ClinVar Miner

List of variants in gene BRCA1 reported as pathogenic for Breast-ovarian cancer, familial 1

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2671
Download table as spreadsheet
HGVS dbSNP
BRCA1, 59-BP INS
BRCA1, 6-KB DUP, EX13
L824X
LRG_292:g.116321_140085del
LRG_292:g.133626_139705dup
LRG_292:g.61068_98138del
LRG_292t1:c.(671_4096)ins(300)
NC_000017.11:g.(43076615_43082403)_(43099881_43104121)del
NG_005905.2:g.(102259_111450)_(113786_118149)del
NG_005905.2:g.(102259_111450)_(172307_?)del
NG_005905.2:g.(113863_118103)_(118210_120694)del
NG_005905.2:g.(113863_118103)_(172307_?)del
NG_005905.2:g.(122139_123344)_(126550_126951)dup
NG_005905.2:g.(147057_150288)_(172307_?)del
NG_005905.2:g.(150290_154032)_(172307_?)del
NG_005905.2:g.(154652_160848)_(172307_?)del
NG_005905.2:g.(160933_166866)_(172307_?)del
NG_005905.2:g.(166922_168789)_(168864_170280)del
NG_005905.2:g.(168864_170280)_(172307_?)del
NG_005905.2:g.(170342_172181)_(172307_?)del
NG_005905.2:g.110245_115469del5225
NG_005905.2:g.110447_115471del5025
NG_005905.2:g.110966_142550del
NG_005905.2:g.116869_123429del6561
NG_005905.2:g.117282_121246del3965
NG_005905.2:g.118449_154829del
NG_005905.2:g.124095_124103delATTACTAATins2
NG_005905.2:g.125407_125411delCCATCins3
NG_005905.2:g.125502_125503ins7
NG_005905.2:g.126374_136783del10410
NG_005905.2:g.137094_142043del
NG_005905.2:g.139641_147792dup8152
NG_005905.2:g.139830_166277del
NG_005905.2:g.141479_141480ins5
NG_005905.2:g.142345_165745del23401
NG_005905.2:g.147946_153049del5104
NG_005905.2:g.148011_151127del3117
NG_005905.2:g.151367_156192del4826
NG_005905.2:g.152586_159830del7245ins27
NG_005905.2:g.152940_163021dup
NG_005905.2:g.154259_156851del2593insTTTTTTTTTTTT
NG_005905.2:g.157279_161602del4324
NG_005905.2:g.158009_169399del11391
NG_005905.2:g.160911_164110del3200
NG_005905.2:g.163032_170685dup
NG_005905.2:g.169527_180579del11053
NM_007294.3(BRCA1):c.*102_*105delCTGT rs431825382
NM_007294.3(BRCA1):c.-19-2A>G rs886040902
NM_007294.3(BRCA1):c.-19-48_80+248delinsU77841.1:g.2145_2536
NM_007294.3(BRCA1):c.-19-?_80+?del
NM_007294.3(BRCA1):c.-19-?_80+?dup
NM_007294.3(BRCA1):c.1002delC (p.Ser335Alafs) rs876658404
NM_007294.3(BRCA1):c.1008dupA (p.Glu337Argfs) rs67284603
NM_007294.3(BRCA1):c.1011dupA (p.Val340Glyfs) rs80357569
NM_007294.3(BRCA1):c.1012A>T (p.Lys338Ter) rs397508826
NM_007294.3(BRCA1):c.1016_1017insC (p.Lys339Asnfs) rs1555592653
NM_007294.3(BRCA1):c.1016delA (p.Lys339Argfs) rs80357569
NM_007294.3(BRCA1):c.1017_1018insA (p.Val340Serfs) rs886039921
NM_007294.3(BRCA1):c.1017_1018insC (p.Val340Argfs) rs886039921
NM_007294.3(BRCA1):c.1018_1019insA (p.Val340Aspfs) rs1555592640
NM_007294.3(BRCA1):c.1018delG (p.Val340Terfs) rs80357774
NM_007294.3(BRCA1):c.1018dupG (p.Val340Glyfs) rs80357774
NM_007294.3(BRCA1):c.101_105del (p.Pro34Leufs) rs886039920
NM_007294.3(BRCA1):c.101delC (p.Pro34Leufs) rs80357750
NM_007294.3(BRCA1):c.102delT (p.Val35Serfs) rs886039922
NM_007294.3(BRCA1):c.1039_1040delCT (p.Leu347Valfs) rs397508827
NM_007294.3(BRCA1):c.1039delC (p.Leu347Cysfs) rs749508254
NM_007294.3(BRCA1):c.1040delT (p.Leu347Argfs) rs397508828
NM_007294.3(BRCA1):c.1044T>A (p.Cys348Ter) rs886037985
NM_007294.3(BRCA1):c.1044_1045delTG (p.Cys348Terfs) rs1555592601
NM_007294.3(BRCA1):c.1044_1045insTCAC (p.Glu349Serfs) rs886039923
NM_007294.3(BRCA1):c.1044_1047del (p.Cys348Terfs) rs886039924
NM_007294.3(BRCA1):c.1045G>T (p.Glu349Ter) rs80357338
NM_007294.3(BRCA1):c.1045_1046insTCAC (p.Glu349Valfs) rs1555592590
NM_007294.3(BRCA1):c.1049_1050del (p.Arg350Lysfs) rs886039925
NM_007294.3(BRCA1):c.1054G>T (p.Glu352Ter) rs80357472
NM_007294.3(BRCA1):c.1054delG (p.Glu352Asnfs) rs886039926
NM_007294.3(BRCA1):c.1058G>A (p.Trp353Ter) rs80356908
NM_007294.3(BRCA1):c.1059G>A (p.Trp353Ter) rs80356935
NM_007294.3(BRCA1):c.1063A>T (p.Lys355Ter) rs397508829
NM_007294.3(BRCA1):c.1066C>T (p.Gln356Ter) rs80357215
NM_007294.3(BRCA1):c.1067delA (p.Gln356Argfs) rs80357796
NM_007294.3(BRCA1):c.1068_1077delGAAACTGCCA (p.Gln356Hisfs) rs397508830
NM_007294.3(BRCA1):c.1072delC (p.Leu358Cysfs) rs80357836
NM_007294.3(BRCA1):c.1080C>A (p.Cys360Ter) rs886037986
NM_007294.3(BRCA1):c.1081_1082insA (p.Ser361Tyrfs) rs1555592544
NM_007294.3(BRCA1):c.1082C>G (p.Ser361Ter) rs397508833
NM_007294.3(BRCA1):c.1082_1092delCAGAGAATCCT (p.Ser361Terfs) rs80359880
NM_007294.3(BRCA1):c.1085dup (p.Asn363Glufs) rs1555592537
NM_007294.3(BRCA1):c.1086_1087delGA (p.Asn363Serfs) rs80357897
NM_007294.3(BRCA1):c.1086_1141del56 (p.Asn363Serfs) rs80359875
NM_007294.3(BRCA1):c.1088delA (p.Asn363Ilefs) rs80357954
NM_007294.3(BRCA1):c.1091delC (p.Pro364Leufs) rs397508834
NM_007294.3(BRCA1):c.1093A>T (p.Arg365Ter) rs398122627
NM_007294.3(BRCA1):c.1099dupA (p.Thr367Asnfs) rs397508835
NM_007294.3(BRCA1):c.1100dupC (p.Glu368Terfs) rs397508836
NM_007294.3(BRCA1):c.1101_1102insC (p.Glu368Argfs) rs80357665
NM_007294.3(BRCA1):c.1102G>T (p.Glu368Ter) rs80357139
NM_007294.3(BRCA1):c.1102_1103insC (p.Glu368Alafs) rs1555592500
NM_007294.3(BRCA1):c.1104del (p.Asp369Metfs) rs886039927
NM_007294.3(BRCA1):c.1105dupG (p.Asp369Glyfs) rs1555592498
NM_007294.3(BRCA1):c.1107_1108insCT (p.Val370Leufs) rs1555592487
NM_007294.3(BRCA1):c.110C>A (p.Thr37Lys) rs80356880
NM_007294.3(BRCA1):c.1112delC (p.Pro371Leufs) rs397508837
NM_007294.3(BRCA1):c.1115G>A (p.Trp372Ter) rs397508838
NM_007294.3(BRCA1):c.1116G>A (p.Trp372Ter) rs80357468
NM_007294.3(BRCA1):c.1121_1123delCACinsT (p.Thr374Ilefs) rs273897652
NM_007294.3(BRCA1):c.1121delC (p.Thr374Asnfs) rs80357612
NM_007294.3(BRCA1):c.1122_1123delAC (p.Leu375Lysfs) rs397508839
NM_007294.3(BRCA1):c.1123delC (p.Leu375Terfs) rs886037987
NM_007294.3(BRCA1):c.1125_1132del (p.Asn376Hisfs) rs886039928
NM_007294.3(BRCA1):c.1127delA (p.Asn376Ilefs) rs80357821
NM_007294.3(BRCA1):c.1129dupA (p.Ser377Lysfs) rs80357776
NM_007294.3(BRCA1):c.112_113delAA (p.Lys38Valfs) rs80357949
NM_007294.3(BRCA1):c.1132_1135delAGCA (p.Ser378Phefs) rs1135401841
NM_007294.3(BRCA1):c.1138C>T (p.Gln380Ter) rs397508840
NM_007294.3(BRCA1):c.1140del (p.Val382Leufs) rs886039929
NM_007294.3(BRCA1):c.1140dupG (p.Lys381Glufs) rs876659327
NM_007294.3(BRCA1):c.1141A>T (p.Lys381Ter) rs80357385
NM_007294.3(BRCA1):c.1142_1143delAA (p.Lys381Serfs) rs879255313
NM_007294.3(BRCA1):c.1148_1149delAT (p.Asn383Argfs) rs431825384
NM_007294.3(BRCA1):c.1148delA (p.Asn383Metfs) rs878854930
NM_007294.3(BRCA1):c.1150G>T (p.Glu384Ter) rs878853288
NM_007294.3(BRCA1):c.1152dupG (p.Trp385Valfs) rs397508841
NM_007294.3(BRCA1):c.1155G>A (p.Trp385Ter) rs876660558
NM_007294.3(BRCA1):c.1158_1159delTT (p.Ser387Glnfs) rs397508842
NM_007294.3(BRCA1):c.1159dupT (p.Ser387Phefs) rs397508842
NM_007294.3(BRCA1):c.115T>C (p.Cys39Arg) rs80357164
