051.3(ATM):c.3725C>G (p.Thr1242Arg) rs1266811647
NM_000051.3(ATM):c.3728A>G (p.Asn1243Ser) rs730881363
NM_000051.3(ATM):c.372C>A (p.Ile124=) rs773495195
NM_000051.3(ATM):c.372C>T (p.Ile124=) rs773495195
NM_000051.3(ATM):c.373A>G (p.Met125Val) rs761137313
NM_000051.3(ATM):c.3742T>G (p.Tyr1248Asp)
NM_000051.3(ATM):c.3743A>C (p.Tyr1248Ser) rs766226370
NM_000051.3(ATM):c.3743A>G (p.Tyr1248Cys) rs766226370
NM_000051.3(ATM):c.3744T>C (p.Tyr1248=) rs1555092589
NM_000051.3(ATM):c.3746+4A>C rs1555092593
NM_000051.3(ATM):c.3746+5G>A rs876658419
NM_000051.3(ATM):c.3747-10C>G rs775274473
NM_000051.3(ATM):c.3747-2A>G rs1057517213
NM_000051.3(ATM):c.3747-3_3751del rs1555093256
NM_000051.3(ATM):c.3747-7T>C rs1057523136
NM_000051.3(ATM):c.3749C>A (p.Ser1250Tyr) rs1555093273
NM_000051.3(ATM):c.3751T>C (p.Cys1251Arg) rs763730862
NM_000051.3(ATM):c.3754_3755TA[3] (p.Lys1253fs) rs1555093289
NM_000051.3(ATM):c.3754_3756delinsCA (p.Tyr1252fs) rs786201886
NM_000051.3(ATM):c.3756T>A (p.Tyr1252Ter) rs886039637
NM_000051.3(ATM):c.3760del (p.Val1254fs) rs786203507
NM_000051.3(ATM):c.3768T>G (p.Ile1256Met)
NM_000051.3(ATM):c.3770C>T (p.Pro1257Leu)
NM_000051.3(ATM):c.3772C>A (p.His1258Asn) rs587782741
NM_000051.3(ATM):c.3777G>A (p.Leu1259=) rs780192529
NM_000051.3(ATM):c.3783T>G (p.Ile1261Met)
NM_000051.3(ATM):c.3785G>A (p.Arg1262Lys) rs786203618
NM_000051.3(ATM):c.3785G>T (p.Arg1262Ile) rs786203618
NM_000051.3(ATM):c.3787A>G (p.Ser1263Gly) rs1276194109
NM_000051.3(ATM):c.378T>A (p.Asp126Glu) rs2234997
NM_000051.3(ATM):c.378del (p.Asp126fs) rs587781449
NM_000051.3(ATM):c.3793T>C (p.Phe1265Leu) rs371526361
NM_000051.3(ATM):c.3794T>C (p.Phe1265Ser) rs1565447114
NM_000051.3(ATM):c.379A>G (p.Thr127Ala) rs587781741
NM_000051.3(ATM):c.379A>T (p.Thr127Ser) rs587781741
NM_000051.3(ATM):c.37C>T (p.Arg13Cys) rs141586345
NM_000051.3(ATM):c.3800A>T (p.Glu1267Val) rs781357995
NM_000051.3(ATM):c.3802G>A (p.Val1268Met) rs863224564
NM_000051.3(ATM):c.3802del (p.Glu1267_Val1268insTer) rs587779834
NM_000051.3(ATM):c.3806A>G (p.Lys1269Arg) rs146017595
NM_000051.3(ATM):c.3817A>G (p.Asn1273Asp) rs876660767
NM_000051.3(ATM):c.381A>G (p.Thr127=) rs762582522
NM_000051.3(ATM):c.381del (p.Thr127_Val128insTer) rs587781831
NM_000051.3(ATM):c.3821A>G (p.Gln1274Arg) rs1060501624
NM_000051.3(ATM):c.3821_3822delinsTA (p.Gln1274Leu)
NM_000051.3(ATM):c.382G>A (p.Val128Met) rs587779835
NM_000051.3(ATM):c.3830A>G (p.Glu1277Gly) rs1555093463
NM_000051.3(ATM):c.3831G>C (p.Glu1277Asp) rs587781787
NM_000051.3(ATM):c.3832G>A (p.Asp1278Asn) rs730881365
NM_000051.3(ATM):c.3834C>A (p.Asp1278Glu) rs534864280
NM_000051.3(ATM):c.3841A>T (p.Ser1281Cys) rs370785959
NM_000051.3(ATM):c.3843T>G (p.Ser1281Arg) rs863224565
NM_000051.3(ATM):c.3844C>A (p.Leu1282Ile) rs876660568
NM_000051.3(ATM):c.3848T>C (p.Leu1283Pro) rs730881389
NM_000051.3(ATM):c.384G>C (p.Val128=) rs1555059177
NM_000051.3(ATM):c.3850del (p.Thr1284fs) rs876660865
NM_000051.3(ATM):c.3851C>G (p.Thr1284Arg) rs1200767902
NM_000051.3(ATM):c.3857G>T (p.Cys1286Phe) rs876660770
NM_000051.3(ATM):c.3866A>G (p.Lys1289Arg) rs876660633
NM_000051.3(ATM):c.3872T>C (p.Leu1291Pro) rs1555093536
NM_000051.3(ATM):c.3872T>G (p.Leu1291Arg) rs1555093536
NM_000051.3(ATM):c.3874G>C (p.Val1292Leu) rs878853506
NM_000051.3(ATM):c.3877_3993dup
NM_000051.3(ATM):c.3880dup (p.Ile1294fs) rs1057516541
NM_000051.3(ATM):c.3886C>T (p.Pro1296Ser) rs864622654
NM_000051.3(ATM):c.3890A>G (p.Tyr1297Cys)
NM_000051.3(ATM):c.3894dup (p.Ala1299fs) rs587781823
NM_000051.3(ATM):c.3897C>G (p.Ala1299=)
NM_000051.3(ATM):c.3898T>C (p.Tyr1300His)
NM_000051.3(ATM):c.3899A>G (p.Tyr1300Cys) rs183263185
NM_000051.3(ATM):c.389A>G (p.Asp130Gly) rs766034066
NM_000051.3(ATM):c.38G>A (p.Arg13His) rs778201041
NM_000051.3(ATM):c.3907A>G (p.Thr1303Ala) rs1060501662
NM_000051.3(ATM):c.3909C>T (p.Thr1303=) rs1555093618
NM_000051.3(ATM):c.390T>G (p.Asp130Glu)
NM_000051.3(ATM):c.3910A>G (p.Arg1304Gly) rs1565447611
NM_000051.3(ATM):c.3915C>T (p.Asp1305=) rs1429663437
NM_000051.3(ATM):c.3918T>C (p.Ser1306=) rs139632347
NM_000051.3(ATM):c.3919G>A (p.Gly1307Arg) rs568451087
NM_000051.3(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.3(ATM):c.3927A>G (p.Ala1309=) rs1555093665
NM_000051.3(ATM):c.3933A>G (p.Gln1311=) rs1060504304
NM_000051.3(ATM):c.3934A>G (p.Arg1312Gly) rs864622137
NM_000051.3(ATM):c.3935_3936GA[2] (p.Glu1313fs) rs1555093684
NM_000051.3(ATM):c.3935dup (p.Glu1313fs) rs876659672
NM_000051.3(ATM):c.3937G>C (p.Glu1313Gln) rs3092841
NM_000051.3(ATM):c.3938A>G (p.Glu1313Gly) rs1555093695
NM_000051.3(ATM):c.394T>C (p.Ser132Pro) rs786203851
NM_000051.3(ATM):c.3951G>A (p.Lys1317=) rs1485996895
NM_000051.3(ATM):c.3952G>T (p.Val1318Phe) rs587778074
NM_000051.3(ATM):c.3952del (p.Val1318fs)
NM_000051.3(ATM):c.3955_3958dup (p.Asp1320delinsValTer)
NM_000051.3(ATM):c.395C>T (p.Ser132Phe) rs750969764
NM_000051.3(ATM):c.3961A>G (p.Met1321Val) rs730881366
NM_000051.3(ATM):c.3962T>C (p.Met1321Thr) rs928038643
NM_000051.3(ATM):c.3963G>A (p.Met1321Ile) rs35184530
NM_000051.3(ATM):c.3964C>A (p.Leu1322Ile) rs144535256
NM_000051.3(ATM):c.3964C>T (p.Leu1322Phe) rs144535256
NM_000051.3(ATM):c.3965T>C (p.Leu1322Pro) rs786203306
NM_000051.3(ATM):c.3968A>G (p.Lys1323Arg) rs1295515377
NM_000051.3(ATM):c.3977A>G (p.Asn1326Ser) rs878853507
NM_000051.3(ATM):c.3978C>A (p.Asn1326Lys) rs778123057
NM_000051.3(ATM):c.397A>G (p.Asn133Asp) rs1565356855
NM_000051.3(ATM):c.3980T>G (p.Leu1327Ter) rs587782192
NM_000051.3(ATM):c.3981A>T (p.Leu1327Phe) rs1064794874
NM_000051.3(ATM):c.398A>T (p.Asn133Ile) rs730881330
NM_000051.3(ATM):c.3990del (p.Lys1330fs) rs1057517100
NM_000051.3(ATM):c.3992A>G (p.Gln1331Arg) rs876658669
NM_000051.3(ATM):c.3993+1G>A rs200196781
NM_000051.3(ATM):c.3993+1G>T rs200196781
NM_000051.3(ATM):c.3993+5G>T rs3092842
NM_000051.3(ATM):c.3993+6G>T rs878853508
NM_000051.3(ATM):c.3993G>A (p.Gln1331=) rs863224566
NM_000051.3(ATM):c.3993G>C (p.Gln1331His) rs863224566
NM_000051.3(ATM):c.3994-11_3994-4delTGCCCTTG rs1060501665
NM_000051.3(ATM):c.3994-159A>G rs864622543
NM_000051.3(ATM):c.3994-1G>T rs1057516238
NM_000051.3(ATM):c.3994-2A>G rs587782276
NM_000051.3(ATM):c.3994-3C>A rs1060501681
NM_000051.3(ATM):c.3994-4G>C rs1060504259
NM_000051.3(ATM):c.3994-7C>T rs769346400
NM_000051.3(ATM):c.3994-9C>T rs767111803
NM_000051.3(ATM):c.3997G>A (p.Asp1333Asn)
NM_000051.3(ATM):c.3998A>T (p.Asp1333Val) rs746709782
NM_000051.3(ATM):c.3G>A (p.Met1Ile) rs781404312
NM_000051.3(ATM):c.4001A>G (p.His1334Arg) rs780865776
NM_000051.3(ATM):c.4003T>G (p.Leu1335Val) rs863224568
NM_000051.3(ATM):c.4006T>C (p.Phe1336Leu) rs1565452452
NM_000051.3(ATM):c.4007del (p.Phe1336fs) rs1555095841
NM_000051.3(ATM):c.4008C>T (p.Phe1336=) rs748055132
NM_000051.3(ATM):c.400G>A (p.Gly134Ser) rs2234998
NM_000051.3(ATM):c.4010T>A (p.Ile1337Asn) rs1060501660
NM_000051.3(ATM):c.4010T>C (p.Ile1337Thr) rs1060501660
NM_000051.3(ATM):c.4011del (p.Ser1338fs)
NM_000051.3(ATM):c.4017T>G (p.Asn1339Lys) rs863224569
NM_000051.3(ATM):c.4018T>C (p.Leu1340=) rs1057522187
NM_000051.3(ATM):c.4019_4029del (p.Leu1340fs) rs1057517140
NM_000051.3(ATM):c.401G>A (p.Gly134Asp) rs771166271
NM_000051.3(ATM):c.4020A>G (p.Leu1340=) rs1555095888
NM_000051.3(ATM):c.4028T>C (p.Ile1343Thr) rs1309605588
NM_000051.3(ATM):c.4033G>A (p.Val1345Met)
NM_000051.3(ATM):c.4036G>T (p.Glu1346Ter) rs1060501528
NM_000051.3(ATM):c.403G>A (p.Ala135Thr) rs1272089657
NM_000051.3(ATM):c.4040T>A (p.Leu1347Ter) rs1565452621
NM_000051.3(ATM):c.4042T>C (p.Leu1348=) rs56355831
