ClinVar Miner

List of variants in gene ATP7B

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 588
Download table as spreadsheet
HGVS dbSNP
ATP7B, 1-BP DEL, 2337C
ATP7B, 1-BP DEL, 2511A
ATP7B, 1-BP INS, NT2487
ATP7B, 15-BP DEL, NT-441
ATP7B, 3-BP DEL, 3892GTC
ATP7B, 7-BP DEL, NT2010
NC_000013.11:g.(?_51973915)_(51975188_?)del
NM_000053.3(ATP7B):c.*1005G>T rs563813110
NM_000053.3(ATP7B):c.*1009G>A rs79747858
NM_000053.3(ATP7B):c.*1014A>G rs540878290
NM_000053.3(ATP7B):c.*1036C>T rs533209080
NM_000053.3(ATP7B):c.*1076A>T rs564499990
NM_000053.3(ATP7B):c.*1095C>T rs886050300
NM_000053.3(ATP7B):c.*111G>A rs546262455
NM_000053.3(ATP7B):c.*1172G>A rs1051332
NM_000053.3(ATP7B):c.*1182C>T rs79490882
NM_000053.3(ATP7B):c.*1265A>G rs762692870
NM_000053.3(ATP7B):c.*1385G>A rs41292780
NM_000053.3(ATP7B):c.*1409A>C rs537012324
NM_000053.3(ATP7B):c.*148C>T rs111901413
NM_000053.3(ATP7B):c.*1491A>G rs139053981
NM_000053.3(ATP7B):c.*1493T>C rs886050299
NM_000053.3(ATP7B):c.*1499A>T rs567043686
NM_000053.3(ATP7B):c.*1558T>A rs886050298
NM_000053.3(ATP7B):c.*1592T>C rs886050297
NM_000053.3(ATP7B):c.*15C>T rs73498144
NM_000053.3(ATP7B):c.*1659A>G rs113688195
NM_000053.3(ATP7B):c.*16G>A rs193922100
NM_000053.3(ATP7B):c.*1708A>G rs17076111
NM_000053.3(ATP7B):c.*1717G>T rs77770386
NM_000053.3(ATP7B):c.*1756T>C rs886050296
NM_000053.3(ATP7B):c.*1782C>G rs928169
NM_000053.3(ATP7B):c.*1782delC rs886050295
NM_000053.3(ATP7B):c.*1805C>T rs182439700
NM_000053.3(ATP7B):c.*1901G>A rs886050294
NM_000053.3(ATP7B):c.*190C>A rs115420019
NM_000053.3(ATP7B):c.*190C>T rs115420019
NM_000053.3(ATP7B):c.*221C>A rs886050305
NM_000053.3(ATP7B):c.*421C>T rs556584760
NM_000053.3(ATP7B):c.*510G>T rs886050304
NM_000053.3(ATP7B):c.*781T>C rs886050303
NM_000053.3(ATP7B):c.*786T>C rs886050302
NM_000053.3(ATP7B):c.*851T>C rs553202651
NM_000053.3(ATP7B):c.*870C>T rs532782366
NM_000053.3(ATP7B):c.*963C>T rs371788814
NM_000053.3(ATP7B):c.*994_*997delACTG rs886050301
NM_000053.3(ATP7B):c.-118_-116delATGinsAATCGGCG rs1555304632
NM_000053.3(ATP7B):c.-119del rs587783297
NM_000053.3(ATP7B):c.-122G>A rs886050311
NM_000053.3(ATP7B):c.-122_-118dup rs1555304635
NM_000053.3(ATP7B):c.-124_-123ins5 rs766338038
NM_000053.3(ATP7B):c.-126_-125ins5 rs1322135702
NM_000053.3(ATP7B):c.-127_-126ins5 rs1555304648
NM_000053.3(ATP7B):c.-388C>T rs913869716
NM_000053.3(ATP7B):c.-436_-422del15 rs1484840087
NM_000053.3(ATP7B):c.-441_-427del15 rs879255499
NM_000053.3(ATP7B):c.-54G>T rs115564351
NM_000053.3(ATP7B):c.-676A>G rs1021025464
NM_000053.3(ATP7B):c.-676_-659dup rs1555304816
NM_000053.3(ATP7B):c.-73G>T rs886050309
NM_000053.3(ATP7B):c.-74C>A rs193922101
NM_000053.3(ATP7B):c.-74C>T rs193922101
NM_000053.3(ATP7B):c.-97C>T rs886050310
NM_000053.3(ATP7B):c.103A>T (p.Lys35Ter) rs1057516516
NM_000053.3(ATP7B):c.1041C>T (p.Gly347=) rs1453094974
NM_000053.3(ATP7B):c.1063C>T (p.Gln355Ter) rs778490238
NM_000053.3(ATP7B):c.111dup (p.Ala38Cysfs) rs1555296939
NM_000053.3(ATP7B):c.1122C>G (p.Val374=) rs201254466
NM_000053.3(ATP7B):c.1129A>G (p.Ile377Val) rs775754066
NM_000053.3(ATP7B):c.1145C>G (p.Ser382Cys) rs774102085
NM_000053.3(ATP7B):c.1145_1151delCCCAACT (p.Ser382Trpfs) rs1176709391
NM_000053.3(ATP7B):c.1158G>T (p.Gly386=)
NM_000053.3(ATP7B):c.1172C>T (p.Ser391Leu) rs750724856
NM_000053.3(ATP7B):c.1185C>T (p.Ala395=) rs764551529
NM_000053.3(ATP7B):c.1215C>T (p.Pro405=) rs201020290
NM_000053.3(ATP7B):c.1216T>G (p.Ser406Ala) rs1801243
NM_000053.3(ATP7B):c.1221_1223delAATinsTATA (p.Ser409Terfs) rs1555296015
NM_000053.3(ATP7B):c.122A>G (p.Asn41Ser) rs201738967
NM_000053.3(ATP7B):c.1230A>G (p.Pro410=) rs772843652
NM_000053.3(ATP7B):c.1231G>A (p.Glu411Lys) rs886050308
NM_000053.3(ATP7B):c.1278C>T (p.Val426=) rs143556945
NM_000053.3(ATP7B):c.1285+2T>A rs759749626
NM_000053.3(ATP7B):c.1285+5G>T rs370579582
NM_000053.3(ATP7B):c.1291T>C (p.Cys431Arg) rs145173864