NM_007294.3(BRCA1):c.115T>G (p.Cys39Gly) rs80357164
NM_007294.3(BRCA1):c.1165delA (p.Ser389Valfs) rs80357985
NM_007294.3(BRCA1):c.1166delG (p.Ser389Metfs) rs273897653
NM_007294.3(BRCA1):c.116G>A (p.Cys39Tyr) rs80357498
NM_007294.3(BRCA1):c.116G>T (p.Cys39Phe) rs80357498
NM_007294.3(BRCA1):c.1171G>T (p.Glu391Ter) rs562553169
NM_007294.3(BRCA1):c.1174del (p.Leu392Cysfs) rs886039930
NM_007294.3(BRCA1):c.1175_1178delTGTT (p.Leu392Glnfs) rs397508844
NM_007294.3(BRCA1):c.1175_1214del40 (p.Leu392Glnfs) rs80359874
NM_007294.3(BRCA1):c.1175_1215del41 (p.Leu392Glnfs) rs397507180
NM_007294.3(BRCA1):c.1175_1216del42 (p.Leu392_Asn406delinsHis) rs397507181
NM_007294.3(BRCA1):c.1175_1217del43 (p.Leu393Profs) rs397507182
NM_007294.3(BRCA1):c.1175_1218del44 (p.Leu392Argfs) rs397507183
NM_007294.3(BRCA1):c.1179_1180insT (p.Gly394Trpfs) rs886039931
NM_007294.3(BRCA1):c.117T>G (p.Cys39Trp) rs886040898
NM_007294.3(BRCA1):c.117_118delTG (p.Cys39Terfs) rs80357972
NM_007294.3(BRCA1):c.1180_1181insT (p.Gly394Valfs) rs1555592299
NM_007294.3(BRCA1):c.1188delT (p.Asp396Glufs) rs397508845
NM_007294.3(BRCA1):c.1190delA (p.Asp397Alafs) rs748714307
NM_007294.3(BRCA1):c.1193C>A (p.Ser398Ter) rs80357068
NM_007294.3(BRCA1):c.1193C>G (p.Ser398Ter) rs80357068
NM_007294.3(BRCA1):c.1204G>T (p.Glu402Ter) rs273897655
NM_007294.3(BRCA1):c.1204delG (p.Glu402Serfs) rs80357859
NM_007294.3(BRCA1):c.1205dup (p.Ser403Valfs) rs1555592219
NM_007294.3(BRCA1):c.1209_1210del (p.Glu404Ilefs) rs886039932
NM_007294.3(BRCA1):c.1209dup (p.Glu404Terfs) rs886039933
NM_007294.3(BRCA1):c.1210_1211insCT (p.Glu404Alafs) rs886039934
NM_007294.3(BRCA1):c.1211_1212insCT (p.Glu404Aspfs) rs1555592174
NM_007294.3(BRCA1):c.1214C>A (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1214C>G (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1217delA (p.Asn406Metfs) rs397508846
NM_007294.3(BRCA1):c.1218_1219insA (p.Ala407Serfs) rs1555592129
NM_007294.3(BRCA1):c.121delC (p.His41Thrfs) rs1555599226
NM_007294.3(BRCA1):c.1222A>T (p.Lys408Ter) rs80357253
NM_007294.3(BRCA1):c.1224delA (p.Val409Terfs) rs879255320
NM_007294.3(BRCA1):c.1227_1230dup (p.Asp411Serfs) rs886039935
NM_007294.3(BRCA1):c.122A>G (p.His41Arg) rs80357276
NM_007294.3(BRCA1):c.122delA (p.His41Profs) rs397508847
NM_007294.3(BRCA1):c.1232_1233delAT (p.Asp411Glyfs) rs397508848
NM_007294.3(BRCA1):c.1232_1235delATGTinsCA (p.Asp411Alafs) rs876659253
NM_007294.3(BRCA1):c.1240_1246delGACGTTC (p.Asp414Terfs) rs80357964
NM_007294.3(BRCA1):c.1240delG (p.Asp414Thrfs) rs786204260
NM_007294.3(BRCA1):c.1240dupG (p.Asp414Glyfs) rs786204260
NM_007294.3(BRCA1):c.1241dupA (p.Asp414Glufs) rs80357514
NM_007294.3(BRCA1):c.124delA (p.Ile42Tyrfs) rs80357943
NM_007294.3(BRCA1):c.1251_1252delTGinsA (p.Asn417Lysfs) rs886040899
NM_007294.3(BRCA1):c.1252G>T (p.Glu418Ter) rs80357083
NM_007294.3(BRCA1):c.1252delG (p.Glu418Argfs) rs876660623
NM_007294.3(BRCA1):c.1252dupG (p.Glu418Glyfs) rs886039936
NM_007294.3(BRCA1):c.1253del (p.Glu418Glyfs) rs886039937
NM_007294.3(BRCA1):c.1255delG (p.Val419Terfs) rs80357535
NM_007294.3(BRCA1):c.1256dupT (p.Asp420Argfs) rs786203103
NM_007294.3(BRCA1):c.1257delA (p.Asp420Metfs) rs886037988
NM_007294.3(BRCA1):c.1261G>T (p.Glu421Ter) rs80357046
NM_007294.3(BRCA1):c.1265_1266dupAT (p.Ser423Ilefs) rs397508850
NM_007294.3(BRCA1):c.1265dupA (p.Tyr422Terfs) rs80357809
NM_007294.3(BRCA1):c.1266T>G (p.Tyr422Ter) rs80357417
NM_007294.3(BRCA1):c.1273dup (p.Ser425Phefs) rs886039938
NM_007294.3(BRCA1):c.1276delT (p.Ser426Glnfs) rs80357766
NM_007294.3(BRCA1):c.1277C>A (p.Ser426Ter) rs886039939
NM_007294.3(BRCA1):c.1277C>G (p.Ser426Ter) rs886039939
NM_007294.3(BRCA1):c.1277delC (p.Ser426Terfs) rs1064795775
NM_007294.3(BRCA1):c.1279G>T (p.Glu427Ter) rs397508851
NM_007294.3(BRCA1):c.1287delA (p.Ile429Metfs) rs1060505045
NM_007294.3(BRCA1):c.1287dupA (p.Asp430Argfs) rs80357576
NM_007294.3(BRCA1):c.1288_1289insC (p.Asp430Alafs) rs1555591993
NM_007294.3(BRCA1):c.1288dup (p.Asp430Glyfs) rs886039940
NM_007294.3(BRCA1):c.1292T>G (p.Leu431Ter) rs80357346
NM_007294.3(BRCA1):c.1292delT (p.Leu431Tyrfs) rs80357528
NM_007294.3(BRCA1):c.1292dupT (p.Leu431Phefs) rs80357528
NM_007294.3(BRCA1):c.1293_1295delACTinsGA (p.Leu432Argfs) rs397508852
NM_007294.3(BRCA1):c.1297delG (p.Ala433Profs) rs80357794
NM_007294.3(BRCA1):c.1298_1299ins4
NM_007294.3(BRCA1):c.1299dupC (p.Ser434Glnfs) rs886037786
NM_007294.3(BRCA1):c.1303_1309delGATCCTCinsAAAGT (p.Asp435Lysfs) rs886039941
NM_007294.3(BRCA1):c.130T>A (p.Cys44Ser) rs80357327
NM_007294.3(BRCA1):c.130delT (p.Cys44Alafs) rs80357951
NM_007294.3(BRCA1):c.130dupT (p.Cys44Leufs) rs80357951
NM_007294.3(BRCA1):c.1310_1313delATGA (p.His437Argfs) rs1555591959
NM_007294.3(BRCA1):c.1319T>G (p.Leu440Ter) rs273897656
NM_007294.3(BRCA1):c.1319delT (p.Leu440Terfs) rs80357683
NM_007294.3(BRCA1):c.1319dupT (p.Leu440Phefs) rs80357683
NM_007294.3(BRCA1):c.131G>A (p.Cys44Tyr) rs80357446
NM_007294.3(BRCA1):c.131G>T (p.Cys44Phe) rs80357446
NM_007294.3(BRCA1):c.1323_1324delAT (p.Ile441Metfs) rs80357570
NM_007294.3(BRCA1):c.1323dup (p.Cys442Metfs) rs1555591939
NM_007294.3(BRCA1):c.1326T>A (p.Cys442Ter) rs397508854
NM_007294.3(BRCA1):c.1326_1327insGT (p.Lys443Valfs) rs80357543
NM_007294.3(BRCA1):c.1327A>T (p.Lys443Ter) rs398122630
NM_007294.3(BRCA1):c.1327_1345del (p.Lys443Profs) rs886039942
NM_007294.3(BRCA1):c.132C>T (p.Cys44=) rs876658362
NM_007294.3(BRCA1):c.1333G>T (p.Glu445Ter) rs80356915
NM_007294.3(BRCA1):c.1333del (p.Glu445Lysfs) rs886039943
NM_007294.3(BRCA1):c.1335_1336delAA (p.Arg446Serfs) rs80357978
NM_007294.3(BRCA1):c.1336del (p.Arg446Glufs) rs80357978
NM_007294.3(BRCA1):c.1336dupA (p.Arg446Lysfs) rs80357978
NM_007294.3(BRCA1):c.1339dupG (p.Val447Glyfs) rs397508855
NM_007294.3(BRCA1):c.133_134+3delAAGTAinsT rs397508856
NM_007294.3(BRCA1):c.133_134delAA (p.Lys45Ilefs) rs397508857
NM_007294.3(BRCA1):c.134+1G>A rs80358043
NM_007294.3(BRCA1):c.134+1G>C rs80358043
NM_007294.3(BRCA1):c.134+1G>T rs80358043
NM_007294.3(BRCA1):c.134+2T>C rs80358131
NM_007294.3(BRCA1):c.134+2T>G rs80358131
NM_007294.3(BRCA1):c.134+2delT rs273897657
NM_007294.3(BRCA1):c.134+3A>C rs80358064
NM_007294.3(BRCA1):c.134+3_134+4insT rs886041002
NM_007294.3(BRCA1):c.134+3_134+6delAAGT rs397508858
NM_007294.3(BRCA1):c.1340_1341delTT (p.Val447Alafs) rs730881458
NM_007294.3(BRCA1):c.1340_1341insG (p.His448Serfs) rs80357597
NM_007294.3(BRCA1):c.1341_1342insG (p.His448Alafs) rs1555591909
NM_007294.3(BRCA1):c.1347del (p.Lys450Asnfs) rs886039945
NM_007294.3(BRCA1):c.135-1G>C rs80358158
NM_007294.3(BRCA1):c.135-1G>T rs80358158
NM_007294.3(BRCA1):c.135-2A>G rs80358065
NM_007294.3(BRCA1):c.135-?_212+?del
NM_007294.3(BRCA1):c.135-?_301+?del
NM_007294.3(BRCA1):c.135-?_4185+?del
NM_007294.3(BRCA1):c.135-?_441+?del