NM_000051.3(ATM):c.4047G>T (p.Met1349Ile) rs1555095931
NM_000051.3(ATM):c.4049C>T (p.Thr1350Met) rs587781785
NM_000051.3(ATM):c.404C>G (p.Ala135Gly) rs1555059254
NM_000051.3(ATM):c.404C>T (p.Ala135Val)
NM_000051.3(ATM):c.4050G>A (p.Thr1350=) rs770697446
NM_000051.3(ATM):c.4052T>A (p.Leu1351Ter) rs1565452687
NM_000051.3(ATM):c.4052del (p.Leu1351fs) rs786202350
NM_000051.3(ATM):c.4056T>C (p.His1352=) rs587780622
NM_000051.3(ATM):c.4056_4065del (p.His1352fs) rs1555095955
NM_000051.3(ATM):c.4058A>G (p.Glu1353Gly) rs917721053
NM_000051.3(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.3(ATM):c.4061C>A (p.Pro1354Gln) rs1565452743
NM_000051.3(ATM):c.4064C>T (p.Ala1355Val)
NM_000051.3(ATM):c.4066A>G (p.Asn1356Asp) rs147600485
NM_000051.3(ATM):c.4070C>G (p.Ser1357Cys) rs730881390
NM_000051.3(ATM):c.4071T>C (p.Ser1357=) rs767516955
NM_000051.3(ATM):c.4072A>G (p.Ser1358Gly)
NM_000051.3(ATM):c.4075G>A (p.Ala1359Thr)
NM_000051.3(ATM):c.4079G>A (p.Ser1360Asn) rs764564211
NM_000051.3(ATM):c.4081C>T (p.Gln1361Ter) rs121434222
NM_000051.3(ATM):c.4082A>G (p.Gln1361Arg) rs141921797
NM_000051.3(ATM):c.4083G>T (p.Gln1361His) rs863224570
NM_000051.3(ATM):c.4087A>G (p.Thr1363Ala) rs587779837
NM_000051.3(ATM):c.4087del (p.Thr1363fs) rs1555096035
NM_000051.3(ATM):c.4091A>G (p.Asp1364Gly) rs751169467
NM_000051.3(ATM):c.4093_4094CT[1] (p.Leu1365_Cys1366insTer) rs1555096057
NM_000051.3(ATM):c.4096_4097TG[1] (p.Cys1366_Asp1367delinsTer) rs876658248
NM_000051.3(ATM):c.409T>G (p.Tyr137Asp) rs786204177
NM_000051.3(ATM):c.4101C>T (p.Asp1367=) rs587780623
NM_000051.3(ATM):c.4101del (p.Ser1369fs) rs1565453029
NM_000051.3(ATM):c.4104_4105del (p.Ser1369fs) rs879254189
NM_000051.3(ATM):c.4106C>A (p.Ser1369Ter) rs1057520640
NM_000051.3(ATM):c.4109+6T>C rs368606937
NM_000051.3(ATM):c.4109+6T>G rs368606937
NM_000051.3(ATM):c.4110-1G>A rs1060501692
NM_000051.3(ATM):c.4110-4T>C rs777186156
NM_000051.3(ATM):c.4110-4T>G rs777186156
NM_000051.3(ATM):c.4110-6T>C rs1060504277
NM_000051.3(ATM):c.4110-9C>A rs730881367
NM_000051.3(ATM):c.4110-9C>G rs730881367
NM_000051.3(ATM):c.4110-9C>T rs730881367
NM_000051.3(ATM):c.4111delG rs797045114
NM_000051.3(ATM):c.4114T>C (p.Leu1372=) rs762242838
NM_000051.3(ATM):c.411C>T (p.Tyr137=) rs756160533
NM_000051.3(ATM):c.4126C>G (p.Pro1376Ala) rs863224571
NM_000051.3(ATM):c.4127C>G (p.Pro1376Arg) rs786202406
NM_000051.3(ATM):c.412G>A (p.Gly138Arg) rs150661813
NM_000051.3(ATM):c.4130A>G (p.Asn1377Ser) rs1565454896
NM_000051.3(ATM):c.4133C>T (p.Pro1378Leu) rs750771205
NM_000051.3(ATM):c.4138C>T (p.His1380Tyr) rs3092856
NM_000051.3(ATM):c.4141T>C (p.Phe1381Leu) rs1555096841
NM_000051.3(ATM):c.4143dup (p.Pro1382fs) rs730881309
NM_000051.3(ATM):c.4144C>T (p.Pro1382Ser) rs55859590
NM_000051.3(ATM):c.4145C>T (p.Pro1382Leu) rs752460436
NM_000051.3(ATM):c.4146A>G (p.Pro1382=) rs147738621
NM_000051.3(ATM):c.4148C>A (p.Ser1383Ter) rs141087784
NM_000051.3(ATM):c.4148C>T (p.Ser1383Leu) rs141087784
NM_000051.3(ATM):c.4149G>A (p.Ser1383=) rs749180334
NM_000051.3(ATM):c.4151A>C (p.His1384Pro) rs757172522
NM_000051.3(ATM):c.4151A>G (p.His1384Arg) rs757172522
NM_000051.3(ATM):c.4153G>T (p.Val1385Leu) rs1064794484
NM_000051.3(ATM):c.4158T>G (p.Ile1386Met) rs879254026
NM_000051.3(ATM):c.415G>T (p.Ala139Ser) rs1555059288
NM_000051.3(ATM):c.4162G>A (p.Ala1388Thr) rs1555096903
NM_000051.3(ATM):c.4163C>G (p.Ala1388Gly) rs1555096908
NM_000051.3(ATM):c.4165A>G (p.Thr1389Ala)
NM_000051.3(ATM):c.4167A>G (p.Thr1389=) rs183214437
NM_000051.3(ATM):c.4172C>T (p.Ala1391Val)
NM_000051.3(ATM):c.4173C>T (p.Ala1391=) rs1060504284
NM_000051.3(ATM):c.4177A>C (p.Ile1393Leu) rs1565455097
NM_000051.3(ATM):c.4179C>A (p.Ile1393=) rs775688446
NM_000051.3(ATM):c.4184A>G (p.Asn1395Ser) rs375396787
NM_000051.3(ATM):c.418G>C (p.Asp140His) rs55633650
NM_000051.3(ATM):c.4194A>T (p.Lys1398Asn) rs1565455145
NM_000051.3(ATM):c.4195A>T (p.Thr1399Ser) rs1555096955
NM_000051.3(ATM):c.4196C>A (p.Thr1399Asn) rs786203761
NM_000051.3(ATM):c.4196C>G (p.Thr1399Ser) rs786203761
NM_000051.3(ATM):c.4198A>T (p.Lys1400Ter) rs587781950
NM_000051.3(ATM):c.41A>G (p.Gln14Arg)
NM_000051.3(ATM):c.4201T>A (p.Leu1401Ile) rs587779838
NM_000051.3(ATM):c.4202T>A (p.Leu1401Ter) rs1555096975
NM_000051.3(ATM):c.4210A>G (p.Ile1404Val) rs786201832
NM_000051.3(ATM):c.4219A>G (p.Ile1407Val) rs1382006540
NM_000051.3(ATM):c.421T>G (p.Cys141Gly) rs1565357020
NM_000051.3(ATM):c.4222C>T (p.Leu1408Phe) rs1565455224
NM_000051.3(ATM):c.4227C>T (p.Ser1409=) rs1555097018
NM_000051.3(ATM):c.4227del (p.Ser1411fs) rs587782054
NM_000051.3(ATM):c.4234C>T (p.Pro1412Ser)
NM_000051.3(ATM):c.4235C>T (p.Pro1412Leu) rs776581499
NM_000051.3(ATM):c.4236+1G>T rs876660674
NM_000051.3(ATM):c.4236+2_4236+3insCT
NM_000051.3(ATM):c.4236+5G>A rs1441281768
NM_000051.3(ATM):c.4236+8T>C rs765636697
NM_000051.3(ATM):c.4237-2A>G
NM_000051.3(ATM):c.4237-8T>C rs750427647
NM_000051.3(ATM):c.4237-9_4237-7delATT rs1555097355
NM_000051.3(ATM):c.4237G>A (p.Asp1413Asn) rs1337392659
NM_000051.3(ATM):c.4237G>T (p.Asp1413Tyr) rs1337392659
NM_000051.3(ATM):c.4244A>G (p.Tyr1415Cys) rs876660540
NM_000051.3(ATM):c.4246C>T (p.Gln1416Ter) rs1057516311
NM_000051.3(ATM):c.4247A>G (p.Gln1416Arg) rs758180727
NM_000051.3(ATM):c.4255_4257CTT[1] (p.Leu1420del) rs876659842
NM_000051.3(ATM):c.4256T>C (p.Leu1419Pro) rs1060501622
NM_000051.3(ATM):c.4258C>T (p.Leu1420Phe) rs1800058
NM_000051.3(ATM):c.425G>A (p.Ser142Asn) rs755618506
NM_000051.3(ATM):c.4263C>T (p.Ala1421=) rs1373073134
NM_000051.3(ATM):c.4264A>G (p.Ile1422Val) rs562445932
NM_000051.3(ATM):c.4265T>C (p.Ile1422Thr) rs876659764
NM_000051.3(ATM):c.4267T>A (p.Cys1423Ser) rs587782442
NM_000051.3(ATM):c.4267T>C (p.Cys1423Arg) rs587782442
NM_000051.3(ATM):c.4279G>A (p.Ala1427Thr) rs2229021
NM_000051.3(ATM):c.427A>G (p.Asn143Asp) rs587781688
NM_000051.3(ATM):c.4280del (p.Ala1427fs)
NM_000051.3(ATM):c.428A>G (p.Asn143Ser) rs1565357066
NM_000051.3(ATM):c.4292A>G (p.Asn1431Ser) rs201356803
NM_000051.3(ATM):c.4295T>G (p.Val1432Gly) rs1131691150
NM_000051.3(ATM):c.4297T>G (p.Tyr1433Asp) rs876659559
NM_000051.3(ATM):c.4299T>C (p.Tyr1433=) rs886047612
NM_000051.3(ATM):c.429C>T (p.Asn143=) rs1416280463
NM_000051.3(ATM):c.42A>G (p.Gln14=) rs771378101
NM_000051.3(ATM):c.4303A>C (p.Lys1435Gln) rs876660964
NM_000051.3(ATM):c.4304A>C (p.Lys1435Thr) rs769980220
NM_000051.3(ATM):c.4304A>G (p.Lys1435Arg) rs769980220
NM_000051.3(ATM):c.4306C>T (p.His1436Tyr) rs544891616
NM_000051.3(ATM):c.4307A>G (p.His1436Arg) rs940104361
NM_000051.3(ATM):c.430A>G (p.Ile144Val) rs1555059323
NM_000051.3(ATM):c.4310G>A (p.Arg1437Lys) rs1227046364
NM_000051.3(ATM):c.4311A>T (p.Arg1437Ser) rs1555097507
NM_000051.3(ATM):c.4316T>A (p.Leu1439His)
NM_000051.3(ATM):c.4316T>C (p.Leu1439Pro)
NM_000051.3(ATM):c.4318A>T (p.Lys1440Ter) rs1060501551
NM_000051.3(ATM):c.4321A>C (p.Ile1441Leu) rs774886013
NM_000051.3(ATM):c.4323A>G (p.Ile1441Met) rs587779839
NM_000051.3(ATM):c.4323A>T (p.Ile1441=) rs587779839
NM_000051.3(ATM):c.4324T>C (p.Tyr1442His) rs201666889
NM_000051.3(ATM):c.4327C>T (p.His1443Tyr) rs1555097538
NM_000051.3(ATM):c.4329C>A (p.His1443Gln) rs377065665
NM_000051.3(ATM):c.432A>G (p.Ile144Met)
NM_000051.3(ATM):c.432del (p.Leu145fs) rs1555059333
NM_000051.3(ATM):c.4330_4333delinsTAAAATAAA (p.Leu1444_Phe1445delinsTer) rs1064792938
NM_000051.3(ATM):c.4331_4332insTTT (p.Leu1444dup) rs1060501663
NM_000051.3(ATM):c.4332G>A (p.Leu1444=) rs753570046
NM_000051.3(ATM):c.4332G>C (p.Leu1444=) rs753570046
NM_000051.3(ATM):c.4333T>C (p.Phe1445Leu) rs1060501683