NM_000053.3(ATP7B):c.1298C>G (p.Thr433Ser)
NM_000053.3(ATP7B):c.130T>A (p.Tyr44Asn)
NM_000053.3(ATP7B):c.1336G>C (p.Val446Leu) rs587783298
NM_000053.3(ATP7B):c.1337_1338insTT (p.Gln447Cysfs) rs1057517141
NM_000053.3(ATP7B):c.133G>A (p.Glu45Lys) rs777504965
NM_000053.3(ATP7B):c.1340_1343delAAAC (p.Gln447Leufs) rs1057517444
NM_000053.3(ATP7B):c.1362A>G (p.Thr454=) rs150018860
NM_000053.3(ATP7B):c.1366G>C (p.Val456Leu) rs1801244
NM_000053.3(ATP7B):c.1372G>T (p.Glu458Ter) rs1057516305
NM_000053.3(ATP7B):c.1374_1377delAGTG (p.Val459Leufs) rs1060499593
NM_000053.3(ATP7B):c.1392dup (p.Arg465Glufs) rs1555295017
NM_000053.3(ATP7B):c.1415C>T (p.Pro472Leu) rs771789585
NM_000053.3(ATP7B):c.1426G>A (p.Ala476Thr) rs139289704
NM_000053.3(ATP7B):c.1428A>G (p.Ala476=) rs914451059
NM_000053.3(ATP7B):c.1461G>A (p.Pro487=) rs372068316
NM_000053.3(ATP7B):c.1470C>A (p.Cys490Ter) rs778675259
NM_000053.3(ATP7B):c.1475T>C (p.Leu492Ser)
NM_000053.3(ATP7B):c.1512dupT (p.Asn505Terfs) rs1057516418
NM_000053.3(ATP7B):c.1531C>T (p.Gln511Ter)
NM_000053.3(ATP7B):c.1543+13C>T rs200171850
NM_000053.3(ATP7B):c.1543+14G>A rs770362811
NM_000053.3(ATP7B):c.1543+1G>T
NM_000053.3(ATP7B):c.1544-2A>C rs1555294398
NM_000053.3(ATP7B):c.1568T>A (p.Leu523Ter) rs773385516
NM_000053.3(ATP7B):c.1607T>C (p.Val536Ala) rs138427376
NM_000053.3(ATP7B):c.1609_1610insGGTCA (p.Ile537Argfs) rs886043238
NM_000053.3(ATP7B):c.1616C>T (p.Pro539Leu) rs572122562
NM_000053.3(ATP7B):c.1620C>T (p.Leu540=) rs145798966
NM_000053.3(ATP7B):c.1621G>A (p.Glu541Lys) rs187046823
NM_000053.3(ATP7B):c.1639C>T (p.Gln547Ter) rs996419100
NM_000053.3(ATP7B):c.1694A>G (p.Asn565Ser)
NM_000053.3(ATP7B):c.1700_1707+16del24 rs1555294199
NM_000053.3(ATP7B):c.1707+29dup rs113829533
NM_000053.3(ATP7B):c.1707+9T>C rs114449708
NM_000053.3(ATP7B):c.1707+9_1707+10insGT rs797045401
NM_000053.3(ATP7B):c.1708-14A>G rs751612293
NM_000053.3(ATP7B):c.1708-1G>A rs137853280
NM_000053.3(ATP7B):c.1708-1G>C rs137853280
NM_000053.3(ATP7B):c.1708-25_1719delGGATTCTTGCCATCCTGTGTTGCAGATCACAGGGATG
NM_000053.3(ATP7B):c.1708-2A>G rs1057517024
NM_000053.3(ATP7B):c.1708-5T>G rs770829226
NM_000053.3(ATP7B):c.1716delG (p.Met573Terfs) rs1057516893
NM_000053.3(ATP7B):c.1728G>A (p.Ala576=) rs116703544
NM_000053.3(ATP7B):c.1739delA (p.His580Profs) rs1555293357
NM_000053.3(ATP7B):c.1745_1746delTA (p.Ile582Argfs) rs753962912
NM_000053.3(ATP7B):c.174dupC (p.Thr59Hisfs) rs1057516561
NM_000053.3(ATP7B):c.1760C>T (p.Thr587Met) rs757716093
NM_000053.3(ATP7B):c.1762A>C (p.Arg588=)
NM_000053.3(ATP7B):c.1771G>A (p.Gly591Ser)
NM_000053.3(ATP7B):c.1772G>A (p.Gly591Asp) rs797045402
NM_000053.3(ATP7B):c.1782delT (p.Tyr594Terfs) rs780327716
NM_000053.3(ATP7B):c.1820dupA (p.Phe608Valfs) rs1057516940
NM_000053.3(ATP7B):c.1834A>G (p.Ile612Val) rs886050307
NM_000053.3(ATP7B):c.1839C>T (p.Ile613=) rs370476756
NM_000053.3(ATP7B):c.1840G>T (p.Gly614Cys) rs376565432
NM_000053.3(ATP7B):c.1847G>A (p.Arg616Gln) rs752850609
NM_000053.3(ATP7B):c.1869+20A>G
NM_000053.3(ATP7B):c.1877G>C (p.Gly626Ala) rs587783299
NM_000053.3(ATP7B):c.1878C>T (p.Gly626=) rs587783300
NM_000053.3(ATP7B):c.1911C>T (p.Asn637=) rs770640457
NM_000053.3(ATP7B):c.1912G>A (p.Ala638Thr) rs886038218
NM_000053.3(ATP7B):c.1915C>T (p.His639Tyr) rs200728096
NM_000053.3(ATP7B):c.1922T>C (p.Leu641Ser) rs186924074
NM_000053.3(ATP7B):c.1924G>C (p.Asp642His) rs72552285
NM_000053.3(ATP7B):c.1924G>T (p.Asp642Tyr) rs72552285
NM_000053.3(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.3(ATP7B):c.1946+6T>C rs751287778
NM_000053.3(ATP7B):c.1947-15G>T rs1555291926
NM_000053.3(ATP7B):c.1947-4C>T rs74904335
NM_000053.3(ATP7B):c.1965G>T (p.Leu655=)
NM_000053.3(ATP7B):c.1969A>C (p.Ser657Arg) rs372436901
NM_000053.3(ATP7B):c.1993A>G (p.Met665Val) rs146303208
NM_000053.3(ATP7B):c.1995G>A (p.Met665Ile) rs72552259
NM_000053.3(ATP7B):c.19_20delCA (p.Gln7Aspfs) rs749363958