NM_007294.3(BRCA1):c.135-?_441+?dup
NM_007294.3(BRCA1):c.135-?_4484+?del
NM_007294.3(BRCA1):c.135-?_547+?del
NM_007294.3(BRCA1):c.135-?_547+?dup
NM_007294.3(BRCA1):c.135-?_670+?del
NM_007294.3(BRCA1):c.1352C>A (p.Ser451Ter) rs80356891
NM_007294.3(BRCA1):c.1352C>G (p.Ser451Ter) rs80356891
NM_007294.3(BRCA1):c.1354delG (p.Val452Terfs) rs886039946
NM_007294.3(BRCA1):c.1356delA (p.Glu453Argfs) rs80357939
NM_007294.3(BRCA1):c.1360_1361delAG (p.Ser454Terfs) rs80357969
NM_007294.3(BRCA1):c.1361delG (p.Ser454Ilefs) rs398122632
NM_007294.3(BRCA1):c.1364_1365insGA (p.Asn455Lysfs) rs1555591846
NM_007294.3(BRCA1):c.1371delA (p.Asp458Thrfs) rs397508861
NM_007294.3(BRCA1):c.1374delC (p.Asp458Glufs) rs397508862
NM_007294.3(BRCA1):c.1375A>T (p.Lys459Ter) rs886039947
NM_007294.3(BRCA1):c.1377_1378delAA (p.Lys459Asnfs) rs398122633
NM_007294.3(BRCA1):c.1378dup (p.Ile460Asnfs) rs398122633
NM_007294.3(BRCA1):c.1379del (p.Ile460Asnfs) rs886039949
NM_007294.3(BRCA1):c.1380delA (p.Phe461Leufs) rs397508863
NM_007294.3(BRCA1):c.1380dupA (p.Phe461Ilefs) rs80357714
NM_007294.3(BRCA1):c.1383delT (p.Phe461Leufs) rs80357879
NM_007294.3(BRCA1):c.1384_1393dupGGGAAAACCT (p.Tyr465Trpfs) rs397508864
NM_007294.3(BRCA1):c.1386delG (p.Thr464Profs) rs80357722
NM_007294.3(BRCA1):c.1386dupG (p.Lys463Glufs) rs80357722
NM_007294.3(BRCA1):c.1387_1390delAAAAins5
NM_007294.3(BRCA1):c.1387_1390delAAAAinsGAAAG (p.Lys463Glufs) rs80357770
NM_007294.3(BRCA1):c.1387delAinsGG (p.Lys463Glyfs)
NM_007294.3(BRCA1):c.1389_1390delAAinsG (p.Thr464Profs) rs273897659
NM_007294.3(BRCA1):c.1390delA (p.Thr464Profs) rs80357770
NM_007294.3(BRCA1):c.1390dup (p.Thr464Asnfs) rs80357770
NM_007294.3(BRCA1):c.1391_1392insG (p.Tyr465Leufs) rs1135401845
NM_007294.3(BRCA1):c.1392_1393insG (p.Tyr465Valfs) rs1555591814
NM_007294.3(BRCA1):c.1392delC (p.Tyr465Ilefs) rs80357592
NM_007294.3(BRCA1):c.1392dupC (p.Tyr465Leufs) rs80357592
NM_007294.3(BRCA1):c.1393_1394ins10 (p.?)
NM_007294.3(BRCA1):c.1395dup (p.Arg466Serfs) rs1555591796
NM_007294.3(BRCA1):c.1399A>T (p.Lys467Ter) rs80357279
NM_007294.3(BRCA1):c.139T>A (p.Cys47Ser) rs80357370
NM_007294.3(BRCA1):c.139dupT (p.Cys47Leufs) rs80357734
NM_007294.3(BRCA1):c.1403delA (p.Lys468Argfs) rs397508870
NM_007294.3(BRCA1):c.1405delG (p.Ala469Glnfs) rs397508871
NM_007294.3(BRCA1):c.1407_1408delAA (p.Ser470Profs) rs879255476
NM_007294.3(BRCA1):c.140G>A (p.Cys47Tyr) rs80357150
NM_007294.3(BRCA1):c.140G>T (p.Cys47Phe) rs80357150
NM_007294.3(BRCA1):c.140_141insT (p.Met48Hisfs) rs886039950
NM_007294.3(BRCA1):c.1412dup (p.Asn473Glnfs) rs886039951
NM_007294.3(BRCA1):c.1419_1422delCTTA (p.Asn473Lysfs) rs886039952
NM_007294.3(BRCA1):c.141C>A (p.Cys47Ter) rs398122635
NM_007294.3(BRCA1):c.141_142insT (p.Met48Tyrfs) rs1555597309
NM_007294.3(BRCA1):c.1421T>G (p.Leu474Ter) rs80357490
NM_007294.3(BRCA1):c.1428_1437del (p.His476Glnfs) rs886039953
NM_007294.3(BRCA1):c.1434_1435delTG (p.Glu479Lysfs) rs1060505050
NM_007294.3(BRCA1):c.1434delT (p.Glu479Lysfs) rs431825386
NM_007294.3(BRCA1):c.1439dupA (p.Asn480Lysfs) rs80357505
NM_007294.3(BRCA1):c.143delT (p.Met48Serfs) rs80357637
NM_007294.3(BRCA1):c.1440_1441insA (p.Leu481Thrfs) rs80357778
NM_007294.3(BRCA1):c.1441_1442insA (p.Leu481Hisfs) rs1555591749
NM_007294.3(BRCA1):c.1444_1447delATTA (p.Ile482Terfs) rs80357801
NM_007294.3(BRCA1):c.1444delA (p.Ile482Leufs) rs80357648
NM_007294.3(BRCA1):c.144delG (p.Met48Ilefs) rs80357682
NM_007294.3(BRCA1):c.1450G>T (p.Gly484Ter) rs80357304
NM_007294.3(BRCA1):c.1462dupA (p.Thr488Asnfs) rs80357599
NM_007294.3(BRCA1):c.1465G>T (p.Glu489Ter) rs80357167
NM_007294.3(BRCA1):c.1471C>T (p.Gln491Ter) rs62625303
NM_007294.3(BRCA1):c.1477delA (p.Ile493Tyrfs) rs786203982
NM_007294.3(BRCA1):c.1480C>T (p.Gln494Ter) rs80357010
NM_007294.3(BRCA1):c.1483_1498del16 (p.Glu495Ilefs) rs397508872
NM_007294.3(BRCA1):c.1488delT (p.Leu498Serfs) rs587782251
NM_007294.3(BRCA1):c.1492delC (p.Leu498Serfs) rs80357527
NM_007294.3(BRCA1):c.1497_1509del (p.Asn500Valfs) rs886039954
NM_007294.3(BRCA1):c.1499_1508dupATAAATTAAA (p.Arg504Terfs) rs397508873
NM_007294.3(BRCA1):c.1499delA (p.Asn500Ilefs) rs397508874
NM_007294.3(BRCA1):c.1501_1504delAAAT (p.Lys501Terfs) rs80357632
NM_007294.3(BRCA1):c.1504_1507delTTAA (p.Leu502Serfs) rs886039955
NM_007294.3(BRCA1):c.1504_1508delTTAAA (p.Leu502Alafs) rs80357888
NM_007294.3(BRCA1):c.1505T>G (p.Leu502Ter) rs886039957
NM_007294.3(BRCA1):c.1505_1509delTAAAG (p.Leu502Serfs) rs876659139
NM_007294.3(BRCA1):c.1505del (p.Leu502Terfs) rs886039956
NM_007294.3(BRCA1):c.1506_1510delAAAGC (p.Lys503Terfs) rs397508876
NM_007294.3(BRCA1):c.1508delA (p.Lys503Serfs) rs80357506
NM_007294.3(BRCA1):c.150delA (p.Lys50Asnfs) rs273897662
NM_007294.3(BRCA1):c.1510delC (p.Arg504Valfs) rs80357908
NM_007294.3(BRCA1):c.1511dupG (p.Lys505Terfs) rs80357817
NM_007294.3(BRCA1):c.1512dupT (p.Lys505Terfs) rs398122636
NM_007294.3(BRCA1):c.1513A>T (p.Lys505Ter) rs397508877
NM_007294.3(BRCA1):c.1513_1514insT (p.Lys505Ilefs) rs397508878
NM_007294.3(BRCA1):c.1514_1515insT (p.Lys505Asnfs) rs1555591635
NM_007294.3(BRCA1):c.1517_1521delGGAGA (p.Arg506Thrfs) rs397508879
NM_007294.3(BRCA1):c.1518delG (p.Arg507Aspfs) rs80357947
NM_007294.3(BRCA1):c.1519A>T (p.Arg507Ter) rs397508880
NM_007294.3(BRCA1):c.1521_1531delACCTACATCAG (p.Thr509Serfs) rs1555591596
NM_007294.3(BRCA1):c.1523delC (p.Pro508Leufs) rs80357782
NM_007294.3(BRCA1):c.1529C>A (p.Ser510Ter) rs80357427
NM_007294.3(BRCA1):c.1529C>G (p.Ser510Ter) rs80357427
NM_007294.3(BRCA1):c.1530delA (p.Gly511Alafs) rs80357735
NM_007294.3(BRCA1):c.1542_1550delTGAGGATTTinsCG (p.Glu515Valfs) rs876659591
NM_007294.3(BRCA1):c.1543G>T (p.Glu515Ter) rs886037990
NM_007294.3(BRCA1):c.1551delT (p.Phe517Leufs) rs80357630
NM_007294.3(BRCA1):c.1556delA (p.Lys519Argfs) rs80357662
NM_007294.3(BRCA1):c.1561_1562delGCinsTA (p.Ala521Ter) rs273897663
NM_007294.3(BRCA1):c.1561_1564delGCAGinsTAAA (p.Ala521Ter) rs397508883
NM_007294.3(BRCA1):c.1566_1567insC (p.Ala524Glyfs) rs1555591551
NM_007294.3(BRCA1):c.1568delT (p.Leu523Trpfs) rs1555591543
NM_007294.3(BRCA1):c.1570delG (p.Ala524Glnfs) rs397508886
NM_007294.3(BRCA1):c.1575_1576insT (p.Gln526Serfs) rs879255478
NM_007294.3(BRCA1):c.1575del (p.Gln526Lysfs) rs879255478
NM_007294.3(BRCA1):c.1576C>T (p.Gln526Ter) rs80356984
NM_007294.3(BRCA1):c.1579_1580delAA (p.Lys527Aspfs) rs431825387
NM_007294.3(BRCA1):c.1583_1589delCTCCTGA (p.Thr528Lysfs) rs80357613
NM_007294.3(BRCA1):c.1595_1601delTAAATCA (p.Ile532Argfs) rs397508888
NM_007294.3(BRCA1):c.1600C>T (p.Gln534Ter) rs142074233
NM_007294.3(BRCA1):c.1600delC (p.Gln534Argfs) rs869320776
NM_007294.3(BRCA1):c.1601_1602delAG (p.Gln534Argfs) rs878854933
NM_007294.3(BRCA1):c.1601dupA (p.Thr536Asnfs) rs397508889
NM_007294.3(BRCA1):c.1604_1612delGAACTAACCins13 (p.?)