NM_000051.3(ATM):c.4335T>C (p.Phe1445=) rs761225071
NM_000051.3(ATM):c.4336G>T (p.Val1446Phe) rs1060501658
NM_000051.3(ATM):c.4337T>A (p.Val1446Asp)
NM_000051.3(ATM):c.4343_4344delinsGTT (p.Leu1448fs) rs1565456465
NM_000051.3(ATM):c.4344dup (p.Leu1449fs) rs1555097604
NM_000051.3(ATM):c.4349T>C (p.Leu1450Pro) rs750306932
NM_000051.3(ATM):c.434T>G (p.Leu145Arg) rs1555059346
NM_000051.3(ATM):c.4355A>T (p.Asp1452Val) rs1565456579
NM_000051.3(ATM):c.4356_4357TA[1] (p.Ile1453fs) rs1555097650
NM_000051.3(ATM):c.4358T>G (p.Ile1453Arg) rs587782126
NM_000051.3(ATM):c.4361A>G (p.Lys1454Arg) rs1451928082
NM_000051.3(ATM):c.4362A>C (p.Lys1454Asn) rs148993589
NM_000051.3(ATM):c.4365T>A (p.Ser1455Arg) rs527471560
NM_000051.3(ATM):c.4366G>A (p.Gly1456Ser)
NM_000051.3(ATM):c.4367G>A (p.Gly1456Asp)
NM_000051.3(ATM):c.4370T>G (p.Leu1457Ter) rs373226793
NM_000051.3(ATM):c.4371A>C (p.Leu1457Phe)
NM_000051.3(ATM):c.4373del (p.Gly1458fs) rs587781653
NM_000051.3(ATM):c.4375G>A (p.Gly1459Arg) rs145667735
NM_000051.3(ATM):c.4378G>T (p.Ala1460Ser) rs1060501675
NM_000051.3(ATM):c.4379C>T (p.Ala1460Val) rs376165779
NM_000051.3(ATM):c.437_441delinsACAAT (p.Leu146_Lys147delinsHisAsn) rs1555059356
NM_000051.3(ATM):c.4383G>A (p.Trp1461Ter)
NM_000051.3(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.3(ATM):c.4389T>C (p.Phe1463=) rs1555097753
NM_000051.3(ATM):c.4394T>C (p.Leu1465Pro) rs730881391
NM_000051.3(ATM):c.4396C>G (p.Arg1466Gly) rs730881369
NM_000051.3(ATM):c.4396C>T (p.Arg1466Ter) rs730881369
NM_000051.3(ATM):c.4397G>A (p.Arg1466Gln) rs749770110
NM_000051.3(ATM):c.4397_4398delinsCG (p.Arg1466Pro) rs886038217
NM_000051.3(ATM):c.4398A>G (p.Arg1466=) rs142728382
NM_000051.3(ATM):c.43del (p.Gln14_Leu15insTer) rs771887195
NM_000051.3(ATM):c.4400A>G (p.Asp1467Gly) rs730881392
NM_000051.3(ATM):c.4401C>T (p.Asp1467=) rs876660356
NM_000051.3(ATM):c.4402G>A (p.Val1468Ile) rs369903995
NM_000051.3(ATM):c.4402_4403delinsA (p.Val1468fs)
NM_000051.3(ATM):c.4404T>C (p.Val1468=) rs1555097801
NM_000051.3(ATM):c.4414T>G (p.Leu1472Val) rs539676759
NM_000051.3(ATM):c.4415T>A (p.Leu1472Ter) rs772555314
NM_000051.3(ATM):c.4416G>A (p.Leu1472=) rs201526888
NM_000051.3(ATM):c.4417A>G (p.Ile1473Val)
NM_000051.3(ATM):c.441A>G (p.Lys147=) rs1555059372
NM_000051.3(ATM):c.4420C>A (p.His1474Asn) rs587779840
NM_000051.3(ATM):c.4420C>G (p.His1474Asp) rs587779840
NM_000051.3(ATM):c.4422C>T (p.His1474=) rs1555097849
NM_000051.3(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941
NM_000051.3(ATM):c.4431C>A (p.Asn1477Lys) rs571989748
NM_000051.3(ATM):c.4432C>T (p.Gln1478Ter) rs1368412801
NM_000051.3(ATM):c.4436+10A>G rs878853509
NM_000051.3(ATM):c.4436+1G>T rs1555097894
NM_000051.3(ATM):c.4436+2T>C rs1555097898
NM_000051.3(ATM):c.4437-1G>C rs759520465
NM_000051.3(ATM):c.4437-7A>C
NM_000051.3(ATM):c.4437-7A>G rs370354306
NM_000051.3(ATM):c.4437-9C>T rs766003804
NM_000051.3(ATM):c.4439_4441CTT[1] (p.Ser1481del) rs786202338
NM_000051.3(ATM):c.4442C>T (p.Ser1481Phe) rs863224572
NM_000051.3(ATM):c.4444T>C (p.Cys1482Arg)
NM_000051.3(ATM):c.4445G>A (p.Cys1482Tyr) rs201277352
NM_000051.3(ATM):c.4447A>G (p.Ile1483Val) rs1281685502
NM_000051.3(ATM):c.4450_4451del (p.Met1484fs) rs1565460896
NM_000051.3(ATM):c.4451del (p.Met1484fs) rs1555099760
NM_000051.3(ATM):c.4454A>C (p.Asp1485Ala)
NM_000051.3(ATM):c.4454A>G (p.Asp1485Gly) rs1555099762
NM_000051.3(ATM):c.4456G>C (p.Val1486Leu) rs786203352
NM_000051.3(ATM):c.445A>G (p.Ile149Val) rs1565357194
NM_000051.3(ATM):c.4465C>T (p.Arg1489Cys) rs754181173
NM_000051.3(ATM):c.4466G>A (p.Arg1489His) rs201594549
NM_000051.3(ATM):c.4468A>G (p.Ser1490Gly) rs876658711
NM_000051.3(ATM):c.446_449TTCT[1] (p.Leu150_Ser151insTer) rs771936821
NM_000051.3(ATM):c.4471T>C (p.Phe1491Leu) rs587781944
NM_000051.3(ATM):c.4473C>T (p.Phe1491=) rs4988008
NM_000051.3(ATM):c.4477C>G (p.Leu1493Val)
NM_000051.3(ATM):c.4477C>T (p.Leu1493Phe) rs377595814
NM_000051.3(ATM):c.4480T>C (p.Cys1494Arg) rs1060501576
NM_000051.3(ATM):c.4482T>C (p.Cys1494=) rs769071554
NM_000051.3(ATM):c.4484G>T (p.Cys1495Phe) rs878853510
NM_000051.3(ATM):c.4489_4491TTA[1] (p.Leu1498del) rs1555099818
NM_000051.3(ATM):c.4491A>G (p.Leu1497=) rs878853511
NM_000051.3(ATM):c.4492T>C (p.Leu1498=) rs748949478
NM_000051.3(ATM):c.4493T>G (p.Leu1498Ter) rs1329359780
NM_000051.3(ATM):c.4499A>G (p.Gln1500Arg) rs786203789
NM_000051.3(ATM):c.44T>A (p.Leu15Gln) rs1555053927
NM_000051.3(ATM):c.44T>G (p.Leu15Arg) rs1555053927
NM_000051.3(ATM):c.4501G>A (p.Val1501Ile)
NM_000051.3(ATM):c.4501G>T (p.Val1501Phe) rs370574283
NM_000051.3(ATM):c.4505G>T (p.Cys1502Phe) rs759340881
NM_000051.3(ATM):c.4507C>T (p.Gln1503Ter) rs1131691164
NM_000051.3(ATM):c.4508A>G (p.Gln1503Arg) rs1555099858
NM_000051.3(ATM):c.4511C>T (p.Thr1504Ile) rs1060501638
NM_000051.3(ATM):c.4515C>G (p.Ala1505=) rs540798997
NM_000051.3(ATM):c.4516G>A (p.Val1506Met) rs760542469
NM_000051.3(ATM):c.4516G>T (p.Val1506Leu)
NM_000051.3(ATM):c.4517T>A (p.Val1506Glu) rs1555099878
NM_000051.3(ATM):c.4518G>A (p.Val1506=) rs1057524110
NM_000051.3(ATM):c.451T>C (p.Ser151Pro) rs1565357241
NM_000051.3(ATM):c.4520C>T (p.Thr1507Ile) rs1064793811
NM_000051.3(ATM):c.4522dup (p.Tyr1508fs) rs1555099888
NM_000051.3(ATM):c.452C>T (p.Ser151Phe) rs1565357249
NM_000051.3(ATM):c.4532A>T (p.Asp1511Val)
NM_000051.3(ATM):c.4534G>A (p.Ala1512Thr) rs1060501653
NM_000051.3(ATM):c.4545C>T (p.Asn1515=) rs764039368
NM_000051.3(ATM):c.4546C>T (p.His1516Tyr) rs1389372050
NM_000051.3(ATM):c.4547A>G (p.His1516Arg) rs1565461434
NM_000051.3(ATM):c.4549C>T (p.Leu1517Phe) rs754058482
NM_000051.3(ATM):c.4553A>C (p.His1518Pro) rs762132832
NM_000051.3(ATM):c.4555G>C (p.Val1519Leu) rs969120822
NM_000051.3(ATM):c.4559T>C (p.Ile1520Thr) rs375654664
NM_000051.3(ATM):c.4561G>C (p.Val1521Leu) rs141329176
NM_000051.3(ATM):c.4564G>A (p.Gly1522Ser) rs1064795495
NM_000051.3(ATM):c.4565G>A (p.Gly1522Asp) rs1555099954
NM_000051.3(ATM):c.4568C>T (p.Thr1523Ile) rs1555099959
NM_000051.3(ATM):c.4570C>T (p.Leu1524Phe) rs780603110
NM_000051.3(ATM):c.4571T>A (p.Leu1524His) rs1555099971
NM_000051.3(ATM):c.4574T>C (p.Ile1525Thr) rs755274980
NM_000051.3(ATM):c.4575A>T (p.Ile1525=) rs781539071
NM_000051.3(ATM):c.4576C>A (p.Pro1526Thr) rs748898098
NM_000051.3(ATM):c.4576C>T (p.Pro1526Ser) rs748898098
NM_000051.3(ATM):c.4577C>A (p.Pro1526His) rs770590652
NM_000051.3(ATM):c.4577_4578delinsTT (p.Pro1526Leu)
NM_000051.3(ATM):c.4578C>T (p.Pro1526=) rs1800889
NM_000051.3(ATM):c.4579del (p.Val1528fs) rs1565461674
NM_000051.3(ATM):c.457A>G (p.Arg153Gly) rs1555059438
NM_000051.3(ATM):c.4586A>G (p.Tyr1529Cys) rs1365089723
NM_000051.3(ATM):c.4587T>G (p.Tyr1529Ter) rs1555100005
NM_000051.3(ATM):c.4588G>T (p.Glu1530Ter) rs864622479
NM_000051.3(ATM):c.4600G>T (p.Val1534Phe) rs745351684
NM_000051.3(ATM):c.4606A>G (p.Lys1536Glu) rs587779841
NM_000051.3(ATM):c.4609C>T (p.Gln1537Ter) rs1555100037
NM_000051.3(ATM):c.4611+1G>A rs1565461840
NM_000051.3(ATM):c.4611+4A>G
NM_000051.3(ATM):c.4611+6T>C rs1555100047
NM_000051.3(ATM):c.4611+9C>G rs760704159
NM_000051.3(ATM):c.4612-1G>A rs1555100351
NM_000051.3(ATM):c.4612-2A>C rs1555100347
NM_000051.3(ATM):c.4612-32_4612-30delCTT rs113149503
NM_000051.3(ATM):c.4612-4T>G rs569983068
NM_000051.3(ATM):c.4612-8A>G rs1555100341
NM_000051.3(ATM):c.4612G>T (p.Val1538Leu) rs1034235291
NM_000051.3(ATM):c.4615T>C (p.Leu1539=) rs976206782
NM_000051.3(ATM):c.4618G>T (p.Asp1540Tyr) rs778622948
NM_000051.3(ATM):c.4626G>A (p.Leu1542=) rs786202784