NM_000053.3(ATP7B):c.2000T>A (p.Leu667Ter) rs1474837260
NM_000053.3(ATP7B):c.2002A>G (p.Met668Val) rs587783301
NM_000053.3(ATP7B):c.2009_2015delATATGCT (p.Tyr670Terfs) rs779904655
NM_000053.3(ATP7B):c.2011_2012dup (p.Met671Ilefs) rs1555291870
NM_000053.3(ATP7B):c.2028C>T (p.Asn676=)
NM_000053.3(ATP7B):c.2035delC (p.His679Thrfs) rs786204764
NM_000053.3(ATP7B):c.2038C>T (p.Gln680Ter) rs1555291848
NM_000053.3(ATP7B):c.2044A>G (p.Met682Val) rs1555291836
NM_000053.3(ATP7B):c.2060_2062delACA (p.Asn687del) rs770107276
NM_000053.3(ATP7B):c.2067T>C (p.Ile689=) rs1274947728
NM_000053.3(ATP7B):c.2069C>T (p.Pro690Leu) rs1555291809
NM_000053.3(ATP7B):c.2071G>A (p.Gly691Arg) rs121908001
NM_000053.3(ATP7B):c.2072G>T (p.Gly691Val) rs1555291801
NM_000053.3(ATP7B):c.2078C>A (p.Ser693Tyr)
NM_000053.3(ATP7B):c.2078C>G (p.Ser693Cys) rs1212479289
NM_000053.3(ATP7B):c.2097_2099delCTT (p.Phe700del) rs1555291787
NM_000053.3(ATP7B):c.2097_2100delCTTT (p.Phe699Leufs) rs1555291784
NM_000053.3(ATP7B):c.2121+3A>G rs1248002612
NM_000053.3(ATP7B):c.2122-1G>A rs1319653818
NM_000053.3(ATP7B):c.2122-8T>G rs193922102
NM_000053.3(ATP7B):c.2123T>C (p.Leu708Pro) rs121908000
NM_000053.3(ATP7B):c.2128G>A (p.Gly710Ser) rs137853285
NM_000053.3(ATP7B):c.2129G>C (p.Gly710Ala) rs1555291285
NM_000053.3(ATP7B):c.2131G>A (p.Gly711Arg) rs1394999756
NM_000053.3(ATP7B):c.2131G>T (p.Gly711Trp) rs1394999756
NM_000053.3(ATP7B):c.2143T>C (p.Tyr715His) rs1555291272
NM_000053.3(ATP7B):c.2145C>A (p.Tyr715Ter) rs751202110
NM_000053.3(ATP7B):c.2146G>A (p.Val716Ile) rs886038219
NM_000053.3(ATP7B):c.2149C>T (p.Gln717Ter) rs1085307057
NM_000053.3(ATP7B):c.2152G>C (p.Ala718Pro) rs1555291265
NM_000053.3(ATP7B):c.2157C>A (p.Tyr719Ter) rs1057516380
NM_000053.3(ATP7B):c.2165dupT (p.Arg723Glufs) rs768729972
NM_000053.3(ATP7B):c.2166G>A (p.Leu722=) rs587783302
NM_000053.3(ATP7B):c.2174G>A (p.Arg725Lys) rs115227204
NM_000053.3(ATP7B):c.2175G>A (p.Arg725=) rs61733684
NM_000053.3(ATP7B):c.2184C>G (p.Asn728Lys)
NM_000053.3(ATP7B):c.2190C>T (p.Asp730=) rs550565277
NM_000053.3(ATP7B):c.2191G>A (p.Val731Met) rs762746959
NM_000053.3(ATP7B):c.2217dup (p.Ala740Cysfs) rs1555291207
NM_000053.3(ATP7B):c.2222dup (p.Tyr741Terfs) rs1180133690
NM_000053.3(ATP7B):c.222G>C (p.Lys74Asn) rs587776496
NM_000053.3(ATP7B):c.2233_2234delCT (p.Leu745Glyfs) rs1555291195
NM_000053.3(ATP7B):c.2251G>T (p.Ala751Ser) rs1555291181
NM_000053.3(ATP7B):c.2267C>T (p.Ala756Val) rs769927137
NM_000053.3(ATP7B):c.2268G>A (p.Ala756=) rs755387536
NM_000053.3(ATP7B):c.2279C>T (p.Pro760Leu) rs766907687
NM_000053.3(ATP7B):c.2292C>T (p.Phe764=) rs372979339
NM_000053.3(ATP7B):c.2293G>A (p.Asp765Asn) rs28942075
NM_000053.3(ATP7B):c.2294A>G (p.Asp765Gly) rs1555291147
NM_000053.3(ATP7B):c.2297C>G (p.Thr766Arg) rs121907997
NM_000053.3(ATP7B):c.2297C>T (p.Thr766Met)
NM_000053.3(ATP7B):c.2301C>T (p.Pro767=) rs770787421
NM_000053.3(ATP7B):c.2303C>T (p.Pro768Leu) rs1057516844
NM_000053.3(ATP7B):c.2304delC (p.Met769Cysfs) rs137853287
NM_000053.3(ATP7B):c.2304dup (p.Met769Hisfs) rs137853287
NM_000053.3(ATP7B):c.2305A>G (p.Met769Val) rs193922103
NM_000053.3(ATP7B):c.2310C>G (p.Leu770=) rs398123136
NM_000053.3(ATP7B):c.2326C>G (p.Leu776Val) rs1217463955
NM_000053.3(ATP7B):c.2332C>G (p.Arg778Gly) rs137853284
NM_000053.3(ATP7B):c.2332C>T (p.Arg778Trp) rs137853284
NM_000053.3(ATP7B):c.2333G>A (p.Arg778Gln) rs28942074
NM_000053.3(ATP7B):c.2333G>T (p.Arg778Leu) rs28942074
NM_000053.3(ATP7B):c.2335T>G (p.Trp779Gly) rs751798708
NM_000053.3(ATP7B):c.2336G>A (p.Trp779Ter) rs137853283
NM_000053.3(ATP7B):c.2337G>A (p.Trp779Ter) rs137853282
NM_000053.3(ATP7B):c.2351C>T (p.Ala784Val)
NM_000053.3(ATP7B):c.2354A>G (p.Lys785Arg) rs1555291085
NM_000053.3(ATP7B):c.2355+13T>G rs139211339
NM_000053.3(ATP7B):c.2355+4A>G rs776572343
NM_000053.3(ATP7B):c.2356-1G>A rs1555290925
NM_000053.3(ATP7B):c.2356-1G>C rs1555290925