NM_007294.3(BRCA1):c.1608_1611delTAAC (p.Asn537Lysfs) rs80357698
NM_007294.3(BRCA1):c.160C>T (p.Gln54Ter) rs80356864
NM_007294.3(BRCA1):c.160delC (p.Gln54Argfs) rs397508890
NM_007294.3(BRCA1):c.1612C>T (p.Gln538Ter) rs80356893
NM_007294.3(BRCA1):c.1612_1616delCAAAC (p.Gln538Glyfs) rs587776480
NM_007294.3(BRCA1):c.1616_1625del (p.Thr539Metfs) rs886039959
NM_007294.3(BRCA1):c.1618G>T (p.Glu540Ter) rs730881471
NM_007294.3(BRCA1):c.1618delG (p.Glu540Serfs) rs1555591470
NM_007294.3(BRCA1):c.1621C>T (p.Gln541Ter) rs80356904
NM_007294.3(BRCA1):c.1622_1626delAGAAT (p.Gln541Argfs) rs879255314
NM_007294.3(BRCA1):c.1623dupG (p.Asn542Glufs) rs397508891
NM_007294.3(BRCA1):c.1628delG (p.Gly543Valfs) rs398122640
NM_007294.3(BRCA1):c.1630C>T (p.Gln544Ter) rs80356952
NM_007294.3(BRCA1):c.1636_1654del19 (p.Met546Valfs) rs80359881
NM_007294.3(BRCA1):c.1637_1685del49ins5
NM_007294.3(BRCA1):c.1637_1685del49insGAAAG (p.Met546Argfs) rs483353085
NM_007294.3(BRCA1):c.1638_1646delGAATATTACinsA (p.Met546Ilefs) rs1135401846
NM_007294.3(BRCA1):c.1642_1643del (p.Ile548Tyrfs) rs886039960
NM_007294.3(BRCA1):c.1649delA (p.Asn550Ilefs) rs80357619
NM_007294.3(BRCA1):c.1650dupT (p.Ser551Terfs) rs753524038
NM_007294.3(BRCA1):c.1651_1652insC (p.Ser551Thrfs) rs886039961
NM_007294.3(BRCA1):c.1652_1653insC (p.Gly552Trpfs) rs1555591420
NM_007294.3(BRCA1):c.165_166dupGA (p.Lys56Argfs) rs80357550
NM_007294.3(BRCA1):c.1660G>T (p.Glu554Ter) rs397508894
NM_007294.3(BRCA1):c.1669del (p.Thr557Glnfs) rs886039962
NM_007294.3(BRCA1):c.1670_1673delCAAA (p.Thr557Lysfs) rs1555591390
NM_007294.3(BRCA1):c.1673_1674delAA (p.Lys558Argfs) rs80357600
NM_007294.3(BRCA1):c.1674delA (p.Gly559Valfs) rs80357600
NM_007294.3(BRCA1):c.1674dupA (p.Gly559Argfs) rs80357600
NM_007294.3(BRCA1):c.1685_1686insGAAAG (p.Ile562Metfs) rs1555591372
NM_007294.3(BRCA1):c.1687C>T (p.Gln563Ter) rs80356898
NM_007294.3(BRCA1):c.1693G>T (p.Glu565Ter) rs886039963
NM_007294.3(BRCA1):c.1695dupG (p.Lys566Glufs) rs273897664
NM_007294.3(BRCA1):c.1700delA (p.Asn567Ilefs) rs80357784
NM_007294.3(BRCA1):c.1700dupA (p.Asn567Lysfs) rs80357784
NM_007294.3(BRCA1):c.1713_1717delAGAAT (p.Glu572Thrfs) rs80357640
NM_007294.3(BRCA1):c.1714G>T (p.Glu572Ter) rs730881473
NM_007294.3(BRCA1):c.1716delA (p.Glu572Aspfs) rs397508900
NM_007294.3(BRCA1):c.1716dupA (p.Ser573Ilefs) rs397508900
NM_007294.3(BRCA1):c.171delG (p.Pro58Leufs) rs80357660
NM_007294.3(BRCA1):c.171dupG (p.Pro58Alafs) rs80357660
NM_007294.3(BRCA1):c.1723G>T (p.Glu575Ter) rs397508902
NM_007294.3(BRCA1):c.1723dup (p.Glu575Glyfs) rs1555591335
NM_007294.3(BRCA1):c.1726_1727insG (p.Lys576Argfs) rs1555591326
NM_007294.3(BRCA1):c.1728dupA (p.Glu577Argfs) rs397507192
NM_007294.3(BRCA1):c.1729G>T (p.Glu577Ter) rs397508903
NM_007294.3(BRCA1):c.1729_1730delGA (p.Glu577Ilefs) rs80357834
NM_007294.3(BRCA1):c.1733_1734delCT (p.Ser578Cysfs) rs886037991
NM_007294.3(BRCA1):c.1741A>T (p.Lys581Ter) rs397508905
NM_007294.3(BRCA1):c.1744delA (p.Thr582Argfs) rs398122641
NM_007294.3(BRCA1):c.1747A>T (p.Lys583Ter) rs80356928
NM_007294.3(BRCA1):c.1749_1755del (p.Lys583Asnfs) rs886039965
NM_007294.3(BRCA1):c.1757delC (p.Pro586Leufs) rs80357723
NM_007294.3(BRCA1):c.1759_1762delATAA (p.Ile587Alafs) rs879255479
NM_007294.3(BRCA1):c.1759delA (p.Ile587Terfs) rs398122642
NM_007294.3(BRCA1):c.1762dup (p.Ser588Lysfs) rs886039966
NM_007294.3(BRCA1):c.1763_1764delGC (p.Ser588Lysfs) rs879254237
NM_007294.3(BRCA1):c.1768_1770delAGTinsC (p.Ser590Hisfs) rs876659196
NM_007294.3(BRCA1):c.176C>A (p.Ser59Ter) rs199522616
NM_007294.3(BRCA1):c.1772delT (p.Ile591Lysfs) rs80357901
NM_007294.3(BRCA1):c.1779_1785del (p.Met594Serfs) rs886039967
NM_007294.3(BRCA1):c.1780delA (p.Met594Trpfs) rs1135401848
NM_007294.3(BRCA1):c.1789G>T (p.Glu597Ter) rs55650082
NM_007294.3(BRCA1):c.178C>T (p.Gln60Ter) rs80357471
NM_007294.3(BRCA1):c.178_179delCA (p.Gln60Valfs) rs397508907
NM_007294.3(BRCA1):c.1793T>A (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1793T>G (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1795_1798del (p.Asn599Serfs) rs886039968
NM_007294.3(BRCA1):c.1799delT (p.Ile600Thrfs) rs878854934
NM_007294.3(BRCA1):c.179delA (p.Gln60Argfs) rs80357591
NM_007294.3(BRCA1):c.179dup (p.Cys61Valfs) rs886039969
NM_007294.3(BRCA1):c.1803del (p.His601Glnfs) rs886039970
NM_007294.3(BRCA1):c.1805delA (p.Asn602Ilefs) rs397508908
NM_007294.3(BRCA1):c.1808C>G (p.Ser603Ter) rs397508909
NM_007294.3(BRCA1):c.1812delA (p.Ala605Hisfs) rs80357927
NM_007294.3(BRCA1):c.1817delC (p.Pro606Leufs) rs397508910
NM_007294.3(BRCA1):c.1819A>T (p.Lys607Ter) rs80357220
NM_007294.3(BRCA1):c.181T>A (p.Cys61Ser) rs28897672
NM_007294.3(BRCA1):c.181T>C (p.Cys61Arg) rs28897672
NM_007294.3(BRCA1):c.181T>G (p.Cys61Gly) rs28897672
NM_007294.3(BRCA1):c.1820_1823del (p.Lys607Argfs) rs397508911
NM_007294.3(BRCA1):c.1823_1826delAGAA (p.Lys608Ilefs) rs80357585
NM_007294.3(BRCA1):c.1823delA (p.Lys608Argfs) rs397508911
NM_007294.3(BRCA1):c.1826delA (p.Asn609Ilefs) rs80357736
NM_007294.3(BRCA1):c.182G>A (p.Cys61Tyr) rs80357093
NM_007294.3(BRCA1):c.182_183delGT (p.Cys61Serfs) rs397508912
NM_007294.3(BRCA1):c.182_183insGCGC (p.Cys61Trpfs) rs886039971
NM_007294.3(BRCA1):c.1831delC (p.Leu611Terfs) rs397508913
NM_007294.3(BRCA1):c.1836dupG (p.Arg613Glufs) rs876660523
NM_007294.3(BRCA1):c.1837delA (p.Arg613Glyfs) rs80357652
NM_007294.3(BRCA1):c.1839_1840delGA (p.Lys614Valfs) rs752474843
NM_007294.3(BRCA1):c.183_184insGCGC (p.Pro62Alafs) rs1555597239
NM_007294.3(BRCA1):c.1840A>T (p.Lys614Ter) rs80357282
NM_007294.3(BRCA1):c.1842_1843dupGT (p.Ser615Cysfs) rs767595162
NM_007294.3(BRCA1):c.1844_1845insG (p.Ser616Phefs) rs886039973
NM_007294.3(BRCA1):c.1845_1846insG (p.Ser616Valfs) rs1555591112
NM_007294.3(BRCA1):c.1846dupT (p.Ser616Phefs) rs397508914
NM_007294.3(BRCA1):c.1847del (p.Ser616Leufs) rs886039974
NM_007294.3(BRCA1):c.1854delG (p.Arg618Serfs) rs397507193
NM_007294.3(BRCA1):c.1860delT (p.His621Metfs) rs730881459
NM_007294.3(BRCA1):c.1870G>T (p.Glu624Ter) rs80356950
NM_007294.3(BRCA1):c.1874_1877dupTAGT (p.Val627Serfs) rs80357516
NM_007294.3(BRCA1):c.1875delA (p.Val626Terfs) rs398122646