NM_000051.3(ATM):c.4629A>G (p.Lys1543=) rs745565564
NM_000051.3(ATM):c.4630T>C (p.Tyr1544His) rs771554153
NM_000051.3(ATM):c.4631A>G (p.Tyr1544Cys) rs779718362
NM_000051.3(ATM):c.4632_4635del (p.Lys1543_Tyr1544insTer) rs1064794236
NM_000051.3(ATM):c.4636G>A (p.Val1546Met) rs1305696123
NM_000051.3(ATM):c.4638_4641GATA[1] (p.Asp1548fs) rs876659535
NM_000051.3(ATM):c.4639A>G (p.Ile1547Val) rs537377433
NM_000051.3(ATM):c.4643A>T (p.Asp1548Val) rs1448017467
NM_000051.3(ATM):c.4658A>C (p.Glu1553Ala) rs587778075
NM_000051.3(ATM):c.4661del (p.Asn1554fs) rs1064793390
NM_000051.3(ATM):c.4662C>A (p.Asn1554Lys) rs776761757
NM_000051.3(ATM):c.4664T>A (p.Leu1555His) rs1060501524
NM_000051.3(ATM):c.4664del (p.Leu1555fs) rs876659039
NM_000051.3(ATM):c.4665C>T (p.Leu1555=) rs374431061
NM_000051.3(ATM):c.4666T>C (p.Tyr1556His) rs587781320
NM_000051.3(ATM):c.4667A>G (p.Tyr1556Cys) rs587782037
NM_000051.3(ATM):c.4669del (p.Ile1557fs)
NM_000051.3(ATM):c.4673C>T (p.Thr1558Met) rs587781712
NM_000051.3(ATM):c.4674G>A (p.Thr1558=) rs876658474
NM_000051.3(ATM):c.4677T>A (p.Ile1559=) rs759660081
NM_000051.3(ATM):c.4678A>C (p.Lys1560Gln)
NM_000051.3(ATM):c.4678A>G (p.Lys1560Glu) rs767981230
NM_000051.3(ATM):c.467G>A (p.Trp156Ter) rs876658159
NM_000051.3(ATM):c.4691C>T (p.Pro1564Leu)
NM_000051.3(ATM):c.4695del (p.Pro1566fs) rs1057517452
NM_000051.3(ATM):c.469T>G (p.Cys157Gly) rs1248850168
NM_000051.3(ATM):c.4702C>T (p.His1568Tyr) rs753269143
NM_000051.3(ATM):c.4703A>G (p.His1568Arg) rs368830730
NM_000051.3(ATM):c.4709T>C (p.Val1570Ala) rs140856217
NM_000051.3(ATM):c.4723C>A (p.Arg1575Ser)
NM_000051.3(ATM):c.4724G>A (p.Arg1575His) rs550552791
NM_000051.3(ATM):c.4731T>C (p.Thr1577=) rs145236132
NM_000051.3(ATM):c.4732C>T (p.Gln1578Ter) rs746499337
NM_000051.3(ATM):c.4735C>T (p.Gln1579Ter) rs869312755
NM_000051.3(ATM):c.4738A>G (p.Lys1580Glu)
NM_000051.3(ATM):c.4741A>G (p.Ile1581Val) rs1565463271
NM_000051.3(ATM):c.4741dup (p.Ile1581fs) rs864622164
NM_000051.3(ATM):c.4749C>T (p.Tyr1583=) rs1555100597
NM_000051.3(ATM):c.4751G>A (p.Ser1584Asn)
NM_000051.3(ATM):c.4753A>G (p.Arg1585Gly) rs781275128
NM_000051.3(ATM):c.4756G>A (p.Gly1586Arg) rs1565463314
NM_000051.3(ATM):c.4759C>G (p.Pro1587Ala) rs786202473
NM_000051.3(ATM):c.475A>G (p.Ile159Val) rs1565357315
NM_000051.3(ATM):c.4761C>T (p.Pro1587=) rs769562370
NM_000051.3(ATM):c.4768C>T (p.Leu1590Phe) rs35962982
NM_000051.3(ATM):c.4770C>T (p.Leu1590=) rs749475519
NM_000051.3(ATM):c.4775A>G (p.Glu1592Gly) rs1565463405
NM_000051.3(ATM):c.4776+10delA rs878853512
NM_000051.3(ATM):c.4776+1G>T rs771117943
NM_000051.3(ATM):c.4776+23_4776+25delCTA rs770860526
NM_000051.3(ATM):c.4776+2T>A rs587781927
NM_000051.3(ATM):c.4776+2T>C rs587781927
NM_000051.3(ATM):c.4776+2_4776+13delTAATAAAAATTT rs762838462
NM_000051.3(ATM):c.4776+4A>G
NM_000051.3(ATM):c.4776G>C (p.Glu1592Asp) rs786202973
NM_000051.3(ATM):c.4777-13T>A rs371535082
NM_000051.3(ATM):c.4777-1G>A
NM_000051.3(ATM):c.4777-20A>G rs3218678
NM_000051.3(ATM):c.4777-3T>C rs1468242174
NM_000051.3(ATM):c.4777-6T>C rs1565465980
NM_000051.3(ATM):c.4779A>G (p.Glu1593=) rs587778076
NM_000051.3(ATM):c.4780A>G (p.Ile1594Val) rs1555101615
NM_000051.3(ATM):c.4784A>G (p.Asn1595Ser) rs777812804
NM_000051.3(ATM):c.478T>C (p.Ser160Pro)
NM_000051.3(ATM):c.478_482del (p.Ser160fs) rs587780624
NM_000051.3(ATM):c.4792C>A (p.Leu1598Ile) rs375190373
NM_000051.3(ATM):c.4799T>A (p.Val1600Glu)
NM_000051.3(ATM):c.4800_4803del (p.Ser1601fs) rs1060501659
NM_000051.3(ATM):c.4801A>G (p.Ser1601Gly) rs876660520
NM_000051.3(ATM):c.4802G>A (p.Ser1601Asn) rs587782506
NM_000051.3(ATM):c.4802_4803GT[1] (p.Val1602fs) rs864622290
NM_000051.3(ATM):c.4807T>C (p.Tyr1603His) rs994121421
NM_000051.3(ATM):c.4813G>A (p.Ala1605Thr) rs1555101706
NM_000051.3(ATM):c.4814C>T (p.Ala1605Val) rs786203520
NM_000051.3(ATM):c.4816C>G (p.Leu1606Val) rs746103632
NM_000051.3(ATM):c.4816C>T (p.Leu1606Phe)
NM_000051.3(ATM):c.4818T>C (p.Leu1606=) rs772074468
NM_000051.3(ATM):c.4819C>A (p.Pro1607Thr) rs1178015475
NM_000051.3(ATM):c.4820C>G (p.Pro1607Arg) rs864622462
NM_000051.3(ATM):c.4820C>T (p.Pro1607Leu)
NM_000051.3(ATM):c.4821A>G (p.Pro1607=) rs786203559
NM_000051.3(ATM):c.4825A>G (p.Thr1609Ala) rs761197886
NM_000051.3(ATM):c.482A>C (p.Gln161Pro) rs587780625
NM_000051.3(ATM):c.483G>C (p.Gln161His) rs864622742
NM_000051.3(ATM):c.4840C>T (p.Leu1614=) rs777239020
NM_000051.3(ATM):c.4844del (p.Lys1615fs) rs1555101791
NM_000051.3(ATM):c.4845G>T (p.Lys1615Asn) rs888498126
NM_000051.3(ATM):c.4847A>T (p.Asp1616Val)
NM_000051.3(ATM):c.484C>T (p.Gln162Ter) rs1565357383
NM_000051.3(ATM):c.4852C>G (p.Arg1618Gly)
NM_000051.3(ATM):c.4852C>T (p.Arg1618Ter) rs762083530
NM_000051.3(ATM):c.4853G>A (p.Arg1618Gln) rs765759912
NM_000051.3(ATM):c.4856G>A (p.Arg1619Lys) rs730881393
NM_000051.3(ATM):c.4862T>A (p.Leu1621Gln) rs1555101864
NM_000051.3(ATM):c.4865A>G (p.Glu1622Gly) rs1555101872
NM_000051.3(ATM):c.4868T>C (p.Leu1623Pro) rs786203017
NM_000051.3(ATM):c.4869A>C (p.Leu1623=) rs767084038
NM_000051.3(ATM):c.4870C>A (p.His1624Asn)
NM_000051.3(ATM):c.4871A>G (p.His1624Arg) rs56354559
NM_000051.3(ATM):c.4873A>G (p.Lys1625Glu) rs1060501693
NM_000051.3(ATM):c.4874A>G (p.Lys1625Arg)
NM_000051.3(ATM):c.4878T>C (p.Asp1626=) rs755687834
NM_000051.3(ATM):c.4879C>A (p.Gln1627Lys) rs886039592
NM_000051.3(ATM):c.4881G>T (p.Gln1627His) rs1374689246
NM_000051.3(ATM):c.4882A>T (p.Met1628Leu)
NM_000051.3(ATM):c.4889A>G (p.Asp1630Gly) rs1565466579
NM_000051.3(ATM):c.488A>G (p.Gln163Arg) rs876660598
NM_000051.3(ATM):c.4892T>G (p.Ile1631Ser) rs1060501674
NM_000051.3(ATM):c.4894A>G (p.Met1632Val) rs1060501709
NM_000051.3(ATM):c.4896G>A (p.Met1632Ile) rs933030670
NM_000051.3(ATM):c.489G>A (p.Gln163=) rs1057523087
NM_000051.3(ATM):c.48A>G (p.Glu16=) rs774768437
NM_000051.3(ATM):c.4906C>T (p.Gln1636Ter) rs1060501627
NM_000051.3(ATM):c.4909+1G>A rs756987454
NM_000051.3(ATM):c.4909+1G>T
NM_000051.3(ATM):c.4909+3G>A rs778685122
NM_000051.3(ATM):c.4909+4C>T rs587782125
NM_000051.3(ATM):c.4909+9T>G rs1555101970
NM_000051.3(ATM):c.4909G>T (p.Asp1637Tyr) rs753870656
NM_000051.3(ATM):c.490T>C (p.Trp164Arg) rs1060501699
NM_000051.3(ATM):c.4910-1G>T rs1060501706
NM_000051.3(ATM):c.4910-2A>G
NM_000051.3(ATM):c.4910-4C>T rs786202493
NM_000051.3(ATM):c.4910-5T>C rs1309478967
NM_000051.3(ATM):c.4910-6T>G rs878853513
NM_000051.3(ATM):c.4910-8A>G rs1555103144
NM_000051.3(ATM):c.4910A>G (p.Asp1637Gly) rs763457172
NM_000051.3(ATM):c.4916C>G (p.Pro1639Arg) rs752459491
NM_000051.3(ATM):c.4916C>T (p.Pro1639Leu) rs752459491
NM_000051.3(ATM):c.4917G>A (p.Pro1639=) rs140425622
NM_000051.3(ATM):c.4921G>C (p.Asp1641His) rs587782896
NM_000051.3(ATM):c.492G>T (p.Trp164Cys) rs1555059530
NM_000051.3(ATM):c.492dup (p.Leu165fs) rs1555059513
NM_000051.3(ATM):c.4930A>G (p.Met1644Val)
NM_000051.3(ATM):c.4932G>C (p.Met1644Ile) rs730881371
NM_000051.3(ATM):c.4933G>T (p.Val1645Leu) rs757381170
NM_000051.3(ATM):c.4938del (p.Lys1646fs) rs587781754
NM_000051.3(ATM):c.493T>C (p.Leu165=) rs878853514
NM_000051.3(ATM):c.493T>G (p.Leu165Val)
NM_000051.3(ATM):c.4943T>C (p.Val1648Ala)
NM_000051.3(ATM):c.4949A>C (p.Asn1650Thr) rs55870064
NM_000051.3(ATM):c.4949A>G (p.Asn1650Ser) rs55870064
NM_000051.3(ATM):c.4952T>C (p.Leu1651Ser) rs1555103237
NM_000051.3(ATM):c.4952T>G (p.Leu1651Trp)
NM_000051.3(ATM):c.4953G>A (p.Leu1651=) rs786201297
NM_000051.3(ATM):c.4957C>T (p.Gln1653Ter) rs1565469955
NM_000051.3(ATM):c.495_496+16del18 rs1555059522
NM_000051.3(ATM):c.496+3A>G rs876658311