NM_000053.3(ATP7B):c.2383C>T (p.Leu795Phe) rs751710854
NM_000053.3(ATP7B):c.2390C>T (p.Ser797Phe) rs1555290883
NM_000053.3(ATP7B):c.2428G>T (p.Glu810Ter) rs770020484
NM_000053.3(ATP7B):c.2438_2440delTAAinsAT (p.Leu813Tyrfs) rs1555290810
NM_000053.3(ATP7B):c.2447+1delG rs1057516732
NM_000053.3(ATP7B):c.2447+2T>G rs1555290800
NM_000053.3(ATP7B):c.2447+8A>G rs747586752
NM_000053.3(ATP7B):c.2448-11G>A rs200450017
NM_000053.3(ATP7B):c.2448-25G>A rs9526811
NM_000053.3(ATP7B):c.245A>G (p.Asn82Ser) rs1555296815
NM_000053.3(ATP7B):c.2469G>C (p.Glu823Asp) rs886050306
NM_000053.3(ATP7B):c.2478_2479delGCinsT (p.Gln826Hisfs) rs1555288808
NM_000053.3(ATP7B):c.2479C>T (p.Arg827Trp) rs539585071
NM_000053.3(ATP7B):c.2480G>C (p.Arg827Pro) rs368589213
NM_000053.3(ATP7B):c.2480G>T (p.Arg827Leu) rs368589213
NM_000053.3(ATP7B):c.2484C>T (p.Gly828=) rs570594838
NM_000053.3(ATP7B):c.2486A>G (p.Asp829Gly)
NM_000053.3(ATP7B):c.2495A>G (p.Lys832Arg) rs1061472
NM_000053.3(ATP7B):c.2513delA (p.Lys838Serfs) rs777362050
NM_000053.3(ATP7B):c.2519C>T (p.Pro840Leu) rs768671894
NM_000053.3(ATP7B):c.2532delA (p.Val845Serfs) rs755709270
NM_000053.3(ATP7B):c.2544C>T (p.Gly848=) rs200996053
NM_000053.3(ATP7B):c.2549C>T (p.Thr850Ile) rs777629392
NM_000053.3(ATP7B):c.254G>T (p.Gly85Val) rs786204643
NM_000053.3(ATP7B):c.2570T>C (p.Ile857Thr) rs1057520235
NM_000053.3(ATP7B):c.2575+1G>A rs766149114
NM_000053.3(ATP7B):c.2575+1G>C rs766149114
NM_000053.3(ATP7B):c.2575+5G>C rs551030054
NM_000053.3(ATP7B):c.2576-2A>G rs757265256
NM_000053.3(ATP7B):c.2583C>T (p.Ala861=) rs565717791
NM_000053.3(ATP7B):c.2591T>G (p.Val864Gly) rs1555288669
NM_000053.3(ATP7B):c.2605G>A (p.Gly869Arg) rs191312027
NM_000053.3(ATP7B):c.2620G>C (p.Ala874Pro) rs376355660
NM_000053.3(ATP7B):c.2621C>T (p.Ala874Val) rs121907994
NM_000053.3(ATP7B):c.2623G>A (p.Gly875Arg) rs587783304
NM_000053.3(ATP7B):c.2668G>A (p.Val890Met) rs786204718
NM_000053.3(ATP7B):c.2672G>A (p.Gly891Asp) rs483352684
NM_000053.3(ATP7B):c.2672G>C (p.Gly891Ala) rs483352684
NM_000053.3(ATP7B):c.2673C>G (p.Gly891=) rs587783305
NM_000053.3(ATP7B):c.268_270delAAG (p.Lys90del) rs751970838
NM_000053.3(ATP7B):c.2715G>C (p.Glu905Asp)
NM_000053.3(ATP7B):c.2730+1G>A rs1057516425
NM_000053.3(ATP7B):c.2731-2A>G rs367956522
NM_000053.3(ATP7B):c.2743C>T (p.Gln915Ter) rs1555288479
NM_000053.3(ATP7B):c.2752G>A (p.Asp918Asn) rs540935874
NM_000053.3(ATP7B):c.2755C>G (p.Arg919Gly) rs121907993
NM_000053.3(ATP7B):c.2755C>T (p.Arg919Trp) rs121907993
NM_000053.3(ATP7B):c.2785A>G (p.Ile929Val) rs534960245
NM_000053.3(ATP7B):c.2795C>A (p.Ser932Ter)
NM_000053.3(ATP7B):c.2797A>C (p.Thr933Pro) rs1555288410
NM_000053.3(ATP7B):c.2804C>T (p.Thr935Met) rs750019452
NM_000053.3(ATP7B):c.2806T>G (p.Leu936Val) rs367855110
NM_000053.3(ATP7B):c.2810delT (p.Val937Glyfs) rs1057516643
NM_000053.3(ATP7B):c.2817G>T (p.Trp939Cys) rs1057517310
NM_000053.3(ATP7B):c.2826_2832del7 (p.Gly943Serfs) rs1555288385
NM_000053.3(ATP7B):c.2827G>A (p.Gly943Ser) rs28942076
NM_000053.3(ATP7B):c.2827G>T (p.Gly943Cys) rs28942076
NM_000053.3(ATP7B):c.2828G>A (p.Gly943Asp) rs779323689
NM_000053.3(ATP7B):c.2848_2850delGTT (p.Val950del) rs1424494639
NM_000053.3(ATP7B):c.2855G>A (p.Arg952Lys) rs732774
NM_000053.3(ATP7B):c.2859C>T (p.Tyr953=)
NM_000053.3(ATP7B):c.2865+1G>A rs587783306
NM_000053.3(ATP7B):c.2866-13G>C rs7325983
NM_000053.3(ATP7B):c.2866-21C>T rs763362019
NM_000053.3(ATP7B):c.2866-2A>G
NM_000053.3(ATP7B):c.2901delC (p.Ile968Serfs) rs1064796054
NM_000053.3(ATP7B):c.2905C>T (p.Arg969Trp) rs774028495
NM_000053.3(ATP7B):c.2906G>A (p.Arg969Gln) rs121907996
NM_000053.3(ATP7B):c.2921C>T (p.Thr974Met) rs201061621
NM_000053.3(ATP7B):c.2930C>T (p.Thr977Met) rs72552255
NM_000053.3(ATP7B):c.2939G>A (p.Cys980Tyr) rs1038582488
NM_000053.3(ATP7B):c.2945C>T (p.Ala982Val) rs1487547257
NM_000053.3(ATP7B):c.2953T>C (p.Cys985Arg) rs193922104