NM_007294.3(BRCA1):c.1877_1878ins4
NM_007294.3(BRCA1):c.1878_1879insTAGT (p.Val627Terfs) rs886039975
NM_007294.3(BRCA1):c.187_188delTT (p.Leu63Metfs) rs1555597235
NM_007294.3(BRCA1):c.1880_1881insAGTT (p.Ser628Valfs) rs1555591019
NM_007294.3(BRCA1):c.1881_1882insCC (p.Ser628Profs) rs878853289
NM_007294.3(BRCA1):c.1881_1884delCAGT (p.Ser628Glufs) rs80357567
NM_007294.3(BRCA1):c.1882_1883insCC (p.Ser628Thrfs) rs1555590997
NM_007294.3(BRCA1):c.1885A>T (p.Arg629Ter) rs1555590987
NM_007294.3(BRCA1):c.1885del (p.Arg629Glufs) rs886039976
NM_007294.3(BRCA1):c.1887_1900dup (p.Pro634Glnfs) rs886039977
NM_007294.3(BRCA1):c.188T>A (p.Leu63Ter) rs80357086
NM_007294.3(BRCA1):c.1892dupT (p.Ser632Lysfs) rs80357932
NM_007294.3(BRCA1):c.1893_1894insT (p.Ser632Terfs) rs80357768
NM_007294.3(BRCA1):c.1894_1895insT (p.Ser632Metfs) rs1555590964
NM_007294.3(BRCA1):c.1898delC (p.Pro633Hisfs) rs80357851
NM_007294.3(BRCA1):c.189dupA (p.Cys64Metfs) rs273897665
NM_007294.3(BRCA1):c.18_19insG (p.Arg7Alafs) rs398122648
NM_007294.3(BRCA1):c.1905_1909del (p.Cys636Terfs) rs886039979
NM_007294.3(BRCA1):c.1906delT (p.Cys636Valfs) rs397508916
NM_007294.3(BRCA1):c.1908_1911del (p.Cys636Trpfs) rs886039980
NM_007294.3(BRCA1):c.190T>C (p.Cys64Arg) rs80357064
NM_007294.3(BRCA1):c.190T>G (p.Cys64Gly) rs80357064
NM_007294.3(BRCA1):c.190_191insAATGTAAGGATGATATAAA (p.Cys64Terfs) rs1555597215
NM_007294.3(BRCA1):c.190_193delTGTA (p.Cys64Argfs) rs397508917
NM_007294.3(BRCA1):c.190_211del (p.Cys64Glyfs) rs886039978
NM_007294.3(BRCA1):c.1912G>T (p.Glu638Ter) rs80357005
NM_007294.3(BRCA1):c.1912delG (p.Glu638Asnfs) rs80357933
NM_007294.3(BRCA1):c.1916T>A (p.Leu639Ter) rs80357267
NM_007294.3(BRCA1):c.1918C>T (p.Gln640Ter) rs886039981
NM_007294.3(BRCA1):c.191G>A (p.Cys64Tyr) rs55851803
NM_007294.3(BRCA1):c.1921delA (p.Ile641Leufs) rs397507194
NM_007294.3(BRCA1):c.1921dupA (p.Ile641Asnfs) rs397507194
NM_007294.3(BRCA1):c.1923dupT (p.Asp642Terfs) rs878854935
NM_007294.3(BRCA1):c.192T>A (p.Cys64Ter) rs587781632
NM_007294.3(BRCA1):c.192T>G (p.Cys64Trp) rs587781632
NM_007294.3(BRCA1):c.1930del (p.Cys644Valfs) rs886039982
NM_007294.3(BRCA1):c.1936delA (p.Ser646Alafs) rs397508919
NM_007294.3(BRCA1):c.1938_1945del (p.Ser646Argfs) rs886039983
NM_007294.3(BRCA1):c.1938_1947delCAGTGAAGAG (p.Ser646Argfs) rs397508920
NM_007294.3(BRCA1):c.1942G>T (p.Glu648Ter) rs886039984
NM_007294.3(BRCA1):c.1945G>T (p.Glu649Ter) rs80356907
NM_007294.3(BRCA1):c.1949_1950delTA (p.Ile650Lysfs) rs397508921
NM_007294.3(BRCA1):c.1949_1950insCA (p.Lys652Argfs) rs1555590829
NM_007294.3(BRCA1):c.1949_1952del (p.Ile650Argfs) rs886039985
NM_007294.3(BRCA1):c.1949dupT (p.Lys652Glufs) rs879255480
NM_007294.3(BRCA1):c.1950_1951insCA (p.Lys651Glnfs) rs1555590811
NM_007294.3(BRCA1):c.1952delA (p.Lys651Argfs) rs80357885
NM_007294.3(BRCA1):c.1952dupA (p.Lys652Glufs) rs80357885
NM_007294.3(BRCA1):c.1953_1956delGAAA (p.Lys653Serfs) rs80357526
NM_007294.3(BRCA1):c.1953del (p.Lys654Serfs) rs886039986
NM_007294.3(BRCA1):c.1953dupG (p.Lys652Glufs) rs80357753
NM_007294.3(BRCA1):c.1958_1961delAAAA (p.Lys653Serfs) rs80357522
NM_007294.3(BRCA1):c.195delG (p.Asn66Metfs) rs80357869
NM_007294.3(BRCA1):c.1960A>T (p.Lys654Ter) rs80357355
NM_007294.3(BRCA1):c.1960_1961delAA (p.Lys654Valfs) rs80357522
NM_007294.3(BRCA1):c.1961_1962delAG (p.Lys654Ilefs) rs886037993
NM_007294.3(BRCA1):c.1961delA (p.Lys654Serfs) rs80357522
NM_007294.3(BRCA1):c.1961dupA (p.Tyr655Valfs) rs80357522
NM_007294.3(BRCA1):c.1962_1968delGTACAAC (p.Lys654Asnfs) rs1135401849
NM_007294.3(BRCA1):c.1963_1964insG (p.Tyr655Terfs) rs1555590789
NM_007294.3(BRCA1):c.1963dupT (p.Tyr655Leufs) rs397508924
NM_007294.3(BRCA1):c.1964_1965insG (p.Tyr655Terfs) rs1555590775
NM_007294.3(BRCA1):c.1964delA (p.Tyr655Serfs) rs786203594
NM_007294.3(BRCA1):c.1965C>A (p.Tyr655Ter) rs886039987
NM_007294.3(BRCA1):c.1969C>T (p.Gln657Ter) rs397508926
NM_007294.3(BRCA1):c.1972delA (p.Met658Cysfs) rs397507195
NM_007294.3(BRCA1):c.1977_1978delAG (p.Val660Glnfs) rs773413634
NM_007294.3(BRCA1):c.1978delG (p.Val660Serfs) rs886039988
NM_007294.3(BRCA1):c.1994delA (p.Asn665Thrfs) rs1555590714
NM_007294.3(BRCA1):c.1996delC (p.Leu666Tyrfs) rs80357922
NM_007294.3(BRCA1):c.1999C>T (p.Gln667Ter) rs80356889
NM_007294.3(BRCA1):c.19_47del29 (p.Arg7Cysfs) rs80359871
NM_007294.3(BRCA1):c.1A>G (p.Met1Val) rs80357287
NM_007294.3(BRCA1):c.2001dupA (p.Leu668Thrfs) rs80357521
NM_007294.3(BRCA1):c.2012_2013dupGT (p.Lys672Valfs) rs397508928
NM_007294.3(BRCA1):c.2012dup (p.Lys672Terfs) rs886039989
NM_007294.3(BRCA1):c.2014A>T (p.Lys672Ter) rs397508929
NM_007294.3(BRCA1):c.2017G>T (p.Glu673Ter) rs80357391
NM_007294.3(BRCA1):c.2017delG (p.Glu673Asnfs) rs80357638
NM_007294.3(BRCA1):c.2019delA (p.Glu673Aspfs) rs80357626
NM_007294.3(BRCA1):c.2021delC (p.Pro674Leufs) rs397508930
NM_007294.3(BRCA1):c.2028_2029delTG (p.Gly677Serfs) rs397508931
NM_007294.3(BRCA1):c.202dupA (p.Ile68Asnfs) rs886039990
NM_007294.3(BRCA1):c.2035A>T (p.Lys679Ter) rs80357082
NM_007294.3(BRCA1):c.2037delGinsCC (p.Lys679Asnfs) rs397508932
NM_007294.3(BRCA1):c.2038A>T (p.Lys680Ter) rs1135401850
NM_007294.3(BRCA1):c.2038_2039insCC (p.Lys680Thrfs) rs80357940
NM_007294.3(BRCA1):c.2039_2040insCC (p.Lys680Asnfs) rs1555590620
NM_007294.3(BRCA1):c.203_204delTA (p.Ile68Asnfs) rs398122651
NM_007294.3(BRCA1):c.2043dupT (p.Asn682Terfs) rs863224510
NM_007294.3(BRCA1):c.2048delA (p.Lys683Serfs) rs397508933
NM_007294.3(BRCA1):c.2056G>T (p.Glu686Ter) rs587782709
NM_007294.3(BRCA1):c.2059C>T (p.Gln687Ter) rs273898674
NM_007294.3(BRCA1):c.205dupA (p.Thr69Asnfs) rs273898673
NM_007294.3(BRCA1):c.2063_2066delCAAG (p.Thr688Ilefs) rs397508935
NM_007294.3(BRCA1):c.2066_2069delGTAA (p.Ser689Lysfs) rs886037994
NM_007294.3(BRCA1):c.2068A>T (p.Lys690Ter) rs587781448
NM_007294.3(BRCA1):c.2070_2071delAA (p.Arg691Thrfs) rs80357688
NM_007294.3(BRCA1):c.2071delA (p.Arg691Aspfs) rs80357688
NM_007294.3(BRCA1):c.2074_2075delCA (p.His692Terfs) rs886037995
NM_007294.3(BRCA1):c.2074delC (p.His692Metfs) rs80357554
NM_007294.3(BRCA1):c.2075_2076delAT (p.His692Argfs) rs397508936
