ClinVar Miner

List of variants in gene ATP7B reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 161
Download table as spreadsheet
HGVS dbSNP
NC_000013.10:g.(?_52511392)_(52513349_?)del
NC_000013.10:g.(?_52518225)_(52520634_?)del
NM_000053.3(ATP7B):c.-676A>G rs1021025464
NM_000053.3(ATP7B):c.1708-25_1719delGGATTCTTGCCATCCTGTGTTGCAGATCACAGGGATG rs1566560096
NM_000053.3(ATP7B):c.3809A>G rs121907990
NM_000053.4(ATP7B):c.1145_1151del (p.Ser382fs) rs1176709391
NM_000053.4(ATP7B):c.1155A>C (p.Glu385Asp)
NM_000053.4(ATP7B):c.1158_1159del (p.Val387fs)
NM_000053.4(ATP7B):c.1172C>T (p.Ser391Leu) rs750724856
NM_000053.4(ATP7B):c.1185C>T (p.Ala395=) rs764551529
NM_000053.4(ATP7B):c.1191G>T (p.Gly397=)
NM_000053.4(ATP7B):c.1198A>G (p.Thr400Ala)
NM_000053.4(ATP7B):c.122A>G (p.Asn41Ser) rs201738967
NM_000053.4(ATP7B):c.1362A>G (p.Thr454=) rs150018860
NM_000053.4(ATP7B):c.1415C>T (p.Pro472Leu) rs771789585
NM_000053.4(ATP7B):c.1426G>A (p.Ala476Thr) rs139289704
NM_000053.4(ATP7B):c.1461G>A (p.Pro487=) rs372068316
NM_000053.4(ATP7B):c.1607T>C (p.Val536Ala) rs138427376
NM_000053.4(ATP7B):c.1620C>T (p.Leu540=) rs145798966
NM_000053.4(ATP7B):c.1628C>G (p.Ala543Gly)
NM_000053.4(ATP7B):c.1707+2dup
NM_000053.4(ATP7B):c.1707+9T>C rs114449708
NM_000053.4(ATP7B):c.1728G>A (p.Ala576=) rs116703544
NM_000053.4(ATP7B):c.1745_1746del (p.Ile582fs) rs753962912
NM_000053.4(ATP7B):c.1829C>T (p.Pro610Leu) rs368381292
NM_000053.4(ATP7B):c.1840G>T (p.Gly614Cys) rs376565432
NM_000053.4(ATP7B):c.1847G>A (p.Arg616Gln) rs752850609
NM_000053.4(ATP7B):c.1877G>C (p.Gly626Ala) rs587783299
NM_000053.4(ATP7B):c.1911C>T (p.Asn637=) rs770640457
NM_000053.4(ATP7B):c.1922T>C (p.Leu641Ser) rs186924074
NM_000053.4(ATP7B):c.1924G>C (p.Asp642His) rs72552285
NM_000053.4(ATP7B):c.1924G>T (p.Asp642Tyr) rs72552285
NM_000053.4(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.4(ATP7B):c.1947-4C>T rs74904335
NM_000053.4(ATP7B):c.1995G>A (p.Met665Ile) rs72552259
NM_000053.4(ATP7B):c.19_20del (p.Gln7fs) rs749363958
NM_000053.4(ATP7B):c.2072G>T (p.Gly691Val) rs1555291801
NM_000053.4(ATP7B):c.2078C>G (p.Ser693Cys) rs1212479289
NM_000053.4(ATP7B):c.2122-3C>T
NM_000053.4(ATP7B):c.2123T>C (p.Leu708Pro) rs121908000
NM_000053.4(ATP7B):c.2128G>A (p.Gly710Ser) rs137853285
NM_000053.4(ATP7B):c.2129G>C (p.Gly710Ala) rs1555291285
NM_000053.4(ATP7B):c.213_214del (p.Val73fs)
NM_000053.4(ATP7B):c.2145del (p.Phe714_Tyr715insTer)
NM_000053.4(ATP7B):c.2174G>A (p.Arg725Lys) rs115227204
NM_000053.4(ATP7B):c.2175G>A (p.Arg725=) rs61733684
NM_000053.4(ATP7B):c.2294A>G (p.Asp765Gly) rs1555291147
NM_000053.4(ATP7B):c.2297C>G (p.Thr766Arg) rs121907997
NM_000053.4(ATP7B):c.2300C>T (p.Pro767Leu)
NM_000053.4(ATP7B):c.2304dup (p.Met769fs) rs137853287
NM_000053.4(ATP7B):c.2305A>G (p.Met769Val) rs193922103
NM_000053.4(ATP7B):c.2310C>G (p.Leu770=) rs398123136