NM_000051.3(ATM):c.496+4T>C rs587781375
NM_000051.3(ATM):c.496+5G>A rs796051858
NM_000051.3(ATM):c.4963T>C (p.Ser1655Pro) rs1376280581
NM_000051.3(ATM):c.4964C>A (p.Ser1655Tyr) rs786201215
NM_000051.3(ATM):c.4965C>T (p.Ser1655=) rs1555103252
NM_000051.3(ATM):c.4966A>G (p.Lys1656Glu) rs1565470010
NM_000051.3(ATM):c.4969A>G (p.Met1657Val) rs1060501656
NM_000051.3(ATM):c.496G>T (p.Glu166Ter) rs1565357473
NM_000051.3(ATM):c.497-1G>C
NM_000051.3(ATM):c.497-4T>A rs876659621
NM_000051.3(ATM):c.497-4_497-3insT rs768748099
NM_000051.3(ATM):c.497-5T>C
NM_000051.3(ATM):c.4975A>G (p.Ile1659Val) rs778632065
NM_000051.3(ATM):c.4977A>T (p.Ile1659=) rs199888434
NM_000051.3(ATM):c.497A>G (p.Glu166Gly)
NM_000051.3(ATM):c.497A>T (p.Glu166Val) rs863224573
NM_000051.3(ATM):c.4980C>A (p.Asn1660Lys) rs144338238
NM_000051.3(ATM):c.4980C>T (p.Asn1660=) rs144338238
NM_000051.3(ATM):c.4981C>A (p.His1661Asn)
NM_000051.3(ATM):c.4985C>T (p.Thr1662Ile)
NM_000051.3(ATM):c.4988del (p.Gly1663fs) rs1565470139
NM_000051.3(ATM):c.498A>G (p.Glu166=) rs587779842
NM_000051.3(ATM):c.498A>T (p.Glu166Asp) rs587779842
NM_000051.3(ATM):c.49C>A (p.His17Asn) rs876658161
NM_000051.3(ATM):c.4A>G (p.Ser2Gly)
NM_000051.3(ATM):c.5002C>A (p.Leu1668Ile)
NM_000051.3(ATM):c.5002C>T (p.Leu1668=) rs747317946
NM_000051.3(ATM):c.5004A>G (p.Leu1668=)
NM_000051.3(ATM):c.5005+14A>T rs374337879
NM_000051.3(ATM):c.5005+1G>T rs1057517427
NM_000051.3(ATM):c.5005+7_5005+8delTA rs587780626
NM_000051.3(ATM):c.5005+8A>G rs1204604787
NM_000051.3(ATM):c.5005+9C>T rs730881291
NM_000051.3(ATM):c.5006-1G>A
NM_000051.3(ATM):c.5006-4G>A
NM_000051.3(ATM):c.5006-8A>G rs1057520447
NM_000051.3(ATM):c.5009C>T (p.Ala1670Val) rs375131360
NM_000051.3(ATM):c.5010T>G (p.Ala1670=) rs1555104482
NM_000051.3(ATM):c.5011G>T (p.Val1671Phe) rs1057523385
NM_000051.3(ATM):c.5015del (p.Gly1672fs) rs864622662
NM_000051.3(ATM):c.5018G>A (p.Ser1673Asn) rs878853515
NM_000051.3(ATM):c.501_503del (p.Leu167del) rs1555066242
NM_000051.3(ATM):c.5021G>A (p.Cys1674Tyr) rs1555104518
NM_000051.3(ATM):c.5023T>C (p.Leu1675=) rs876660275
NM_000051.3(ATM):c.5027G>A (p.Gly1676Glu) rs1565473530
NM_000051.3(ATM):c.5028_5036del (p.Glu1677_Gly1679del) rs1555104529
NM_000051.3(ATM):c.502T>C (p.Phe168Leu) rs1565369177
NM_000051.3(ATM):c.5033T>A (p.Val1678Glu) rs878853516
NM_000051.3(ATM):c.5034G>C (p.Val1678=) rs1555104548
NM_000051.3(ATM):c.5036G>A (p.Gly1679Asp) rs1064794124
NM_000051.3(ATM):c.5036G>T (p.Gly1679Val) rs1064794124
NM_000051.3(ATM):c.5038C>G (p.Pro1680Ala) rs1565473572
NM_000051.3(ATM):c.5039C>G (p.Pro1680Arg) rs587782153
NM_000051.3(ATM):c.5039C>T (p.Pro1680Leu) rs587782153
NM_000051.3(ATM):c.5041A>G (p.Ile1681Val) rs1298268285
NM_000051.3(ATM):c.5042T>C (p.Ile1681Thr) rs1307715383
NM_000051.3(ATM):c.5045A>G (p.Asp1682Gly) rs980731959
NM_000051.3(ATM):c.5049C>A (p.Phe1683Leu) rs1183084231
NM_000051.3(ATM):c.504C>T (p.Phe168=) rs1060504312
NM_000051.3(ATM):c.5051C>G (p.Ser1684Cys) rs1565473651
NM_000051.3(ATM):c.5053A>G (p.Thr1685Ala) rs879254205
NM_000051.3(ATM):c.5055C>T (p.Thr1685=) rs587780551
NM_000051.3(ATM):c.5056A>G (p.Ile1686Val) rs145453814
NM_000051.3(ATM):c.5057T>C (p.Ile1686Thr) rs878853517
NM_000051.3(ATM):c.5060C>G (p.Ala1687Gly)
NM_000051.3(ATM):c.5062A>G (p.Ile1688Val) rs766053182
NM_000051.3(ATM):c.5063T>C (p.Ile1688Thr) rs199836342
NM_000051.3(ATM):c.5065C>T (p.Gln1689Ter) rs1555104609
NM_000051.3(ATM):c.5066A>G (p.Gln1689Arg) rs1555104616
NM_000051.3(ATM):c.5067A>G (p.Gln1689=) rs1555104621
NM_000051.3(ATM):c.5068C>G (p.His1690Asp)
NM_000051.3(ATM):c.5069A>G (p.His1690Arg) rs863224574
NM_000051.3(ATM):c.506C>G (p.Ser169Cys) rs587779843
NM_000051.3(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.3(ATM):c.5076A>C (p.Lys1692Asn) rs767841041
NM_000051.3(ATM):c.5076del (p.Asp1693fs)
NM_000051.3(ATM):c.5077G>C (p.Asp1693His)
NM_000051.3(ATM):c.5078A>T (p.Asp1693Val)
NM_000051.3(ATM):c.507T>C (p.Ser169=) rs758619186
NM_000051.3(ATM):c.5080G>A (p.Ala1694Thr) rs756197350
NM_000051.3(ATM):c.5081C>T (p.Ala1694Val) rs587782551
NM_000051.3(ATM):c.5082A>G (p.Ala1694=) rs778014234
NM_000051.3(ATM):c.5087A>G (p.Tyr1696Cys) rs1555104673
NM_000051.3(ATM):c.5089A>G (p.Thr1697Ala) rs142455912
NM_000051.3(ATM):c.508G>T (p.Val170Leu) rs786202781
NM_000051.3(ATM):c.5093A>T (p.Lys1698Met)
NM_000051.3(ATM):c.50_51del (p.His17fs)
NM_000051.3(ATM):c.5102_5106del (p.Lys1701fs) rs1555104693
NM_000051.3(ATM):c.5108T>C (p.Phe1703Ser) rs772376652
NM_000051.3(ATM):c.510G>A (p.Val170=) rs375682557
NM_000051.3(ATM):c.5119G>A (p.Glu1707Lys) rs1565474056
NM_000051.3(ATM):c.5124T>G (p.Leu1708=) rs864622668
NM_000051.3(ATM):c.5125C>A (p.Gln1709Lys) rs1341457041
NM_000051.3(ATM):c.5126A>G (p.Gln1709Arg) rs587780627
NM_000051.3(ATM):c.5127G>C (p.Gln1709His)
NM_000051.3(ATM):c.512A>G (p.Tyr171Cys) rs1060501616
NM_000051.3(ATM):c.5130_5131delinsAC (p.Trp1710_Thr1711delinsTer) rs1057516358
NM_000051.3(ATM):c.5132C>G (p.Thr1711Ser) rs1291016764
NM_000051.3(ATM):c.5138T>C (p.Ile1713Thr) rs1199544303
NM_000051.3(ATM):c.513C>G (p.Tyr171Ter) rs786201693
NM_000051.3(ATM):c.5141T>G (p.Met1714Arg)
NM_000051.3(ATM):c.5144T>C (p.Leu1715Pro) rs747800057
NM_000051.3(ATM):c.5145G>A (p.Leu1715=) rs786202765
NM_000051.3(ATM):c.514T>C (p.Phe172Leu) rs786201608
NM_000051.3(ATM):c.5154G>A (p.Leu1718=) rs1555104785
NM_000051.3(ATM):c.5156A>G (p.Asn1719Ser) rs183531638
NM_000051.3(ATM):c.5157T>C (p.Asn1719=) rs786203254
NM_000051.3(ATM):c.5160C>A (p.Asn1720Lys) rs1565474287
NM_000051.3(ATM):c.5168T>C (p.Val1723Ala) rs915337829
NM_000051.3(ATM):c.5173G>T (p.Asp1725Tyr) rs1555104799
NM_000051.3(ATM):c.5175T>C (p.Asp1725=) rs1555104803
NM_000051.3(ATM):c.5177+1G>A rs1131691159
NM_000051.3(ATM):c.5177+3G>A rs774216164
NM_000051.3(ATM):c.5177+5G>A rs759373136
NM_000051.3(ATM):c.5177+6T>A rs1555104814
NM_000051.3(ATM):c.5178-10T>A rs1565476613
NM_000051.3(ATM):c.5178-10T>G
NM_000051.3(ATM):c.5178-11G>A rs200876654
NM_000051.3(ATM):c.5178-1G>A rs1555105579
NM_000051.3(ATM):c.5178-3delC rs1555105575
NM_000051.3(ATM):c.5178-7T>C rs1555105564
NM_000051.3(ATM):c.5178-9T>G rs1555105562
NM_000051.3(ATM):c.5183A>G (p.Lys1728Arg) rs1060501613
NM_000051.3(ATM):c.5184dup (p.Val1729fs) rs1555105588
NM_000051.3(ATM):c.5185G>C (p.Val1729Leu) rs3092907
NM_000051.3(ATM):c.5188C>T (p.Arg1730Ter) rs764389018
NM_000051.3(ATM):c.5189G>A (p.Arg1730Gln) rs373789346
NM_000051.3(ATM):c.5189G>T (p.Arg1730Leu) rs373789346
NM_000051.3(ATM):c.518G>T (p.Arg173Met) rs372694758
NM_000051.3(ATM):c.5190A>G (p.Arg1730=) rs786201609
NM_000051.3(ATM):c.5191T>C (p.Ser1731Pro) rs1064793038
NM_000051.3(ATM):c.5194G>A (p.Ala1732Thr) rs730881372
NM_000051.3(ATM):c.5203dup (p.Thr1735fs) rs878853518
NM_000051.3(ATM):c.5205C>G (p.Thr1735=) rs1060504283
NM_000051.3(ATM):c.5209_5210del (p.Leu1737fs) rs1555105660
NM_000051.3(ATM):c.520C>T (p.Leu174Phe) rs1565369274
NM_000051.3(ATM):c.5218A>C (p.Ile1740Leu)
NM_000051.3(ATM):c.5218A>G (p.Ile1740Val) rs1358200819
NM_000051.3(ATM):c.5222T>C (p.Leu1741Ser) rs750896881
NM_000051.3(ATM):c.5227A>G (p.Thr1743Ala) rs758924620
NM_000051.3(ATM):c.5228C>T (p.Thr1743Ile) rs587779844
NM_000051.3(ATM):c.5229A>G (p.Thr1743=) rs878853519
NM_000051.3(ATM):c.522C>G (p.Leu174=) rs780173724
NM_000051.3(ATM):c.5233A>C (p.Thr1745Pro) rs587782532
NM_000051.3(ATM):c.5236G>A (p.Gly1746Arg) rs1060501571
NM_000051.3(ATM):c.5237G>T (p.Gly1746Val) rs879254135
NM_000051.3(ATM):c.5240A>G (p.His1747Arg) rs1555105695
NM_000051.3(ATM):c.5246T>C (p.Phe1749Ser)