NM_007294.3(BRCA1):c.2077_2078insTA (p.Asp693Valfs) rs80357595
NM_007294.3(BRCA1):c.2077delGinsATA (p.Asp693Ilefs) rs886039991
NM_007294.3(BRCA1):c.2078_2079insTA (p.Ser694Thrfs) rs886039992
NM_007294.3(BRCA1):c.2079_2080delCA (p.Asp693Glufs) rs80357773
NM_007294.3(BRCA1):c.2079_2080insTA (p.Ser694Terfs) rs1555590520
NM_007294.3(BRCA1):c.2080dup (p.Ser694Lysfs) rs886039993
NM_007294.3(BRCA1):c.2086_2089del (p.Thr696Serfs) rs886039994
NM_007294.3(BRCA1):c.2086delA (p.Thr696Leufs) rs397508937
NM_007294.3(BRCA1):c.2086dup (p.Thr696Asnfs) rs886039995
NM_007294.3(BRCA1):c.2090delT (p.Phe697Serfs) rs886039996
NM_007294.3(BRCA1):c.2090dupT (p.Glu699Argfs) rs886039996
NM_007294.3(BRCA1):c.2095G>T (p.Glu699Ter) rs876658306
NM_007294.3(BRCA1):c.2098_2099insA (p.Leu700Hisfs) rs483353086
NM_007294.3(BRCA1):c.2099_2100insA (p.Lys701Glufs) rs1555590461
NM_007294.3(BRCA1):c.20dup (p.Val8Argfs) rs1555601027
NM_007294.3(BRCA1):c.2101A>T (p.Lys701Ter) rs876660282
NM_007294.3(BRCA1):c.2101_2102delAA (p.Lys701Valfs) rs431825389
NM_007294.3(BRCA1):c.2105T>G (p.Leu702Ter) rs80357298
NM_007294.3(BRCA1):c.2105del (p.Leu702Terfs) rs80357880
NM_007294.3(BRCA1):c.2105dupT (p.Leu702Phefs) rs80357880
NM_007294.3(BRCA1):c.2110_2111delAA (p.Asn704Cysfs) rs80357814
NM_007294.3(BRCA1):c.2112_2131dup (p.Lys711Metfs) rs886039998
NM_007294.3(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.3(BRCA1):c.211delA (p.Arg71Glyfs) rs397508938
NM_007294.3(BRCA1):c.211dupA (p.Arg71Lysfs) rs397508938
NM_007294.3(BRCA1):c.212+1G>A rs80358042
NM_007294.3(BRCA1):c.212+1G>C rs80358042
NM_007294.3(BRCA1):c.212+1G>T rs80358042
NM_007294.3(BRCA1):c.212+2T>C rs80358026
NM_007294.3(BRCA1):c.212+3A>G rs80358083
NM_007294.3(BRCA1):c.2120delG (p.Gly707Valfs) rs1555590441
NM_007294.3(BRCA1):c.2125_2126ins3
NM_007294.3(BRCA1):c.2125_2126insA (p.Phe709Tyrfs) rs80357871
NM_007294.3(BRCA1):c.2125_2126insAGT (p.Phe709_Asn1043delinsTer) rs1555590428
NM_007294.3(BRCA1):c.2126_2127delTT (p.Phe709Tyrfs) rs397508939
NM_007294.3(BRCA1):c.2126_2127insA (p.Phe709Leufs) rs1135401851
NM_007294.3(BRCA1):c.2127_2128insGA (p.Thr710Glufs) rs886039999
NM_007294.3(BRCA1):c.2127del (p.Phe709Leufs) rs397508939
NM_007294.3(BRCA1):c.2128_2129insGA (p.Thr710Argfs) rs1555590415
NM_007294.3(BRCA1):c.2128dup (p.Thr710Asnfs) rs1555590415
NM_007294.3(BRCA1):c.212G>A (p.Arg71Lys) rs80356913
NM_007294.3(BRCA1):c.212G>C (p.Arg71Thr) rs80356913
NM_007294.3(BRCA1):c.212G>T (p.Arg71Met) rs80356913
NM_007294.3(BRCA1):c.213-11T>G rs80358061
NM_007294.3(BRCA1):c.213-12A>G rs80358163
NM_007294.3(BRCA1):c.213-15A>G rs886040903
NM_007294.3(BRCA1):c.213-1G>A rs80358146
NM_007294.3(BRCA1):c.213-1G>T rs80358146
NM_007294.3(BRCA1):c.213-2A>C rs397508940
NM_007294.3(BRCA1):c.213-2A>G rs397508940
NM_007294.3(BRCA1):c.213-3C>G rs80358119
NM_007294.3(BRCA1):c.213-?_441+?del
NM_007294.3(BRCA1):c.2130delTinsAA (p.Cys712Valfs) rs1060502332
NM_007294.3(BRCA1):c.2131_2132delAA (p.Lys711Valfs) rs398122653
NM_007294.3(BRCA1):c.2135_2136delGT (p.Cys712Phefs) rs886040001
NM_007294.3(BRCA1):c.2138C>A (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2138C>G (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2138_2139dup (p.Asn714Glnfs) rs886040002
NM_007294.3(BRCA1):c.2142_2144delTACinsAG (p.Asn714Lysfs) rs886040003
NM_007294.3(BRCA1):c.2142delT (p.Asn714Lysfs) rs273898679
NM_007294.3(BRCA1):c.2145delC (p.Ser716Valfs) rs886037996
NM_007294.3(BRCA1):c.2149G>T (p.Glu717Ter) rs886040004
NM_007294.3(BRCA1):c.2155A>T (p.Lys719Ter) rs80357147
NM_007294.3(BRCA1):c.2155_2168delAAAGAATTTGTCAA (p.Lys719Serfs) rs397508941
NM_007294.3(BRCA1):c.2155_2221dup67 (p.Ser741Terfs) rs1555590136
NM_007294.3(BRCA1):c.2157_2160del (p.Lys719Asnfs) rs886040005
NM_007294.3(BRCA1):c.2157dupA (p.Glu720Argfs) rs80357715
NM_007294.3(BRCA1):c.2158G>T (p.Glu720Ter) rs80356875
NM_007294.3(BRCA1):c.2161_2162insG (p.Phe721Cysfs) rs886040006
NM_007294.3(BRCA1):c.2162_2163insG (p.Phe721Leufs) rs1555590332
NM_007294.3(BRCA1):c.2166delC (p.Asn723Ilefs) rs397508943
NM_007294.3(BRCA1):c.2174delG (p.Ser725Thrfs) rs397508944
NM_007294.3(BRCA1):c.2176_2177delCT (p.Leu726Serfs) rs397508945
NM_007294.3(BRCA1):c.2176delC (p.Leu726Phefs) rs80357668
NM_007294.3(BRCA1):c.2185G>T (p.Glu729Ter) rs876659852
NM_007294.3(BRCA1):c.2185_2189del (p.Glu729Lysfs) rs886040007
NM_007294.3(BRCA1):c.2185delG (p.Glu729Lysfs) rs1064795840
NM_007294.3(BRCA1):c.2188G>T (p.Glu730Ter) rs80357058
NM_007294.3(BRCA1):c.2188_2195delGAAAAAGAinsAAAAAGG (p.Glu730Lysfs) rs886040008
NM_007294.3(BRCA1):c.2188_2201delGAAAAAGAAGAGAA (p.Glu730Thrfs) rs273898681
NM_007294.3(BRCA1):c.2188dupG (p.Glu730Glyfs) rs80357566
NM_007294.3(BRCA1):c.2192_2196delAAGAA (p.Lys731Argfs) rs397508946
NM_007294.3(BRCA1):c.2193_2196delAGAA (p.Glu732Argfs) rs397508947
NM_007294.3(BRCA1):c.2193delA (p.Glu732Lysfs) rs886040009
NM_007294.3(BRCA1):c.2194G>T (p.Glu732Ter) rs80357426
NM_007294.3(BRCA1):c.2194delGinsAA (p.Glu732Lysfs) rs886040010
NM_007294.3(BRCA1):c.2195_2196delAAinsG (p.Glu732Glyfs) rs397508948
NM_007294.3(BRCA1):c.2196delA (p.Glu733Argfs) rs397508948
NM_007294.3(BRCA1):c.2197G>T (p.Glu733Ter) rs397508949
NM_007294.3(BRCA1):c.2197_2201delGAGAA (p.Glu733Thrfs) rs80357507
NM_007294.3(BRCA1):c.2198dup (p.Lys734Glufs) rs886040012
NM_007294.3(BRCA1):c.2199delG (p.Lys734Asnfs) rs80357944
NM_007294.3(BRCA1):c.2202delA (p.Lys734Asnfs) rs80357982
NM_007294.3(BRCA1):c.2202dup (p.Leu735Thrfs) rs80357982
NM_007294.3(BRCA1):c.2203delC (p.Leu735Terfs) rs80357936
NM_007294.3(BRCA1):c.2205del (p.Glu736Lysfs) rs886040015
NM_007294.3(BRCA1):c.2206delG (p.Glu736Lysfs) rs80357860
NM_007294.3(BRCA1):c.2209delA (p.Thr737Glnfs) rs1060502333
NM_007294.3(BRCA1):c.220C>T (p.Gln74Ter) rs80357234
NM_007294.3(BRCA1):c.2210_2211delCA (p.Thr737Serfs) rs80357654
NM_007294.3(BRCA1):c.2210delC (p.Thr737Lysfs) rs80357793
NM_007294.3(BRCA1):c.2211_2212delAG (p.Val738Terfs) rs397508950
NM_007294.3(BRCA1):c.2211dup (p.Val738Serfs) rs886040016
NM_007294.3(BRCA1):c.2212_2215delGTTA (p.Val738Lysfs) rs397508951
NM_007294.3(BRCA1):c.2214_2215insTT (p.Lys739Leufs) rs80357574