NM_000053.3(ATP7B):c.2955C>T (p.Cys985=) rs116587608
NM_000053.3(ATP7B):c.2962G>C (p.Gly988Arg) rs199623434
NM_000053.3(ATP7B):c.2963G>A (p.Gly988Glu) rs1057518867
NM_000053.3(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000053.3(ATP7B):c.2973G>A (p.Thr991=) rs1801246
NM_000053.3(ATP7B):c.2975C>A (p.Pro992His) rs201038679
NM_000053.3(ATP7B):c.2975C>T (p.Pro992Leu) rs201038679
NM_000053.3(ATP7B):c.2976C>A (p.Pro992=) rs746358240
NM_000053.3(ATP7B):c.2978C>T (p.Thr993Met) rs200290721
NM_000053.3(ATP7B):c.2979G>C (p.Thr993=) rs200656411
NM_000053.3(ATP7B):c.2980G>T (p.Ala994Ser) rs1555287372
NM_000053.3(ATP7B):c.2984T>C (p.Val995Ala) rs777791532
NM_000053.3(ATP7B):c.2989G>A (p.Val997Met)
NM_000053.3(ATP7B):c.2998G>A (p.Gly1000Arg) rs751078884
NM_000053.3(ATP7B):c.3006C>T (p.Ala1002=) rs369620062
NM_000053.3(ATP7B):c.3007G>A (p.Ala1003Thr) rs201497300
NM_000053.3(ATP7B):c.3008C>T (p.Ala1003Val) rs775055397
NM_000053.3(ATP7B):c.3009G>A (p.Ala1003=) rs1801247
NM_000053.3(ATP7B):c.3011A>C (p.Gln1004Pro) rs587783307
NM_000053.3(ATP7B):c.3015C>T (p.Asn1005=) rs74085888
NM_000053.3(ATP7B):c.3021C>A (p.Ile1007=)
NM_000053.3(ATP7B):c.3036dup (p.Lys1013Glnfs) rs1555287300
NM_000053.3(ATP7B):c.3042C>T (p.Pro1014=) rs1438628867
NM_000053.3(ATP7B):c.3045G>A (p.Leu1015=) rs1801248
NM_000053.3(ATP7B):c.3051G>A (p.Met1017Ile) rs755851188
NM_000053.3(ATP7B):c.3053C>T (p.Ala1018Val) rs371840514
NM_000053.3(ATP7B):c.3054G>A (p.Ala1018=) rs193922105
NM_000053.3(ATP7B):c.3060+16G>T rs76163470
NM_000053.3(ATP7B):c.3061-12T>A rs1045194246
NM_000053.3(ATP7B):c.3061A>G (p.Ile1021Val) rs776490710
NM_000053.3(ATP7B):c.3069T>C (p.Thr1023=) rs187343742
NM_000053.3(ATP7B):c.3071T>C (p.Val1024Ala) rs1416453532
NM_000053.3(ATP7B):c.3074T>G (p.Met1025Arg) rs1555286633
NM_000053.3(ATP7B):c.3083_3085delAGAinsG (p.Lys1028Serfs)
NM_000053.3(ATP7B):c.3086C>T (p.Thr1029Ile) rs1555286628
NM_000053.3(ATP7B):c.3097A>G (p.Thr1033Ala) rs1555286620
NM_000053.3(ATP7B):c.3101A>G (p.His1034Arg) rs74085882
NM_000053.3(ATP7B):c.3104G>T (p.Gly1035Val) rs753594031
NM_000053.3(ATP7B):c.3105C>T (p.Gly1035=) rs200324179
NM_000053.3(ATP7B):c.3106G>A (p.Val1036Ile) rs761147984
NM_000053.3(ATP7B):c.3107dupT (p.Arg1038Glnfs) rs886043423
NM_000053.3(ATP7B):c.3121C>T (p.Arg1041Trp) rs746485916
NM_000053.3(ATP7B):c.3128T>C (p.Leu1043Pro) rs1412025509
NM_000053.3(ATP7B):c.3147delC (p.Thr1050Hisfs) rs762031690
NM_000053.3(ATP7B):c.314C>A (p.Ser105Ter) rs753236073
NM_000053.3(ATP7B):c.3155C>T (p.Pro1052Leu) rs778543794
NM_000053.3(ATP7B):c.3157dup (p.Leu1053Profs) rs1555286522
NM_000053.3(ATP7B):c.3160A>C (p.Arg1054=) rs377586515
NM_000053.3(ATP7B):c.3169C>T (p.Leu1057=) rs587783308
NM_000053.3(ATP7B):c.3182G>A (p.Gly1061Glu) rs764131178
NM_000053.3(ATP7B):c.3188C>T (p.Ala1063Val) rs587783309
NM_000053.3(ATP7B):c.3190G>A (p.Glu1064Lys) rs376910645
NM_000053.3(ATP7B):c.3191A>C (p.Glu1064Ala) rs374094065
NM_000053.3(ATP7B):c.3203A>G (p.Glu1068Gly) rs1555286478
NM_000053.3(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.3(ATP7B):c.3208C>T (p.Pro1070Ser) rs1423701688
NM_000053.3(ATP7B):c.3210C>T (p.Pro1070=) rs587783310
NM_000053.3(ATP7B):c.3211T>C (p.Leu1071=) rs748003525
NM_000053.3(ATP7B):c.3215G>A (p.Gly1072Asp) rs1397311718
NM_000053.3(ATP7B):c.3221C>T (p.Ala1074Val) rs1206016866
NM_000053.3(ATP7B):c.322T>C (p.Cys108Arg)
NM_000053.3(ATP7B):c.3236G>T (p.Cys1079Phe) rs1064797072
NM_000053.3(ATP7B):c.3243+1G>A rs748819198
NM_000053.3(ATP7B):c.3243+5G>A rs373193482
NM_000053.3(ATP7B):c.3244-2A>G rs786204584
NM_000053.3(ATP7B):c.3247C>T (p.Leu1083Phe) rs1286080173
NM_000053.3(ATP7B):c.325C>T (p.Leu109=) rs751920801
NM_000053.3(ATP7B):c.3263T>A (p.Leu1088Ter) rs753250853
NM_000053.3(ATP7B):c.3266G>A (p.Gly1089Glu) rs1555285911
NM_000053.3(ATP7B):c.3272G>A (p.Cys1091Tyr) rs778825095
NM_000053.3(ATP7B):c.3275C>T (p.Thr1092Met) rs368545738