NM_000051.3(ATM):c.5249G>A (p.Trp1750Ter) rs1060501669
NM_000051.3(ATM):c.5250G>C (p.Trp1750Cys) rs587779845
NM_000051.3(ATM):c.5250G>T (p.Trp1750Cys) rs587779845
NM_000051.3(ATM):c.5251G>C (p.Glu1751Gln) rs755397489
NM_000051.3(ATM):c.5256T>C (p.Ile1752=) rs1555105718
NM_000051.3(ATM):c.5258A>G (p.Tyr1753Cys) rs777481236
NM_000051.3(ATM):c.5262G>T (p.Lys1754Asn) rs748900588
NM_000051.3(ATM):c.5263A>G (p.Met1755Val) rs876659150
NM_000051.3(ATM):c.5264T>C (p.Met1755Thr) rs1555105739
NM_000051.3(ATM):c.5265G>T (p.Met1755Ile) rs1060501556
NM_000051.3(ATM):c.5267C>G (p.Thr1756Arg) rs786203369
NM_000051.3(ATM):c.526C>A (p.Leu176Met)
NM_000051.3(ATM):c.526C>G (p.Leu176Val) rs375798802
NM_000051.3(ATM):c.5271A>G (p.Thr1757=) rs1555105759
NM_000051.3(ATM):c.5274T>A (p.Asp1758Glu) rs913665369
NM_000051.3(ATM):c.5276C>T (p.Pro1759Leu) rs1565477222
NM_000051.3(ATM):c.5278A>G (p.Met1760Val) rs151327241
NM_000051.3(ATM):c.527T>A (p.Leu176Gln) rs1555066315
NM_000051.3(ATM):c.5286_5293del (p.Tyr1763fs)
NM_000051.3(ATM):c.5288_5289insGA (p.Tyr1763Ter) rs1555105786
NM_000051.3(ATM):c.5290del (p.Leu1764fs) rs587779846
NM_000051.3(ATM):c.5294A>G (p.Gln1765Arg) rs35556390
NM_000051.3(ATM):c.5300T>G (p.Phe1767Cys) rs864622125
NM_000051.3(ATM):c.5309C>G (p.Ser1770Ter) rs121434223
NM_000051.3(ATM):c.5310A>G (p.Ser1770=) rs1060504282
NM_000051.3(ATM):c.5318del (p.Lys1773fs) rs876660289
NM_000051.3(ATM):c.5319+1G>T rs876660175
NM_000051.3(ATM):c.5319+2T>C rs1555105842
NM_000051.3(ATM):c.5319+3C>A rs371640963
NM_000051.3(ATM):c.5319+3C>T rs371640963
NM_000051.3(ATM):c.5319+6_5319+7delTT rs777478613
NM_000051.3(ATM):c.5319+7T>A rs925428128
NM_000051.3(ATM):c.5319+8A>G rs375051697
NM_000051.3(ATM):c.5319_5319+8delGGTCTCTTAinsTGTTTG rs1064792939
NM_000051.3(ATM):c.5320-10T>C rs864622731
NM_000051.3(ATM):c.5320-4_5323del8 rs1057516540
NM_000051.3(ATM):c.5320-5_5320-2delTCTA rs730881310
NM_000051.3(ATM):c.5320-6_5320-3delTTCT rs864622386
NM_000051.3(ATM):c.5320-7T>G rs863224292
NM_000051.3(ATM):c.5323T>G (p.Leu1775Val) rs768820804
NM_000051.3(ATM):c.5326G>A (p.Glu1776Lys) rs1555106321
NM_000051.3(ATM):c.5329G>A (p.Val1777Ile) rs1064794192
NM_000051.3(ATM):c.5332C>T (p.Pro1778Ser) rs1279041730
NM_000051.3(ATM):c.5335A>G (p.Arg1779Gly)
NM_000051.3(ATM):c.5337A>T (p.Arg1779Ser) rs369351803
NM_000051.3(ATM):c.533C>T (p.Pro178Leu)
NM_000051.3(ATM):c.5345A>G (p.Lys1782Arg) rs878853520
NM_000051.3(ATM):c.5346A>C (p.Lys1782Asn) rs1555106345
NM_000051.3(ATM):c.534T>C (p.Pro178=) rs1060504293
NM_000051.3(ATM):c.534T>G (p.Pro178=) rs1060504293
NM_000051.3(ATM):c.5351del (p.Asn1784fs) rs1057517101
NM_000051.3(ATM):c.5352C>T (p.Asn1784=) rs140641762
NM_000051.3(ATM):c.5352_5355del (p.Pro1785fs)
NM_000051.3(ATM):c.5354C>A (p.Pro1785His) rs1555106368
NM_000051.3(ATM):c.5355T>G (p.Pro1785=) rs1025083720
NM_000051.3(ATM):c.5362G>A (p.Gly1788Ser) rs730881373
NM_000051.3(ATM):c.5369A>G (p.Asp1790Gly) rs746945284
NM_000051.3(ATM):c.5369A>T (p.Asp1790Val) rs746945284
NM_000051.3(ATM):c.5375T>C (p.Ile1792Thr) rs776309355
NM_000051.3(ATM):c.5375T>G (p.Ile1792Arg)
NM_000051.3(ATM):c.5382G>A (p.Leu1794=) rs188362115
NM_000051.3(ATM):c.538C>A (p.Gln180Lys) rs730881333
NM_000051.3(ATM):c.538C>T (p.Gln180Ter) rs730881333
NM_000051.3(ATM):c.5395dup (p.Ser1799fs)
NM_000051.3(ATM):c.539A>G (p.Gln180Arg) rs730881334
NM_000051.3(ATM):c.5402A>G (p.Asn1801Ser) rs1555106445
NM_000051.3(ATM):c.5405A>G (p.His1802Arg) rs878853521
NM_000051.3(ATM):c.5405dup (p.His1802fs) rs1555106452
NM_000051.3(ATM):c.5409C>T (p.Asp1803=) rs1555106462
NM_000051.3(ATM):c.5410A>T (p.Ile1804Phe) rs769872474
NM_000051.3(ATM):c.5414G>A (p.Trp1805Ter) rs879254171
NM_000051.3(ATM):c.5417T>C (p.Ile1806Thr) rs773546064
NM_000051.3(ATM):c.5418A>G (p.Ile1806Met) rs763020528
NM_000051.3(ATM):c.5428A>T (p.Thr1810Ser) rs876659748
NM_000051.3(ATM):c.5429C>T (p.Thr1810Ile) rs1565479223
NM_000051.3(ATM):c.5432G>C (p.Cys1811Ser) rs149569091
NM_000051.3(ATM):c.5433T>A (p.Cys1811Ter) rs1555106493
NM_000051.3(ATM):c.5435C>T (p.Ala1812Val) rs199885813
NM_000051.3(ATM):c.5436T>G (p.Ala1812=) rs1555106502
NM_000051.3(ATM):c.5443G>A (p.Asp1815Asn) rs933604666
NM_000051.3(ATM):c.5443del (p.Asp1815fs) rs878853522
NM_000051.3(ATM):c.5445C>G (p.Asp1815Glu) rs1555106518
NM_000051.3(ATM):c.5448T>C (p.Ser1816=) rs766455425
NM_000051.3(ATM):c.544G>C (p.Val182Leu) rs3218707
NM_000051.3(ATM):c.5453_5454delinsAA (p.Gly1818Glu) rs1555106531
NM_000051.3(ATM):c.5456C>T (p.Thr1819Ile) rs760060843
NM_000051.3(ATM):c.5459A>C (p.Lys1820Thr) rs983664978
NM_000051.3(ATM):c.5460dup (p.Cys1821fs) rs1057516760
NM_000051.3(ATM):c.5462G>T (p.Cys1821Phe) rs1565479431
NM_000051.3(ATM):c.5464G>A (p.Glu1822Lys)
NM_000051.3(ATM):c.5470C>T (p.Leu1824Phe) rs764784077
NM_000051.3(ATM):c.5471T>C (p.Leu1824Pro) rs1565479465
NM_000051.3(ATM):c.5474A>C (p.Gln1825Pro) rs587782655
NM_000051.3(ATM):c.5475A>G (p.Gln1825=) rs1555106560
NM_000051.3(ATM):c.5476T>C (p.Leu1826=) rs1555106563
NM_000051.3(ATM):c.5476T>G (p.Leu1826Val) rs1555106563
NM_000051.3(ATM):c.5488A>G (p.Met1830Val) rs587781622
NM_000051.3(ATM):c.5489T>C (p.Met1830Thr) rs145812395
NM_000051.3(ATM):c.548A>C (p.His183Pro) rs786204219
NM_000051.3(ATM):c.5490G>A (p.Met1830Ile) rs779720793
NM_000051.3(ATM):c.5496+2T>G
NM_000051.3(ATM):c.5496+2_5496+5delTAAG rs1565479572
NM_000051.3(ATM):c.5496+7_5496+9delAGA rs878853523
NM_000051.3(ATM):c.5497-2A>C rs786203796
NM_000051.3(ATM):c.5497-2A>G rs786203796
NM_000051.3(ATM):c.5497-3T>C
NM_000051.3(ATM):c.5497-4C>G
NM_000051.3(ATM):c.5497-8T>C rs3092829
NM_000051.3(ATM):c.5497-9A>G rs878853524
NM_000051.3(ATM):c.549_550del (p.His183fs) rs730881297
NM_000051.3(ATM):c.5507A>T (p.Asp1836Val) rs1555107256
NM_000051.3(ATM):c.5509T>G (p.Phe1837Val) rs876660472
NM_000051.3(ATM):c.5511_5512del (p.Phe1837fs) rs1555107263
NM_000051.3(ATM):c.5515C>T (p.Gln1839Ter) rs786204751
NM_000051.3(ATM):c.5521G>A (p.Val1841Ile) rs1565481593
NM_000051.3(ATM):c.5523A>C (p.Val1841=) rs1060504268
NM_000051.3(ATM):c.5524C>A (p.Leu1842Ile)
NM_000051.3(ATM):c.5524C>T (p.Leu1842Phe) rs956546711
NM_000051.3(ATM):c.5525T>G (p.Leu1842Arg) rs1060501619
NM_000051.3(ATM):c.5527C>G (p.Pro1843Ala) rs1060501607
NM_000051.3(ATM):c.5528C>G (p.Pro1843Arg) rs764522350
NM_000051.3(ATM):c.5529A>G (p.Pro1843=) rs750037588
NM_000051.3(ATM):c.5544T>C (p.Asp1848=) rs146568734
NM_000051.3(ATM):c.5549T>A (p.Leu1850Ter) rs878853525
NM_000051.3(ATM):c.5549del (p.Leu1850fs) rs876658287
NM_000051.3(ATM):c.554T>C (p.Val185Ala) rs730881335
NM_000051.3(ATM):c.5550A>G (p.Leu1850=) rs35850088
NM_000051.3(ATM):c.5551C>G (p.Leu1851Val) rs200842502
NM_000051.3(ATM):c.5554C>A (p.Gln1852Lys) rs754562056
NM_000051.3(ATM):c.5554C>T (p.Gln1852Ter) rs754562056
NM_000051.3(ATM):c.5554dup (p.Gln1852fs) rs1555107356
NM_000051.3(ATM):c.5557G>A (p.Asp1853Asn) rs1801516
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.5561C>G (p.Thr1854Arg) rs138710254
NM_000051.3(ATM):c.5564A>G (p.Asn1855Ser) rs1565481878
NM_000051.3(ATM):c.5565T>G (p.Asn1855Lys) rs1565481888
NM_000051.3(ATM):c.5566G>C (p.Glu1856Gln)
NM_000051.3(ATM):c.5573G>A (p.Trp1858Ter) rs879254076
NM_000051.3(ATM):c.5576G>A (p.Arg1859Lys) rs1060501568
NM_000051.3(ATM):c.5576G>T (p.Arg1859Ile) rs1060501568
NM_000051.3(ATM):c.557T>G (p.Leu186Ter) rs1555066388
NM_000051.3(ATM):c.5583G>A (p.Leu1861=) rs781383087
NM_000051.3(ATM):c.5584C>T (p.Leu1862Phe)
NM_000051.3(ATM):c.5589T>C (p.Ser1863=) rs786203902
NM_000051.3(ATM):c.558A>C (p.Leu186Phe) rs991667156