NM_007294.3(BRCA1):c.2214_2218delTAAAGinsAAA (p.Lys739Asnfs) rs886040017
NM_007294.3(BRCA1):c.2214delT (p.Val740Cysfs) rs80357574
NM_007294.3(BRCA1):c.2214dupT (p.Lys739Terfs) rs80357574
NM_007294.3(BRCA1):c.2215A>T (p.Lys739Ter) rs56329598
NM_007294.3(BRCA1):c.2215_2216insCT (p.Lys739Thrfs) rs80357930
NM_007294.3(BRCA1):c.2216_2217delAA (p.Lys739Serfs) rs397508952
NM_007294.3(BRCA1):c.2216_2217insCT (p.Lys739Asnfs) rs1555590163
NM_007294.3(BRCA1):c.2217dupA (p.Val740Serfs) rs80357802
NM_007294.3(BRCA1):c.2218del (p.Val740Cysfs) rs886040018
NM_007294.3(BRCA1):c.2222_2223del (p.Ser741Terfs) rs886040019
NM_007294.3(BRCA1):c.2223dup (p.Asn742Terfs) rs886040020
NM_007294.3(BRCA1):c.2226_2227delTA (p.Asn742Lysfs) rs878854938
NM_007294.3(BRCA1):c.2236dupG (p.Asp746Glyfs) rs80357909
NM_007294.3(BRCA1):c.2241delC (p.Asp749Ilefs) rs80357650
NM_007294.3(BRCA1):c.2241dupC (p.Lys748Glnfs) rs80357650
NM_007294.3(BRCA1):c.2242_2251delAAAGATCTCA (p.Lys748Cysfs) rs886037997
NM_007294.3(BRCA1):c.2246_2247insGA (p.Asp749Glufs) rs398122654
NM_007294.3(BRCA1):c.2246_2280delATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACT (p.Asp749Glyfs) rs886037998
NM_007294.3(BRCA1):c.2247_2248insGA (p.Leu750Aspfs) rs1555590055
NM_007294.3(BRCA1):c.2248_2252delCTCAT (p.Leu750Valfs) rs397508954
NM_007294.3(BRCA1):c.224_227delAAAG (p.Glu75Valfs) rs80357697
NM_007294.3(BRCA1):c.2253_2254delGT (p.Met751Ilefs) rs80357602
NM_007294.3(BRCA1):c.2255T>A (p.Leu752Ter) rs1135401852
NM_007294.3(BRCA1):c.2255_2256dupTA (p.Ser753Terfs) rs80357557
NM_007294.3(BRCA1):c.2257dupA (p.Ser753Lysfs) rs1555590033
NM_007294.3(BRCA1):c.2263G>T (p.Glu755Ter) rs41286296
NM_007294.3(BRCA1):c.2263delG (p.Glu755Lysfs) rs80357960
NM_007294.3(BRCA1):c.2269delG (p.Val757Phefs) rs80357583
NM_007294.3(BRCA1):c.2273T>A (p.Leu758Ter) rs1060502334
NM_007294.3(BRCA1):c.2273del (p.Leu758Cysfs) rs80357681
NM_007294.3(BRCA1):c.2273dupT (p.Leu758Phefs) rs80357681
NM_007294.3(BRCA1):c.2275C>T (p.Gln759Ter) rs80356999
NM_007294.3(BRCA1):c.2283_2284delAA (p.Arg762Ilefs) rs80357657
NM_007294.3(BRCA1):c.2289delT (p.Val764Terfs) rs876658791
NM_007294.3(BRCA1):c.2292_2310dup19 (p.Leu771Argfs) rs397508955
NM_007294.3(BRCA1):c.2293G>T (p.Glu765Ter) rs80357449
NM_007294.3(BRCA1):c.2296_2297delAG (p.Ser766Terfs) rs80357780
NM_007294.3(BRCA1):c.2298dupT (p.Ser767Terfs) rs786204264
NM_007294.3(BRCA1):c.2299delA (p.Ser767Alafs) rs80357786
NM_007294.3(BRCA1):c.22_50del (p.Val8Tyrfs) rs886040013
NM_007294.3(BRCA1):c.2302delA (p.Ser768Valfs) rs1555589953
NM_007294.3(BRCA1):c.2307_2313del (p.Ile769Metfs) rs886040022
NM_007294.3(BRCA1):c.2308delT (p.Ser770Hisfs) rs397508956
NM_007294.3(BRCA1):c.2309C>A (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2309C>G (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2309C>T (p.Ser770Leu) rs80357063
NM_007294.3(BRCA1):c.230delCinsGTCAACTTGTT (p.Thr77Serfs) rs397508957
NM_007294.3(BRCA1):c.2311_2312insC (p.Leu771Serfs) rs886040023
NM_007294.3(BRCA1):c.2311_2317delTTGGTAC (p.Pro773Leufs) rs1060502354
NM_007294.3(BRCA1):c.2312_2313insC (p.Leu771Phefs) rs1555589935
NM_007294.3(BRCA1):c.2314_2315del (p.Val772Thrfs) rs886040024
NM_007294.3(BRCA1):c.2314delG (p.Val772Tyrfs) rs80357957
NM_007294.3(BRCA1):c.2322del (p.Thr775Leufs) rs886040025
NM_007294.3(BRCA1):c.2327dup (p.Asp776Glufs) rs1555589901
NM_007294.3(BRCA1):c.2329delT (p.Tyr777Metfs) rs80357725
NM_007294.3(BRCA1):c.232delA (p.Arg78Aspfs) rs80357884
NM_007294.3(BRCA1):c.2331T>A (p.Tyr777Ter) rs80357444
NM_007294.3(BRCA1):c.2331T>G (p.Tyr777Ter) rs80357444
NM_007294.3(BRCA1):c.2331_2332dupTG (p.Gly778Valfs) rs431825390
NM_007294.3(BRCA1):c.2337_2338delTC (p.Gln780Glyfs) rs80357515
NM_007294.3(BRCA1):c.2338C>T (p.Gln780Ter) rs80356945
NM_007294.3(BRCA1):c.2340_2343del (p.Glu781Valfs) rs886040026
NM_007294.3(BRCA1):c.2346dupT (p.Ile783Tyrfs) rs886040027
NM_007294.3(BRCA1):c.2350_2351delTC (p.Ser784Valfs) rs397508960
NM_007294.3(BRCA1):c.2351_2357delCGTTACT (p.Ser784Trpfs) rs80357820
NM_007294.3(BRCA1):c.2354T>A (p.Leu785Ter) rs397508961
NM_007294.3(BRCA1):c.2355dupA (p.Leu786Thrfs) rs80357990
NM_007294.3(BRCA1):c.2356delC (p.Leu786Trpfs) rs397508962
NM_007294.3(BRCA1):c.2357delT (p.Leu786Argfs) rs397508963
NM_007294.3(BRCA1):c.2359delG (p.Glu787Lysfs) rs80357739
NM_007294.3(BRCA1):c.2359dupG (p.Glu787Glyfs) rs80357739
NM_007294.3(BRCA1):c.2361del (p.Val788Leufs) rs886040028
NM_007294.3(BRCA1):c.2362delG (p.Val788Leufs) rs876659136
NM_007294.3(BRCA1):c.2368_2369del (p.Thr790Serfs) rs886040029
NM_007294.3(BRCA1):c.2376delG (p.Lys793Argfs) rs80357913
NM_007294.3(BRCA1):c.2378dupA (p.Ala794Glyfs) rs864622536
NM_007294.3(BRCA1):c.237del (p.Phe79Leufs) rs886040030
NM_007294.3(BRCA1):c.2380dupG (p.Ala794Glyfs) rs886037999
NM_007294.3(BRCA1):c.2386_2387delACinsT (p.Thr796Terfs) rs876660305
NM_007294.3(BRCA1):c.2386dupA (p.Thr796Asnfs) rs398122657
NM_007294.3(BRCA1):c.2387dup (p.Glu797Argfs) rs886040031
NM_007294.3(BRCA1):c.2389G>T (p.Glu797Ter) rs62625306
NM_007294.3(BRCA1):c.2389_2390delGA (p.Glu797Thrfs) rs80357695
NM_007294.3(BRCA1):c.2389delG (p.Glu797Asnfs) rs397508965
NM_007294.3(BRCA1):c.2390_2391delAA (p.Glu797Alafs) rs80357546
NM_007294.3(BRCA1):c.2393delC (p.Pro798Glnfs) rs80357850
NM_007294.3(BRCA1):c.2396del (p.Asn799Ilefs) rs886040033
NM_007294.3(BRCA1):c.2398_2401delAAAT (p.Lys800Valfs) rs786202684
NM_007294.3(BRCA1):c.2398_2411del (p.Lys800Valfs) rs886040034
NM_007294.3(BRCA1):c.239_241delGTCinsTT (p.Ser80Ilefs) rs886040032
NM_007294.3(BRCA1):c.2402delG (p.Cys801Leufs) rs876659447
NM_007294.3(BRCA1):c.2403T>A (p.Cys801Ter) rs80357381
NM_007294.3(BRCA1):c.2405_2406delTG (p.Val802Glufs) rs80357706
NM_007294.3(BRCA1):c.2406_2409delGAGT (p.Gln804Valfs) rs80357674
NM_007294.3(BRCA1):c.2407_2408delAG (p.Gln804Valfs) rs786202919
NM_007294.3(BRCA1):c.2409delT (p.Gln804Serfs) rs770460699
NM_007294.3(BRCA1):c.2410C>T (p.Gln804Ter) rs80356982
NM_007294.3(BRCA1):c.2411_2412delAG (p.Gln804Leufs) rs80357664
NM_007294.3(BRCA1):c.2411del (p.Gln804Argfs) rs886040035
NM_007294.3(BRCA1):c.2418delA (p.Ala807Hisfs) rs879255281