NM_000053.3(ATP7B):c.3280_3281insGTAT (p.Phe1094Cysfs)
NM_000053.3(ATP7B):c.3284A>C (p.Gln1095Pro) rs1555285891
NM_000053.3(ATP7B):c.3295G>A (p.Gly1099Ser) rs761632029
NM_000053.3(ATP7B):c.3298T>A (p.Cys1100Ser)
NM_000053.3(ATP7B):c.3298_3300delTGTinsAGTGCCAGGCAGTGCCA (p.Cys1100Serfs)
NM_000053.3(ATP7B):c.3300_3301insGCCAGGCAGTGCCA (p.Gly1101Alafs)
NM_000053.3(ATP7B):c.3301G>A (p.Gly1101Arg) rs786204483
NM_000053.3(ATP7B):c.3305T>C (p.Ile1102Thr) rs560952220
NM_000053.3(ATP7B):c.3316G>A (p.Val1106Ile) rs541208827
NM_000053.3(ATP7B):c.3317T>A (p.Val1106Asp) rs775541743
NM_000053.3(ATP7B):c.331C>T (p.Gln111Ter) rs774221179
NM_000053.3(ATP7B):c.3324C>T (p.Asn1108=) rs372456815
NM_000053.3(ATP7B):c.3350_3353delAGCG (p.Glu1117Alafs) rs1555285830
NM_000053.3(ATP7B):c.3360G>A (p.Leu1120=) rs1555285820
NM_000053.3(ATP7B):c.3366A>G (p.Ala1122=) rs59120265
NM_000053.3(ATP7B):c.3369G>A (p.Pro1123=) rs61733679
NM_000053.3(ATP7B):c.3381G>A (p.Leu1127=) rs587783311
NM_000053.3(ATP7B):c.3396C>T (p.Ser1132=) rs370947152
NM_000053.3(ATP7B):c.3399T>C (p.Leu1133=) rs587783312
NM_000053.3(ATP7B):c.3402C>T (p.Pro1134=) rs145887771
NM_000053.3(ATP7B):c.3402delC (p.Ala1135Glnfs) rs137853281
NM_000053.3(ATP7B):c.3403G>A (p.Ala1135Thr) rs187200982
NM_000053.3(ATP7B):c.3405A>G (p.Ala1135=) rs373081328
NM_000053.3(ATP7B):c.3419T>C (p.Val1140Ala) rs1801249
NM_000053.3(ATP7B):c.3422C>G (p.Pro1141Arg) rs757549770
NM_000053.3(ATP7B):c.3426G>C (p.Gln1142His) rs778749563
NM_000053.3(ATP7B):c.3428C>A (p.Thr1143Asn) rs587783313
NM_000053.3(ATP7B):c.3431_3433delTCT (p.Phe1144del) rs1555285393
NM_000053.3(ATP7B):c.3436G>A (p.Val1146Met) rs1213481140
NM_000053.3(ATP7B):c.3443T>C (p.Ile1148Thr) rs60431989
NM_000053.3(ATP7B):c.3446G>C (p.Gly1149Ala)
NM_000053.3(ATP7B):c.3449delA (p.Asn1150Thrfs) rs1555285380
NM_000053.3(ATP7B):c.3451C>G (p.Arg1151Gly) rs755554442
NM_000053.3(ATP7B):c.3451C>T (p.Arg1151Cys) rs755554442
NM_000053.3(ATP7B):c.3452G>A (p.Arg1151His) rs377297166
NM_000053.3(ATP7B):c.3467G>A (p.Arg1156His) rs773917820
NM_000053.3(ATP7B):c.347T>C (p.Ile116Thr) rs199773340
NM_000053.3(ATP7B):c.3489C>T (p.Ser1163=) rs193922106
NM_000053.3(ATP7B):c.3498T>C (p.Ser1166=) rs587783314
NM_000053.3(ATP7B):c.3502G>T (p.Ala1168Ser) rs777879359
NM_000053.3(ATP7B):c.3505A>G (p.Met1169Val) rs749085322
NM_000053.3(ATP7B):c.3506T>C (p.Met1169Thr) rs1555285311
NM_000053.3(ATP7B):c.3517G>A (p.Glu1173Lys) rs756029120
NM_000053.3(ATP7B):c.3526G>T (p.Gly1176Ter) rs137853279
NM_000053.3(ATP7B):c.3529C>T (p.Gln1177Ter) rs1057516479
NM_000053.3(ATP7B):c.3548C>G (p.Ala1183Gly) rs587783315
NM_000053.3(ATP7B):c.3550A>G (p.Ile1184Val) rs1057519121
NM_000053.3(ATP7B):c.3552dupT (p.Asp1185Terfs) rs748924063
NM_000053.3(ATP7B):c.3556+1G>A rs184388696
NM_000053.3(ATP7B):c.3556+1G>T rs184388696
NM_000053.3(ATP7B):c.3556G>A (p.Gly1186Ser) rs786204547
NM_000053.3(ATP7B):c.3556G>C (p.Gly1186Arg) rs786204547
NM_000053.3(ATP7B):c.3557-6C>T rs140708492
NM_000053.3(ATP7B):c.3557-7G>A rs368128448
NM_000053.3(ATP7B):c.3571A>G (p.Met1191Val)
NM_000053.3(ATP7B):c.3583G>A (p.Ala1195Thr) rs202218969
NM_000053.3(ATP7B):c.3588C>T (p.Asp1196=) rs11840224
NM_000053.3(ATP7B):c.3589G>A (p.Ala1197Thr) rs758025913
NM_000053.3(ATP7B):c.3598C>T (p.Gln1200Ter) rs786204658
NM_000053.3(ATP7B):c.3620A>G (p.His1207Arg) rs7334118
NM_000053.3(ATP7B):c.3623C>T (p.Thr1208Met) rs370713752
NM_000053.3(ATP7B):c.3624G>A (p.Thr1208=) rs377267217
NM_000053.3(ATP7B):c.3638G>T (p.Gly1213Val) rs1555284582
NM_000053.3(ATP7B):c.3644A>G (p.Asp1215Gly) rs1555284575
NM_000053.3(ATP7B):c.3646G>A (p.Val1216Met) rs776280797
NM_000053.3(ATP7B):c.3649_3654del6 (p.Val1217_Leu1218del) rs781266802
NM_000053.3(ATP7B):c.3659C>T (p.Thr1220Met) rs193922107
NM_000053.3(ATP7B):c.3662G>A (p.Gly1221Glu) rs1486594906
NM_000053.3(ATP7B):c.3662_3664delGGG (p.Gly1221del) rs886042519
NM_000053.3(ATP7B):c.3664delG (p.Asp1222Thrfs) rs886042519