NM_000051.3(ATM):c.5590A>G (p.Thr1864Ala) rs1240167425
NM_000051.3(ATM):c.5591C>G (p.Thr1864Arg) rs779156037
NM_000051.3(ATM):c.5595T>C (p.His1865=) rs772261410
NM_000051.3(ATM):c.559G>A (p.Val187Met) rs1060501614
NM_000051.3(ATM):c.55A>G (p.Arg19Gly) rs1565344118
NM_000051.3(ATM):c.5600A>G (p.Gln1867Arg) rs1555107457
NM_000051.3(ATM):c.5603G>A (p.Gly1868Glu) rs1565482084
NM_000051.3(ATM):c.5605T>C (p.Phe1869Leu) rs975721205
NM_000051.3(ATM):c.5605T>G (p.Phe1869Val)
NM_000051.3(ATM):c.5612C>T (p.Thr1871Ile) rs538452060
NM_000051.3(ATM):c.5618G>A (p.Cys1873Tyr) rs587782239
NM_000051.3(ATM):c.5618G>T (p.Cys1873Phe) rs587782239
NM_000051.3(ATM):c.5623C>A (p.Arg1875=) rs376603775
NM_000051.3(ATM):c.5623C>T (p.Arg1875Ter) rs376603775
NM_000051.3(ATM):c.5624G>A (p.Arg1875Gln) rs762304746
NM_000051.3(ATM):c.5624G>C (p.Arg1875Pro) rs762304746
NM_000051.3(ATM):c.5626C>T (p.His1876Tyr) rs1060501567
NM_000051.3(ATM):c.5628C>A (p.His1876Gln) rs1237700879
NM_000051.3(ATM):c.562G>T (p.Ala188Ser) rs1555066392
NM_000051.3(ATM):c.5630T>C (p.Phe1877Ser) rs202028401
NM_000051.3(ATM):c.5631C>G (p.Phe1877Leu) rs751327903
NM_000051.3(ATM):c.5631_5635delinsA (p.Phe1877fs) rs758852420
NM_000051.3(ATM):c.5632_5635del (p.Ser1878fs) rs758852420
NM_000051.3(ATM):c.5633C>T (p.Ser1878Leu) rs758908522
NM_000051.3(ATM):c.5634G>A (p.Ser1878=) rs767070325
NM_000051.3(ATM):c.5637A>G (p.Gln1879=) rs587781993
NM_000051.3(ATM):c.5639C>T (p.Thr1880Met) rs587780628
NM_000051.3(ATM):c.563C>A (p.Ala188Asp) rs1555066393
NM_000051.3(ATM):c.5640G>A (p.Thr1880=) rs757103582
NM_000051.3(ATM):c.5644C>T (p.Arg1882Ter) rs786204433
NM_000051.3(ATM):c.5645G>A (p.Arg1882Gln) rs587782236
NM_000051.3(ATM):c.5649C>T (p.Ser1883=) rs1057522721
NM_000051.3(ATM):c.5650A>G (p.Thr1884Ala) rs1555107562
NM_000051.3(ATM):c.5653A>T (p.Thr1885Ser) rs587779850
NM_000051.3(ATM):c.5653dup (p.Thr1885fs) rs587778077
NM_000051.3(ATM):c.5658T>C (p.Pro1886=) rs940182945
NM_000051.3(ATM):c.5660C>T (p.Ala1887Val) rs1297909613
NM_000051.3(ATM):c.5665T>A (p.Leu1889Met) rs746106249
NM_000051.3(ATM):c.566G>A (p.Arg189Lys) rs79075295
NM_000051.3(ATM):c.566G>C (p.Arg189Thr) rs79075295
NM_000051.3(ATM):c.5673A>G (p.Ser1891=) rs1555107607
NM_000051.3(ATM):c.5674+6C>G rs780204400
NM_000051.3(ATM):c.5674G>A (p.Glu1892Lys) rs730881375
NM_000051.3(ATM):c.5675-10T>G rs377599533
NM_000051.3(ATM):c.5675-3C>G rs876658545
NM_000051.3(ATM):c.5675-4T>A rs56075338
NM_000051.3(ATM):c.5675-7_5675-4delTTGT rs1189695629
NM_000051.3(ATM):c.5679_5680AG[1] (p.Glu1894fs) rs1060501580
NM_000051.3(ATM):c.5683C>G (p.His1895Asp) rs766901049
NM_000051.3(ATM):c.5683C>T (p.His1895Tyr) rs766901049
NM_000051.3(ATM):c.5686T>G (p.Phe1896Val) rs1565485959
NM_000051.3(ATM):c.568A>G (p.Ile190Val) rs1565369501
NM_000051.3(ATM):c.5690T>G (p.Phe1897Cys) rs587782516
NM_000051.3(ATM):c.5691C>T (p.Phe1897=) rs1555109057
NM_000051.3(ATM):c.5692C>T (p.Arg1898Ter) rs775036118
NM_000051.3(ATM):c.5693G>A (p.Arg1898Gln) rs370680798
NM_000051.3(ATM):c.5695T>C (p.Cys1899Arg) rs373213507
NM_000051.3(ATM):c.5699G>C (p.Cys1900Ser)
NM_000051.3(ATM):c.5703G>C (p.Leu1901Phe)
NM_000051.3(ATM):c.5704G>T (p.Asp1902Tyr) rs1565486050
NM_000051.3(ATM):c.5705A>G (p.Asp1902Gly) rs1565486057
NM_000051.3(ATM):c.5707A>G (p.Lys1903Glu) rs765027485
NM_000051.3(ATM):c.5712A>G (p.Lys1904=) rs864622127
NM_000051.3(ATM):c.5712del (p.Lys1904fs) rs587781730
NM_000051.3(ATM):c.5712dup (p.Ser1905fs) rs587781730
NM_000051.3(ATM):c.5715A>G (p.Ser1905=) rs1057524579
NM_000051.3(ATM):c.5718A>G (p.Gln1906=) rs863224293
NM_000051.3(ATM):c.5718_5719del (p.Arg1907fs) rs1555109102
NM_000051.3(ATM):c.5725A>G (p.Met1909Val) rs750561317
NM_000051.3(ATM):c.5726T>A (p.Met1909Lys)
NM_000051.3(ATM):c.5727G>A (p.Met1909Ile) rs1555109119
NM_000051.3(ATM):c.5728C>A (p.Leu1910Ile) rs143577586
NM_000051.3(ATM):c.5736T>C (p.Val1912=) rs1060504302
NM_000051.3(ATM):c.5738T>G (p.Val1913Gly) rs1060501688
NM_000051.3(ATM):c.5747T>C (p.Met1916Thr) rs1060501557
NM_000051.3(ATM):c.574C>A (p.His192Asn) rs587780629
NM_000051.3(ATM):c.574C>G (p.His192Asp) rs587780629
NM_000051.3(ATM):c.5750G>A (p.Arg1917Lys) rs377289524
NM_000051.3(ATM):c.5750G>C (p.Arg1917Thr) rs377289524
NM_000051.3(ATM):c.5753G>C (p.Arg1918Thr) rs148064985
NM_000051.3(ATM):c.5756A>C (p.Gln1919Pro) rs1565486302
NM_000051.3(ATM):c.5761A>G (p.Arg1921Gly) rs1060501527
NM_000051.3(ATM):c.5762+10T>C rs1276744102
NM_000051.3(ATM):c.5762+1G>A rs869312756
NM_000051.3(ATM):c.5762+1G>T rs869312756
NM_000051.3(ATM):c.5762+6G>A rs776532221
NM_000051.3(ATM):c.5762+9A>G rs1565486371
NM_000051.3(ATM):c.588del (p.Gly197fs) rs1057516683
NM_000051.3(ATM):c.590G>A (p.Gly197Glu) rs753806542
NM_000051.3(ATM):c.590G>T (p.Gly197Val) rs753806542
NM_000051.3(ATM):c.591A>T (p.Gly197=) rs587780630
NM_000051.3(ATM):c.595T>C (p.Cys199Arg)
NM_000051.3(ATM):c.597T>A (p.Cys199Ter) rs1565369633
NM_000051.3(ATM):c.599C>G (p.Ser200Cys) rs1060501562
NM_000051.3(ATM):c.5G>A (p.Ser2Asn) rs730881360
NM_000051.3(ATM):c.601C>T (p.Gln201Ter) rs886039666
NM_000051.3(ATM):c.605C>T (p.Thr202Ile) rs1555066438
NM_000051.3(ATM):c.607G>A (p.Asp203Asn)
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.610G>A (p.Gly204Arg) rs147915571
NM_000051.3(ATM):c.612A>G (p.Gly204=) rs878853527
NM_000051.3(ATM):c.616A>C (p.Asn206His) rs587781829
NM_000051.3(ATM):c.628T>C (p.Leu210=) rs1555066477
NM_000051.3(ATM):c.630G>A (p.Leu210=) rs1565369739
NM_000051.3(ATM):c.631G>A (p.Asp211Asn) rs1555066481
NM_000051.3(ATM):c.633C>G (p.Asp211Glu) rs1060501634
NM_000051.3(ATM):c.636T>C (p.Phe212=) rs1555066499
NM_000051.3(ATM):c.63A>G (p.Thr21=) rs199853729
NM_000051.3(ATM):c.640T>C (p.Ser214Pro) rs747053710
NM_000051.3(ATM):c.640del (p.Ser214fs) rs786204543
NM_000051.3(ATM):c.642C>T (p.Ser214=) rs1555066521
NM_000051.3(ATM):c.646G>T (p.Ala216Ser) rs2235002
NM_000051.3(ATM):c.649A>G (p.Ile217Val) rs547045780
NM_000051.3(ATM):c.649A>T (p.Ile217Phe) rs547045780
NM_000051.3(ATM):c.653A>C (p.Gln218Pro) rs1198686265
NM_000051.3(ATM):c.655T>C (p.Cys219Arg) rs771685059
NM_000051.3(ATM):c.657T>C (p.Cys219=) rs2235003
NM_000051.3(ATM):c.659C>T (p.Ala220Val) rs145355104
NM_000051.3(ATM):c.660G>A (p.Ala220=) rs763669136
NM_000051.3(ATM):c.662+1G>A rs1060501690
NM_000051.3(ATM):c.662+6C>G rs1565369978
NM_000051.3(ATM):c.662+8_662+12delAATCT rs864622475
NM_000051.3(ATM):c.662G>A (p.Arg221Lys)
NM_000051.3(ATM):c.663-2A>G rs886041931
NM_000051.3(ATM):c.663-6T>A rs1555066907
NM_000051.3(ATM):c.663-8C>A rs1060501661
NM_000051.3(ATM):c.663A>T (p.Arg221Ser) rs1555066913
NM_000051.3(ATM):c.664C>T (p.Gln222Ter) rs1555066917
NM_000051.3(ATM):c.668A>G (p.Glu223Gly) rs776227830
NM_000051.3(ATM):c.66A>G (p.Glu22=) rs1185359350
NM_000051.3(ATM):c.670A>G (p.Lys224Glu) rs145053092
NM_000051.3(ATM):c.672G>C (p.Lys224Asn) rs769731317
NM_000051.3(ATM):c.672G>T (p.Lys224Asn) rs769731317
NM_000051.3(ATM):c.67C>T (p.Arg23Ter) rs746235533
NM_000051.3(ATM):c.680C>G (p.Ser227Ter)
NM_000051.3(ATM):c.680C>T (p.Ser227Leu) rs762998620
NM_000051.3(ATM):c.681dup (p.Gly228fs)
NM_000051.3(ATM):c.689del (p.Asn230fs) rs1057518965
NM_000051.3(ATM):c.68G>A (p.Arg23Gln) rs587779858
NM_000051.3(ATM):c.691C>G (p.His231Asp) rs1460757633
NM_000051.3(ATM):c.692A>G (p.His231Arg) rs587782229
NM_000051.3(ATM):c.695T>G (p.Ile232Ser) rs786203502
NM_000051.3(ATM):c.699A>G (p.Leu233=) rs1555067006
NM_000051.3(ATM):c.699A>T (p.Leu233Phe)
NM_000051.3(ATM):c.69A>G (p.Arg23=) rs876659304
NM_000051.3(ATM):c.702A>G (p.Ala234=) rs752751588
NM_000051.3(ATM):c.707T>G (p.Leu236Arg)