NM_000053.4(ATP7B):c.2314G>A (p.Val772Met)
NM_000053.4(ATP7B):c.2332C>G (p.Arg778Gly) rs137853284
NM_000053.4(ATP7B):c.2332C>T (p.Arg778Trp) rs137853284
NM_000053.4(ATP7B):c.2333G>T (p.Arg778Leu) rs28942074
NM_000053.4(ATP7B):c.2336G>A (p.Trp779Ter) rs137853283
NM_000053.4(ATP7B):c.2338C>G (p.Leu780Val)
NM_000053.4(ATP7B):c.2355+4A>G rs776572343
NM_000053.4(ATP7B):c.2383C>T (p.Leu795Phe) rs751710854
NM_000053.4(ATP7B):c.2478_2479delinsT (p.Gln826fs) rs1555288808
NM_000053.4(ATP7B):c.2486A>G (p.Asp829Gly) rs1566503575
NM_000053.4(ATP7B):c.2510dup (p.Phe839fs)
NM_000053.4(ATP7B):c.2532del (p.Val845fs) rs755709270
NM_000053.4(ATP7B):c.2544C>T (p.Gly848=) rs200996053
NM_000053.4(ATP7B):c.2583C>T (p.Ala861=) rs565717791
NM_000053.4(ATP7B):c.2605G>A (p.Gly869Arg) rs191312027
NM_000053.4(ATP7B):c.2621C>T (p.Ala874Val) rs121907994
NM_000053.4(ATP7B):c.2622G>A (p.Ala874=)
NM_000053.4(ATP7B):c.2659G>A (p.Ala887Thr)
NM_000053.4(ATP7B):c.2662A>C (p.Thr888Pro)
NM_000053.4(ATP7B):c.2731-2A>G rs367956522
NM_000053.4(ATP7B):c.2755C>G (p.Arg919Gly) rs121907993
NM_000053.4(ATP7B):c.2755C>T (p.Arg919Trp) rs121907993
NM_000053.4(ATP7B):c.2785A>G (p.Ile929Val) rs534960245
NM_000053.4(ATP7B):c.2787C>G (p.Ile929Met)
NM_000053.4(ATP7B):c.2804C>T (p.Thr935Met) rs750019452
NM_000053.4(ATP7B):c.2810del (p.Val937fs) rs1057516643
NM_000053.4(ATP7B):c.2827G>A (p.Gly943Ser) rs28942076
NM_000053.4(ATP7B):c.2921C>T (p.Thr974Met) rs201061621
NM_000053.4(ATP7B):c.2930C>T (p.Thr977Met) rs72552255
NM_000053.4(ATP7B):c.2953T>C (p.Cys985Arg) rs193922104
NM_000053.4(ATP7B):c.2955C>T (p.Cys985=) rs116587608
NM_000053.4(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000053.4(ATP7B):c.2975C>T (p.Pro992Leu) rs201038679
NM_000053.4(ATP7B):c.2998G>A (p.Gly1000Arg) rs751078884
NM_000053.4(ATP7B):c.3007G>A (p.Ala1003Thr) rs201497300
NM_000053.4(ATP7B):c.3015C>T (p.Asn1005=) rs74085888
NM_000053.4(ATP7B):c.3042C>T (p.Pro1014=) rs1438628867
NM_000053.4(ATP7B):c.3053C>T (p.Ala1018Val) rs371840514
NM_000053.4(ATP7B):c.3079G>C (p.Asp1027His)
NM_000053.4(ATP7B):c.3097A>G (p.Thr1033Ala) rs1555286620
NM_000053.4(ATP7B):c.3101A>G (p.His1034Arg) rs74085882
NM_000053.4(ATP7B):c.3105C>T (p.Gly1035=) rs200324179
NM_000053.4(ATP7B):c.3121C>T (p.Arg1041Trp) rs746485916
NM_000053.4(ATP7B):c.3139G>T (p.Asp1047Tyr)
NM_000053.4(ATP7B):c.314C>A (p.Ser105Ter) rs753236073
NM_000053.4(ATP7B):c.3155C>T (p.Pro1052Leu) rs778543794
NM_000053.4(ATP7B):c.3185C>T (p.Thr1062Ile)
NM_000053.4(ATP7B):c.3191A>C (p.Glu1064Ala) rs374094065
NM_000053.4(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.4(ATP7B):c.3211T>C (p.Leu1071=) rs748003525
NM_000053.4(ATP7B):c.3243+2T>C
NM_000053.4(ATP7B):c.3284A>C (p.Gln1095Pro) rs1555285891
NM_000053.4(ATP7B):c.3324C>T (p.Asn1108=) rs372456815
NM_000053.4(ATP7B):c.3366A>G (p.Ala1122=) rs59120265
NM_000053.4(ATP7B):c.3369G>A (p.Pro1123=) rs61733679
