ClinVar Miner

List of variants in gene ATP7B reported as pathogenic by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 59
Download table as spreadsheet
HGVS dbSNP
NC_000013.10:g.(?_52518225)_(52520634_?)del
NM_000053.3(ATP7B):c.1708-25_1719delGGATTCTTGCCATCCTGTGTTGCAGATCACAGGGATG rs1566560096
NM_000053.3(ATP7B):c.3809A>G rs121907990
NM_000053.4(ATP7B):c.1145_1151del (p.Ser382fs) rs1176709391
NM_000053.4(ATP7B):c.1158_1159del (p.Val387fs)
NM_000053.4(ATP7B):c.1745_1746del (p.Ile582fs) rs753962912
NM_000053.4(ATP7B):c.1847G>A (p.Arg616Gln) rs752850609
NM_000053.4(ATP7B):c.1924G>T (p.Asp642Tyr) rs72552285
NM_000053.4(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.4(ATP7B):c.19_20del (p.Gln7fs) rs749363958
NM_000053.4(ATP7B):c.2072G>T (p.Gly691Val) rs1555291801
NM_000053.4(ATP7B):c.2123T>C (p.Leu708Pro) rs121908000
NM_000053.4(ATP7B):c.2128G>A (p.Gly710Ser) rs137853285
NM_000053.4(ATP7B):c.213_214del (p.Val73fs)
NM_000053.4(ATP7B):c.2145del (p.Phe714_Tyr715insTer)
NM_000053.4(ATP7B):c.2297C>G (p.Thr766Arg) rs121907997
NM_000053.4(ATP7B):c.2304dup (p.Met769fs) rs137853287
NM_000053.4(ATP7B):c.2305A>G (p.Met769Val) rs193922103
NM_000053.4(ATP7B):c.2332C>G (p.Arg778Gly) rs137853284
NM_000053.4(ATP7B):c.2332C>T (p.Arg778Trp) rs137853284
NM_000053.4(ATP7B):c.2333G>T (p.Arg778Leu) rs28942074
NM_000053.4(ATP7B):c.2336G>A (p.Trp779Ter) rs137853283
NM_000053.4(ATP7B):c.2383C>T (p.Leu795Phe) rs751710854
NM_000053.4(ATP7B):c.2478_2479delinsT (p.Gln826fs) rs1555288808
NM_000053.4(ATP7B):c.2510dup (p.Phe839fs)
NM_000053.4(ATP7B):c.2532del (p.Val845fs) rs755709270
NM_000053.4(ATP7B):c.2621C>T (p.Ala874Val) rs121907994
NM_000053.4(ATP7B):c.2662A>C (p.Thr888Pro)
NM_000053.4(ATP7B):c.2731-2A>G rs367956522
NM_000053.4(ATP7B):c.2755C>G (p.Arg919Gly) rs121907993
NM_000053.4(ATP7B):c.2804C>T (p.Thr935Met) rs750019452
NM_000053.4(ATP7B):c.2810del (p.Val937fs) rs1057516643
NM_000053.4(ATP7B):c.2827G>A (p.Gly943Ser) rs28942076
NM_000053.4(ATP7B):c.2930C>T (p.Thr977Met) rs72552255
NM_000053.4(ATP7B):c.2975C>T (p.Pro992Leu) rs201038679
NM_000053.4(ATP7B):c.3007G>A (p.Ala1003Thr) rs201497300
NM_000053.4(ATP7B):c.3121C>T (p.Arg1041Trp) rs746485916
NM_000053.4(ATP7B):c.314C>A (p.Ser105Ter) rs753236073
NM_000053.4(ATP7B):c.3191A>C (p.Glu1064Ala) rs374094065
NM_000053.4(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.4(ATP7B):c.3402del (p.Ala1135fs) rs137853281
NM_000053.4(ATP7B):c.3443T>C (p.Ile1148Thr) rs60431989
NM_000053.4(ATP7B):c.3449del (p.Asn1150fs) rs1555285380
NM_000053.4(ATP7B):c.3517G>A (p.Glu1173Lys) rs756029120
NM_000053.4(ATP7B):c.3556G>A (p.Gly1186Ser) rs786204547
NM_000053.4(ATP7B):c.3659C>T (p.Thr1220Met) rs193922107
NM_000053.4(ATP7B):c.3694A>C (p.Thr1232Pro) rs568009639
NM_000053.4(ATP7B):c.3818C>T (p.Pro1273Leu) rs758355520
NM_000053.4(ATP7B):c.3884C>T (p.Ala1295Val)
NM_000053.4(ATP7B):c.3895C>T (p.Leu1299Phe) rs749472361
NM_000053.4(ATP7B):c.3955C>T (p.Arg1319Ter) rs193922109
NM_000053.4(ATP7B):c.4022G>A (p.Gly1341Asp)
NM_000053.4(ATP7B):c.4058G>A (p.Trp1353Ter) rs193922110
NM_000053.4(ATP7B):c.51+4A>T rs369488210
NM_000053.4(ATP7B):c.524_525del (p.Lys175fs) rs558037268
NM_000053.4(ATP7B):c.525dup (p.Val176fs) rs558037268
NM_000053.4(ATP7B):c.778dup (p.Gln260fs) rs786204570
NM_000053.4(ATP7B):c.845del (p.Leu282fs) rs193922111
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.