NM_000053.3(ATP7B):c.3671G>T (p.Arg1224Leu)
NM_000053.3(ATP7B):c.3680C>A (p.Ala1227Asp)
NM_000053.3(ATP7B):c.3688A>G (p.Ile1230Val) rs200911496
NM_000053.3(ATP7B):c.3694A>C (p.Thr1232Pro) rs568009639
NM_000053.3(ATP7B):c.3700-1G>A rs1555284021
NM_000053.3(ATP7B):c.3700G>T (p.Val1234Phe) rs193922108
NM_000053.3(ATP7B):c.3716T>G (p.Val1239Gly) rs374628199
NM_000053.3(ATP7B):c.3722C>T (p.Ala1241Val) rs1555283994
NM_000053.3(ATP7B):c.3733C>G (p.Pro1245Ala) rs587783316
NM_000053.3(ATP7B):c.3733C>T (p.Pro1245Ser) rs587783316
NM_000053.3(ATP7B):c.3741C>G (p.His1247Gln) rs767464491
NM_000053.3(ATP7B):c.3749C>G (p.Ala1250Gly)
NM_000053.3(ATP7B):c.3767A>G (p.Gln1256Arg) rs1555283946
NM_000053.3(ATP7B):c.3784G>T (p.Val1262Phe) rs769484789
NM_000053.3(ATP7B):c.3796G>A (p.Gly1266Arg) rs121907992
NM_000053.3(ATP7B):c.3797G>A (p.Gly1266Glu)
NM_000053.3(ATP7B):c.3800A>C (p.Asp1267Ala) rs1555283916
NM_000053.3(ATP7B):c.3800delA (p.Asp1267Valfs) rs1057516740
NM_000053.3(ATP7B):c.3809A>G rs121907990
NM_000053.3(ATP7B):c.3809delA (p.Asn1270Metfs) rs1555283900
NM_000053.3(ATP7B):c.3818C>A (p.Pro1273Gln) rs758355520
NM_000053.3(ATP7B):c.3818C>T (p.Pro1273Leu) rs758355520
NM_000053.3(ATP7B):c.3821C>T (p.Ala1274Val) rs1555283882
NM_000053.3(ATP7B):c.3836A>G (p.Asp1279Gly) rs778914828
NM_000053.3(ATP7B):c.3842G>A (p.Gly1281Asp) rs755202606
NM_000053.3(ATP7B):c.3852_3875del24 (p.Gly1285_Ile1292del) rs1555283826
NM_000053.3(ATP7B):c.3858C>G (p.Thr1286=) rs558520674
NM_000053.3(ATP7B):c.3863C>G (p.Thr1288Arg) rs373748155
NM_000053.3(ATP7B):c.3863C>T (p.Thr1288Met) rs373748155
NM_000053.3(ATP7B):c.3877G>A (p.Glu1293Lys) rs776300396
NM_000053.3(ATP7B):c.3885C>T (p.Ala1295=) rs200597654
NM_000053.3(ATP7B):c.3886G>A (p.Asp1296Asn) rs199821556
NM_000053.3(ATP7B):c.3889G>A (p.Val1297Ile) rs148399850
NM_000053.3(ATP7B):c.388_389dupGC (p.Ala131Glnfs) rs1057517384
NM_000053.3(ATP7B):c.3891C>T (p.Val1297=) rs114771537
NM_000053.3(ATP7B):c.3895C>T (p.Leu1299Phe) rs749472361
NM_000053.3(ATP7B):c.3903+6C>T rs2282057
NM_000053.3(ATP7B):c.3904-2A>G rs1057517233
NM_000053.3(ATP7B):c.3912_3913delGCinsTT (p.Leu1304Phe) rs1555283732
NM_000053.3(ATP7B):c.3914T>C (p.Leu1305Pro)
NM_000053.3(ATP7B):c.3942_3943delCA (p.Lys1315Glufs) rs1057516227
NM_000053.3(ATP7B):c.3948delG (p.Thr1317Leufs) rs1057516228
NM_000053.3(ATP7B):c.3955C>T (p.Arg1319Ter) rs193922109
NM_000053.3(ATP7B):c.3971A>C (p.Asn1324Thr) rs760285767
NM_000053.3(ATP7B):c.3992A>C (p.Tyr1331Ser) rs1131691741
NM_000053.3(ATP7B):c.3999G>A (p.Leu1333=) rs186435141
NM_000053.3(ATP7B):c.3G>A (p.Met1Ile) rs750530407
NM_000053.3(ATP7B):c.4006delA (p.Ile1336Tyrfs) rs1555283564
NM_000053.3(ATP7B):c.4021+3A>G rs565970531
NM_000053.3(ATP7B):c.4021+50G>C rs9535795
NM_000053.3(ATP7B):c.4021G>A (p.Gly1341Ser) rs587783317
NM_000053.3(ATP7B):c.4022-19C>T rs369736734
NM_000053.3(ATP7B):c.4022-2A>C rs1555282816
NM_000053.3(ATP7B):c.4039G>A (p.Gly1347Ser) rs587783318
NM_000053.3(ATP7B):c.4051C>T (p.Gln1351Ter) rs786204578
NM_000053.3(ATP7B):c.4058G>A (p.Trp1353Ter) rs193922110
NM_000053.3(ATP7B):c.4063G>A (p.Gly1355Ser) rs1555282751
NM_000053.3(ATP7B):c.4064G>A (p.Gly1355Asp) rs1305262063
NM_000053.3(ATP7B):c.4064G>T (p.Gly1355Val) rs1305262063
NM_000053.3(ATP7B):c.4066T>C (p.Ser1356Pro) rs1555282748
NM_000053.3(ATP7B):c.406A>T (p.Arg136Trp) rs557577836
NM_000053.3(ATP7B):c.4088C>T (p.Ser1363Phe) rs776848753
NM_000053.3(ATP7B):c.4090G>C (p.Val1364Leu)
NM_000053.3(ATP7B):c.4092_4093delGT (p.Ser1365Cysfs) rs771603301
NM_000053.3(ATP7B):c.4102C>G (p.Leu1368Val)
NM_000053.3(ATP7B):c.4106C>T (p.Ser1369Leu) rs1555282678
NM_000053.3(ATP7B):c.4114C>T (p.Gln1372Ter) rs755584106
NM_000053.3(ATP7B):c.4118T>C (p.Leu1373Pro) rs780811477
NM_000053.3(ATP7B):c.4124+8C>T rs1459365269
NM_000053.3(ATP7B):c.4124G>C (p.Cys1375Ser) rs1365425480
NM_000053.3(ATP7B):c.4125-1G>A