NM_000053.4(ATP7B):c.3402del (p.Ala1135fs) rs137853281
NM_000053.4(ATP7B):c.3403G>A (p.Ala1135Thr) rs187200982
NM_000053.4(ATP7B):c.3405A>G (p.Ala1135=) rs373081328
NM_000053.4(ATP7B):c.3426G>C (p.Gln1142His) rs778749563
NM_000053.4(ATP7B):c.3443T>C (p.Ile1148Thr) rs60431989
NM_000053.4(ATP7B):c.3449del (p.Asn1150fs) rs1555285380
NM_000053.4(ATP7B):c.3467G>A (p.Arg1156His) rs773917820
NM_000053.4(ATP7B):c.3517G>A (p.Glu1173Lys) rs756029120
NM_000053.4(ATP7B):c.3556G>A (p.Gly1186Ser) rs786204547
NM_000053.4(ATP7B):c.3557-6C>T rs140708492
NM_000053.4(ATP7B):c.3588C>T (p.Asp1196=) rs11840224
NM_000053.4(ATP7B):c.3620A>G (p.His1207Arg) rs7334118
NM_000053.4(ATP7B):c.3659C>T (p.Thr1220Met) rs193922107
NM_000053.4(ATP7B):c.3671G>T (p.Arg1224Leu) rs532177115
NM_000053.4(ATP7B):c.3688A>G (p.Ile1230Val) rs200911496
NM_000053.4(ATP7B):c.3694A>C (p.Thr1232Pro) rs568009639
NM_000053.4(ATP7B):c.3716T>G (p.Val1239Gly) rs374628199
NM_000053.4(ATP7B):c.3797G>A (p.Gly1266Glu) rs1566444586
NM_000053.4(ATP7B):c.3818C>T (p.Pro1273Leu) rs758355520
NM_000053.4(ATP7B):c.3884C>T (p.Ala1295Val)
NM_000053.4(ATP7B):c.3889G>A (p.Val1297Ile) rs148399850
NM_000053.4(ATP7B):c.3891C>T (p.Val1297=) rs114771537
NM_000053.4(ATP7B):c.3895C>T (p.Leu1299Phe) rs749472361
NM_000053.4(ATP7B):c.3912_3913delinsTT (p.Leu1304Phe) rs1555283732
NM_000053.4(ATP7B):c.3914T>C (p.Leu1305Pro)
NM_000053.4(ATP7B):c.3955C>T (p.Arg1319Ter) rs193922109
NM_000053.4(ATP7B):c.4021+3A>G rs565970531
NM_000053.4(ATP7B):c.4022G>A (p.Gly1341Asp)
NM_000053.4(ATP7B):c.4058G>A (p.Trp1353Ter) rs193922110
NM_000053.4(ATP7B):c.406A>T (p.Arg136Trp) rs557577836
NM_000053.4(ATP7B):c.4077G>T (p.Met1359Ile)
NM_000053.4(ATP7B):c.4102C>G (p.Leu1368Val)
NM_000053.4(ATP7B):c.4124+8C>T rs1459365269
NM_000053.4(ATP7B):c.4163C>T (p.Ala1388Val) rs371458882
NM_000053.4(ATP7B):c.4213G>A (p.Gly1405Ser) rs189601972
NM_000053.4(ATP7B):c.4215C>T (p.Gly1405=)
NM_000053.4(ATP7B):c.4301C>T (p.Thr1434Met) rs60986317
NM_000053.4(ATP7B):c.4302G>A (p.Thr1434=) rs116091486
NM_000053.4(ATP7B):c.4311G>A (p.Lys1437=) rs73202048
NM_000053.4(ATP7B):c.4318C>T (p.Arg1440Trp)
NM_000053.4(ATP7B):c.4379A>G (p.Asp1460Gly)
NM_000053.4(ATP7B):c.4395C>A (p.Ile1465=) rs199859839
NM_000053.4(ATP7B):c.482T>C (p.Ile161Thr)
NM_000053.4(ATP7B):c.51+4A>T rs369488210
NM_000053.4(ATP7B):c.524_525del (p.Lys175fs) rs558037268
NM_000053.4(ATP7B):c.525dup (p.Val176fs) rs558037268
NM_000053.4(ATP7B):c.550G>A (p.Val184Ile)
NM_000053.4(ATP7B):c.628A>G (p.Ile210Val) rs61733680
NM_000053.4(ATP7B):c.670A>T (p.Ile224Phe) rs200563529
NM_000053.4(ATP7B):c.778dup (p.Gln260fs) rs786204570
NM_000053.4(ATP7B):c.845del (p.Leu282fs) rs193922111
NM_000053.4(ATP7B):c.854T>G (p.Val285Gly) rs1411865806
NM_000053.4(ATP7B):c.98T>C (p.Met33Thr) rs184868522
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.