NM_000051.3(ATM):c.709A>G (p.Thr237Ala) rs376529329
NM_000051.3(ATM):c.710del (p.Thr237fs) rs1060501642
NM_000051.3(ATM):c.712A>G (p.Ile238Val) rs754275014
NM_000051.3(ATM):c.716T>C (p.Phe239Ser) rs143198946
NM_000051.3(ATM):c.717C>T (p.Phe239=) rs779410490
NM_000051.3(ATM):c.717_720del (p.Phe239fs) rs587782660
NM_000051.3(ATM):c.718C>T (p.Leu240Phe) rs1210038351
NM_000051.3(ATM):c.719T>G (p.Leu240Arg) rs876658753
NM_000051.3(ATM):c.71A>T (p.Lys24Met) rs1060501710
NM_000051.3(ATM):c.72+1G>A rs786204088
NM_000051.3(ATM):c.72+2T>C
NM_000051.3(ATM):c.72+2delT rs1555053972
NM_000051.3(ATM):c.72+4G>A
NM_000051.3(ATM):c.722A>G (p.Lys241Arg)
NM_000051.3(ATM):c.724A>G (p.Thr242Ala) rs1555067068
NM_000051.3(ATM):c.728T>C (p.Leu243Ser) rs786202096
NM_000051.3(ATM):c.73-3C>G rs1555054039
NM_000051.3(ATM):c.73-3C>T rs1555054039
NM_000051.3(ATM):c.733G>A (p.Val245Ile) rs1555067081
NM_000051.3(ATM):c.735C>G (p.Val245=) rs3218674
NM_000051.3(ATM):c.735C>T (p.Val245=) rs3218674
NM_000051.3(ATM):c.737A>G (p.Asn246Ser) rs781023264
NM_000051.3(ATM):c.741T>C (p.Phe247=) rs876659081
NM_000051.3(ATM):c.742C>T (p.Arg248Ter) rs730881336
NM_000051.3(ATM):c.743G>A (p.Arg248Gln) rs769166447
NM_000051.3(ATM):c.743G>T (p.Arg248Leu) rs769166447
NM_000051.3(ATM):c.745A>G (p.Ile249Val) rs1060501636
NM_000051.3(ATM):c.748C>T (p.Arg250Ter) rs772821016
NM_000051.3(ATM):c.749G>A (p.Arg250Gln) rs56123940
NM_000051.3(ATM):c.750A>G (p.Arg250=) rs1555067112
NM_000051.3(ATM):c.751G>A (p.Val251Met) rs1057519145
NM_000051.3(ATM):c.752_753TG[2] (p.Cys252_Glu253delinsTer) rs876659003
NM_000051.3(ATM):c.753G>A (p.Val251=) rs876658806
NM_000051.3(ATM):c.754T>A (p.Cys252Ser) rs863224580
NM_000051.3(ATM):c.762A>G (p.Leu254=) rs1313709939
NM_000051.3(ATM):c.763G>C (p.Gly255Arg)
NM_000051.3(ATM):c.767A>G (p.Asp256Gly) rs907941927
NM_000051.3(ATM):c.769G>C (p.Glu257Gln) rs1565371596
NM_000051.3(ATM):c.76G>C (p.Glu26Gln) rs730881361
NM_000051.3(ATM):c.778C>A (p.Pro260Thr)
NM_000051.3(ATM):c.778C>G (p.Pro260Ala) rs863224581
NM_000051.3(ATM):c.779C>A (p.Pro260His) rs961262202
NM_000051.3(ATM):c.779C>T (p.Pro260Leu) rs961262202
NM_000051.3(ATM):c.77A>G (p.Glu26Gly) rs1555054052
NM_000051.3(ATM):c.781A>T (p.Thr261Ser) rs786203410
NM_000051.3(ATM):c.785T>A (p.Leu262Ter) rs864622163
NM_000051.3(ATM):c.785T>C (p.Leu262Ser) rs864622163
NM_000051.3(ATM):c.785T>G (p.Leu262Trp) rs864622163
NM_000051.3(ATM):c.78A>T (p.Glu26Asp) rs786202953
NM_000051.3(ATM):c.790del (p.Tyr264fs) rs587781978
NM_000051.3(ATM):c.799A>G (p.Thr267Ala) rs876660962
NM_000051.3(ATM):c.79G>A (p.Val27Ile) rs754770960
NM_000051.3(ATM):c.79G>C (p.Val27Leu)
NM_000051.3(ATM):c.802C>T (p.Gln268Ter) rs557012154
NM_000051.3(ATM):c.806A>G (p.His269Arg) rs1565371740
NM_000051.3(ATM):c.809G>A (p.Arg270Lys) rs587781857
NM_000051.3(ATM):c.811C>A (p.Leu271Ile) rs730881339
NM_000051.3(ATM):c.811C>G (p.Leu271Val) rs730881339
NM_000051.3(ATM):c.815A>T (p.Asn272Ile) rs1555067189
NM_000051.3(ATM):c.821C>T (p.Ser274Phe)
NM_000051.3(ATM):c.824del (p.Ser274_Leu275insTer) rs864622389
NM_000051.3(ATM):c.825_849dup (p.Gln284delinsLysArgSerHisTyrTer)
NM_000051.3(ATM):c.8269-?_8671+?del
NM_000051.3(ATM):c.826A>G (p.Lys276Glu) rs587782902
NM_000051.3(ATM):c.829G>T (p.Glu277Ter) rs876660933
NM_000051.3(ATM):c.832G>T (p.Val278Phe) rs761005590
NM_000051.3(ATM):c.835A>G (p.Ile279Val) rs1555067210
NM_000051.3(ATM):c.838A>G (p.Ile280Val) rs764048041
NM_000051.3(ATM):c.841G>A (p.Glu281Lys)
NM_000051.3(ATM):c.846A>T (p.Leu282Phe) rs754008850
NM_000051.3(ATM):c.847T>G (p.Phe283Val)
NM_000051.3(ATM):c.849T>A (p.Phe283Leu) rs1060501617
NM_000051.3(ATM):c.854T>G (p.Leu285Arg) rs864622605
NM_000051.3(ATM):c.855G>C (p.Leu285=) rs863224299
NM_000051.3(ATM):c.858A>G (p.Gln286=) rs145301478
NM_000051.3(ATM):c.861T>C (p.Ile287=) rs55849405
NM_000051.3(ATM):c.865A>C (p.Ile289Leu) rs1555067259
NM_000051.3(ATM):c.866T>C (p.Ile289Thr)
NM_000051.3(ATM):c.868C>A (p.His290Asn)
NM_000051.3(ATM):c.86A>C (p.Lys29Thr) rs147009251
NM_000051.3(ATM):c.871C>G (p.His291Asp) rs1555067280
NM_000051.3(ATM):c.872A>G (p.His291Arg) rs1555067285
NM_000051.3(ATM):c.875C>G (p.Pro292Arg)
NM_000051.3(ATM):c.875C>T (p.Pro292Leu) rs747727055
NM_000051.3(ATM):c.876G>A (p.Pro292=) rs755860432
NM_000051.3(ATM):c.877A>T (p.Lys293Ter) rs1057516442
NM_000051.3(ATM):c.879A>G (p.Lys293=) rs864622069
NM_000051.3(ATM):c.884C>A (p.Ala295Asp) rs1044092081
NM_000051.3(ATM):c.891C>G (p.Thr297=) rs575285986
NM_000051.3(ATM):c.89T>G (p.Phe30Cys) rs876658520
NM_000051.3(ATM):c.8T>C (p.Leu3Pro) rs1555053861
NM_000051.3(ATM):c.8del (p.Leu3fs) rs879254052
NM_000051.3(ATM):c.901+1G>A rs748840480
NM_000051.3(ATM):c.901+1_901+26delGTATAAAGGAAATGTTTACTGTTTTG
NM_000051.3(ATM):c.901+2delinsAA rs1555067355
NM_000051.3(ATM):c.901+4T>G
NM_000051.3(ATM):c.901+6A>C rs1555067357
NM_000051.3(ATM):c.901G>A (p.Gly301Ser) rs1064797160
NM_000051.3(ATM):c.902-1G>T rs1064793518
NM_000051.3(ATM):c.902G>A (p.Gly301Asp) rs202208861
NM_000051.3(ATM):c.903T>G (p.Gly301=) rs876659335
NM_000051.3(ATM):c.916A>G (p.Thr306Ala) rs1555068304
NM_000051.3(ATM):c.921A>T (p.Lys307Asn) rs1555068322
NM_000051.3(ATM):c.925A>G (p.Arg309Gly) rs876659841
NM_000051.3(ATM):c.927A>T (p.Arg309Ser)
NM_000051.3(ATM):c.928A>G (p.Ser310Gly) rs745773225
NM_000051.3(ATM):c.929del (p.Ser310fs)
NM_000051.3(ATM):c.931A>G (p.Ile311Val) rs876658322
NM_000051.3(ATM):c.936A>C (p.Leu312Phe) rs587782257
NM_000051.3(ATM):c.936A>G (p.Leu312=) rs587782257
NM_000051.3(ATM):c.93G>C (p.Lys31Asn) rs863224583
NM_000051.3(ATM):c.941A>G (p.Asn314Ser) rs886047610
NM_000051.3(ATM):c.946T>A (p.Tyr316Asn) rs142317485
NM_000051.3(ATM):c.946T>C (p.Tyr316His) rs142317485
NM_000051.3(ATM):c.947A>G (p.Tyr316Cys)
NM_000051.3(ATM):c.947_951del (p.Tyr316fs) rs1565375055
NM_000051.3(ATM):c.94C>T (p.Arg32Cys) rs148061139
NM_000051.3(ATM):c.957A>G (p.Leu319=) rs1060501542
NM_000051.3(ATM):c.958G>A (p.Val320Met) rs1060501655
NM_000051.3(ATM):c.95G>A (p.Arg32His) rs368161489
NM_000051.3(ATM):c.95G>T (p.Arg32Leu) rs368161489
NM_000051.3(ATM):c.961A>G (p.Asn321Asp)
NM_000051.3(ATM):c.962A>G (p.Asn321Ser) rs1555068398
NM_000051.3(ATM):c.963T>C (p.Asn321=) rs863224301
NM_000051.3(ATM):c.964_968del (p.Glu322fs) rs1555068404
NM_000051.3(ATM):c.967A>G (p.Ile323Val) rs587781511
NM_000051.3(ATM):c.969A>G (p.Ile323Met) rs1565375220
NM_000051.3(ATM):c.974A>T (p.His325Leu) rs1565375244
NM_000051.3(ATM):c.975_976TA[1] (p.Ile326fs) rs876658832
NM_000051.3(ATM):c.976A>G (p.Ile326Val) rs1555068422
NM_000051.3(ATM):c.978del (p.Ile326fs) rs1565375308
NM_000051.3(ATM):c.980G>A (p.Gly327Glu)
NM_000051.3(ATM):c.984_986del (p.Ser328del) rs876659593
NM_000051.3(ATM):c.985A>G (p.Arg329Gly)
NM_000051.3(ATM):c.986G>A (p.Arg329Lys) rs776938735
NM_000051.3(ATM):c.989G>A (p.Gly330Glu) rs762179829
NM_000051.3(ATM):c.992del (p.Lys331fs) rs1060501684
NM_000051.3(ATM):c.993G>A (p.Lys331=) rs786202048
NM_000051.3(ATM):c.995A>G (p.Tyr332Cys)
NM_000051.3(ATM):c.995A>T (p.Tyr332Phe) rs1060501664
NM_000051.3(ATM):c.998C>T (p.Ser333Phe) rs28904919
NM_000051.3(ATM):c.[1236-2A>T];[497-1G>A]
NM_001351834.2(ATM):c.3403-13dup rs3218681
c.1120C>T
c.2249ins9
c.2639del200nt
c.2810_2811insCTAG
c.2851-10T>G
c.3576G>A
c.3802delG
c.3894dupT
c.4507C>T
c.4852C>T
c.5390+2T>C
c.5395-12A>G
c.5908C>T
c.5932G>T
c.6095G>A
c.6404_6405insTT
c.7010_7011del
c.7271T>G
c.7327C>T
c.7449G>A
c.7883_7887del5
c.7926A>C
c.8264_8268del5
c.8313-2A>C
c.9372+1G>A

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.