NM_000053.3(ATP7B):c.4125-2A>G rs1555282347
NM_000053.3(ATP7B):c.4127A>C (p.Tyr1376Ser) rs1555282338
NM_000053.3(ATP7B):c.4135C>T (p.Pro1379Ser) rs181250704
NM_000053.3(ATP7B):c.4150dup (p.Tyr1384Leufs) rs1555282316
NM_000053.3(ATP7B):c.4163C>T (p.Ala1388Val) rs371458882
NM_000053.3(ATP7B):c.4185G>C (p.Leu1395=) rs368801566
NM_000053.3(ATP7B):c.4195delC (p.Gln1399Argfs) rs886041336
NM_000053.3(ATP7B):c.41C>A (p.Ala14Asp) rs587783319
NM_000053.3(ATP7B):c.4213G>A (p.Gly1405Ser) rs189601972
NM_000053.3(ATP7B):c.4221T>A (p.Asp1407Glu) rs587783320
NM_000053.3(ATP7B):c.4242delC (p.Arg1415Glyfs) rs1057517191
NM_000053.3(ATP7B):c.4251A>G (p.Thr1417=)
NM_000053.3(ATP7B):c.4283dup (p.Ser1429Valfs) rs1555282191
NM_000053.3(ATP7B):c.4301C>T (p.Thr1434Met) rs60986317
NM_000053.3(ATP7B):c.4302G>A (p.Thr1434=) rs116091486
NM_000053.3(ATP7B):c.4311G>A (p.Lys1437=) rs73202048
NM_000053.3(ATP7B):c.4325delG (p.Ser1442Thrfs) rs774744497
NM_000053.3(ATP7B):c.432_434delGGT (p.Val145del) rs1555296674
NM_000053.3(ATP7B):c.4336dup (p.Asp1446Glyfs) rs1555282097
NM_000053.3(ATP7B):c.4339dup (p.Asp1447Glyfs)
NM_000053.3(ATP7B):c.433G>T (p.Val145Phe) rs183365083
NM_000053.3(ATP7B):c.4361T>C (p.Leu1454Pro) rs377492122
NM_000053.3(ATP7B):c.4387C>T (p.Gln1463Ter) rs1392030070
NM_000053.3(ATP7B):c.4395C>A (p.Ile1465=) rs199859839
NM_000053.3(ATP7B):c.445G>A (p.Val149Met) rs200606656
NM_000053.3(ATP7B):c.482T>C (p.Ile161Thr)
NM_000053.3(ATP7B):c.51+13C>T rs770273498
NM_000053.3(ATP7B):c.51+15C>G rs781757171
NM_000053.3(ATP7B):c.51+4A>T rs369488210
NM_000053.3(ATP7B):c.52-1G>T rs1057517351
NM_000053.3(ATP7B):c.524_525delAA (p.Lys175Serfs) rs558037268
NM_000053.3(ATP7B):c.525dupA (p.Val176Serfs) rs558037268
NM_000053.3(ATP7B):c.562C>T (p.Gln188Ter) rs1412593296
NM_000053.3(ATP7B):c.588C>A (p.Asp196Glu) rs756718353
NM_000053.3(ATP7B):c.618T>A (p.Phe206Leu) rs764353593
NM_000053.3(ATP7B):c.628A>G (p.Ile210Val) rs61733680
NM_000053.3(ATP7B):c.650T>G (p.Leu217Ter) rs1555296472
NM_000053.3(ATP7B):c.670A>T (p.Ile224Phe) rs200563529
NM_000053.3(ATP7B):c.676C>T (p.Arg226Trp) rs749626601
NM_000053.3(ATP7B):c.738dup (p.Glu247Terfs) rs1555296414
NM_000053.3(ATP7B):c.740A>G (p.Glu247Gly) rs376398239
NM_000053.3(ATP7B):c.764_775del12 (p.His255_Thr258del) rs1417723997
NM_000053.3(ATP7B):c.778dupC (p.Gln260Profs) rs786204570
NM_000053.3(ATP7B):c.811T>C (p.Cys271Arg)
NM_000053.3(ATP7B):c.813C>A (p.Cys271Ter) rs572147914
NM_000053.3(ATP7B):c.841C>T (p.Gln281Ter) rs1555296356
NM_000053.3(ATP7B):c.845delT (p.Leu282Profs) rs193922111
NM_000053.3(ATP7B):c.854T>G (p.Val285Gly)
NM_000053.3(ATP7B):c.865C>T (p.Gln289Ter) rs121907999
NM_000053.3(ATP7B):c.870G>C (p.Val290=) rs587783321
NM_000053.3(ATP7B):c.915T>A (p.Cys305Ter) rs398123137
NM_000053.3(ATP7B):c.970A>T (p.Lys324Ter)
NM_000053.3(ATP7B):c.98T>C (p.Met33Thr) rs184868522
NM_000053.3(ATP7B):c.994G>T (p.Glu332Ter) rs761084829
NM_000053.3(ATP7B):c.999G>T (p.Gly333=) rs371930715
NM_000053.3(ATP7B):c.9G>A (p.Glu3=) rs587783322
NM_000053.3(ATP7B):c.[1924G>C];[3809A>G]
NM_000053.3(ATP7B):c.[2950C>G];[3809A>G]
NM_000053.3(ATP7B):c.[3443T>C;3526G>A]
NM_000053.3:c.802_808delTGTAAGT
NM_001005918.2(ATP7B):c.*23G>T
NM_001005918.2(ATP7B):c.-116G>A
NM_001005918.2(ATP7B):c.1595A>G (p.Tyr532Cys)
NM_001005918.2(ATP7B):c.1829C>T (p.Pro610Leu) rs368381292
NM_001005918.2(ATP7B):c.1869+2894G>A rs9535809
NM_001005918.2(ATP7B):c.2222T>G (p.Val741Gly)
NM_001005918.2(ATP7B):c.226A>G (p.Ile76Val)
NM_001005918.2(ATP7B):c.2936-31G>T rs74085875
NM_001005918.2(ATP7B):c.3165C>T (p.Val1055=) rs375007352
NM_001005918.2(ATP7B):c.352G>A (p.Asp118Asn) rs769655497
NM_001005918.2(ATP7B):c.3669delG (p.Ser1224Profs) rs1555282185
NM_001005918.2(ATP7B):c.496C>T (p.Arg166Trp)
NM_001005918.2:c.3369_3372delTTAT
NM_001243182.1(ATP7B):c.383delG (p.Gly128Glufs) rs797045083

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.