NM_007294.3(BRCA1):c.2418dupA (p.Ala807Serfs) rs886040036
NM_007294.3(BRCA1):c.241C>T (p.Gln81Ter) rs80357350
NM_007294.3(BRCA1):c.241_251delCAACTTGTTGA (p.Gln81Argfs) rs398122659
NM_007294.3(BRCA1):c.2424delT (p.Phe808Leufs) rs397507200
NM_007294.3(BRCA1):c.2429delA (p.Asn810Thrfs) rs397508967
NM_007294.3(BRCA1):c.2429dupA (p.Asn810Lysfs) rs397508967
NM_007294.3(BRCA1):c.2433delC (p.Lys812Argfs) rs80357524
NM_007294.3(BRCA1):c.2433dupC (p.Lys812Glnfs) rs80357524
NM_007294.3(BRCA1):c.2434A>T (p.Lys812Ter) rs397508968
NM_007294.3(BRCA1):c.2437G>T (p.Gly813Ter) rs80357186
NM_007294.3(BRCA1):c.2438dupG (p.Leu814Thrfs) rs80357503
NM_007294.3(BRCA1):c.243delA (p.Gln81Hisfs) rs273899684
NM_007294.3(BRCA1):c.2442_2443insT (p.Ile815Tyrfs) rs886040038
NM_007294.3(BRCA1):c.2443delA (p.Ile815Phefs) rs80357598
NM_007294.3(BRCA1):c.2443dup (p.Ile815Asnfs) rs80357598
NM_007294.3(BRCA1):c.2445_2448delTCAT (p.Ile815Metfs) rs886038000
NM_007294.3(BRCA1):c.2445dup (p.His816Serfs) rs1555589652
NM_007294.3(BRCA1):c.2450delG (p.Gly817Valfs) rs80357679
NM_007294.3(BRCA1):c.2457delC (p.Asp821Ilefs) rs80357669
NM_007294.3(BRCA1):c.2467delA (p.Arg823Glufs) rs1064795446
NM_007294.3(BRCA1):c.2468delG (p.Arg823Lysfs) rs80357799
NM_007294.3(BRCA1):c.246del (p.Val83Leufs) rs886040039
NM_007294.3(BRCA1):c.2473delG (p.Asp825Thrfs) rs886040040
NM_007294.3(BRCA1):c.2474dupA (p.Asp825Glufs) rs80357830
NM_007294.3(BRCA1):c.2475delC (p.Asp825Glufs) rs80357970
NM_007294.3(BRCA1):c.2476delA (p.Thr826Glnfs) rs80357631
NM_007294.3(BRCA1):c.2477_2478delCA (p.Thr826Argfs) rs80357800
NM_007294.3(BRCA1):c.2477_2492del16insTG (p.Thr826Metfs) rs886040041
NM_007294.3(BRCA1):c.2477delC (p.Thr826Lysfs) rs80357740
NM_007294.3(BRCA1):c.2481delA (p.Gly828Alafs) rs886040042
NM_007294.3(BRCA1):c.2486_2487delTT (p.Phe829Terfs) rs80357658
NM_007294.3(BRCA1):c.2487_2488insCCCCT (p.Lys830Profs) rs397508972
NM_007294.3(BRCA1):c.2487delT (p.Phe829Leufs) rs80357658
NM_007294.3(BRCA1):c.2487dupT (p.Lys830Terfs) rs80357658
NM_007294.3(BRCA1):c.2488_2489insCCCCT (p.Lys830Thrfs) rs1555589565
NM_007294.3(BRCA1):c.2488_2497dupAAGTATCCAT (p.Leu833Terfs) rs397508973
NM_007294.3(BRCA1):c.2489_2490insAAGTATCCAT (p.Tyr831Serfs) rs1555589559
NM_007294.3(BRCA1):c.2489_2492delAGTA (p.Lys830Ilefs) rs886040043
NM_007294.3(BRCA1):c.2490_2497dup (p.Leu833Cysfs) rs1555589539
NM_007294.3(BRCA1):c.2493_2494insGT (p.Pro832Valfs) rs1555589547
NM_007294.3(BRCA1):c.2501del (p.Gly834Aspfs) rs886040044
NM_007294.3(BRCA1):c.2504_2505ins17 (p.?)
NM_007294.3(BRCA1):c.2506delG (p.Glu836Lysfs) rs587780798
NM_007294.3(BRCA1):c.2507_2508delAA (p.Glu836Glyfs) rs273899686
NM_007294.3(BRCA1):c.250G>T (p.Glu84Ter) rs398122661
NM_007294.3(BRCA1):c.2513delA (p.Asn838Thrfs) rs80357863
NM_007294.3(BRCA1):c.2515delC (p.His839Thrfs) rs80357607
NM_007294.3(BRCA1):c.2517_2518delCA (p.His839Glnfs) rs397508974
NM_007294.3(BRCA1):c.2518delA (p.Ser840Valfs) rs397508975
NM_007294.3(BRCA1):c.2524G>T (p.Glu842Ter) rs876658552
NM_007294.3(BRCA1):c.2524dup (p.Glu842Glyfs) rs886040045
NM_007294.3(BRCA1):c.2527delA (p.Thr843Glnfs) rs1085308034
NM_007294.3(BRCA1):c.2529_2530del (p.Ser844Hisfs) rs886040046
NM_007294.3(BRCA1):c.2532_2536del (p.Ser844Argfs) rs886040047
NM_007294.3(BRCA1):c.2536G>T (p.Glu846Ter) rs786203523
NM_007294.3(BRCA1):c.2538_2540delAATinsG (p.Met847Glyfs) rs886040048
NM_007294.3(BRCA1):c.2542_2545del (p.Glu848Lysfs) rs886040049
NM_007294.3(BRCA1):c.2545G>T (p.Glu849Ter) rs80356951
NM_007294.3(BRCA1):c.2548delA (p.Ser850Valfs) rs1555589434
NM_007294.3(BRCA1):c.2551G>T (p.Glu851Ter) rs398122662
NM_007294.3(BRCA1):c.2551delG (p.Glu851Asnfs) rs397508977
NM_007294.3(BRCA1):c.2552_2553del (p.Glu851Alafs) rs886040050
NM_007294.3(BRCA1):c.2552_2553dup (p.Leu852Asnfs) rs886040051
NM_007294.3(BRCA1):c.2556delT (p.Asp853Metfs) rs397508978
NM_007294.3(BRCA1):c.2556dupT (p.Asp853Terfs) rs397508978
NM_007294.3(BRCA1):c.2557_2558insTTCACTTTTC (p.Asp853Valfs) rs1555589410
NM_007294.3(BRCA1):c.2558dupA (p.Asp853Glufs) rs80357835
NM_007294.3(BRCA1):c.2560_2561dupGC (p.Gln855Leufs) rs80357968
NM_007294.3(BRCA1):c.2561_2565delCTCAG (p.Ala854Valfs) rs397508981
NM_007294.3(BRCA1):c.2562_2563insGC (p.Gln855Alafs) rs878853290
NM_007294.3(BRCA1):c.2563C>T (p.Gln855Ter) rs80357131
NM_007294.3(BRCA1):c.2563_2564insGC (p.Gln855Argfs) rs1555589397
NM_007294.3(BRCA1):c.2566_2567insTGATT (p.Tyr856Leufs) rs1555589385
NM_007294.3(BRCA1):c.2568T>G (p.Tyr856Ter) rs80356832
NM_007294.3(BRCA1):c.2570T>A (p.Leu857Ter) rs886037787
NM_007294.3(BRCA1):c.2572C>T (p.Gln858Ter) rs397508983
NM_007294.3(BRCA1):c.2576delA (p.Asn859Ilefs) rs1555589351
NM_007294.3(BRCA1):c.2577_2578insTT (p.Thr860Leufs) rs886040052
NM_007294.3(BRCA1):c.2578_2579insTT (p.Thr860Ilefs) rs1555589340
NM_007294.3(BRCA1):c.2586_2593delGGTTTCAA (p.Val863Alafs) rs80357675
NM_007294.3(BRCA1):c.2587del (p.Val863Phefs) rs886040053
NM_007294.3(BRCA1):c.2591C>G (p.Ser864Ter) rs80357003
NM_007294.3(BRCA1):c.2593A>T (p.Lys865Ter) rs587782628
NM_007294.3(BRCA1):c.2594delA (p.Lys865Serfs) rs80357756
NM_007294.3(BRCA1):c.2599C>T (p.Gln867Ter) rs886038001
NM_007294.3(BRCA1):c.2601_2604dupGTCA (p.Phe869Valfs) rs80357603
NM_007294.3(BRCA1):c.2603C>A (p.Ser868Ter) rs80356925
NM_007294.3(BRCA1):c.2603C>G (p.Ser868Ter) rs80356925
NM_007294.3(BRCA1):c.260T>A (p.Leu87Ter) rs886040054
NM_007294.3(BRCA1):c.2611_2612delCC (p.Pro871Valfs) rs80357962
NM_007294.3(BRCA1):c.2612_2613insT (p.Phe872Valfs) rs80357948
NM_007294.3(BRCA1):c.2612delCinsTT (p.Pro871Leufs) rs397508986
NM_007294.3(BRCA1):c.2612dupC (p.Phe872Valfs) rs1555589289
NM_007294.3(BRCA1):c.2617del (p.Ser873Glnfs) rs80357912
NM_007294.3(BRCA1):c.2617dupT (p.Ser873Phefs) rs80357912
NM_007294.3(BRCA1):c.2621delA (p.Asn874Ilefs) rs587781423
NM_007294.3(BRCA1):c.2630delA (p.Asn877Metfs) rs886038002
NM_007294.3(BRCA1):c.2635G>T (p.Glu879Ter) rs80357251
NM_007294.3(BRCA1):c.2637delA (p.Glu880Argfs) rs886040056
NM_007294.3(BRCA1):c.2641G>T (p.Glu881Ter) rs397508988
NM_007294.3(BRCA1):c.2643delA (p.Glu881Aspfs) rs397508989
NM_007294.3(BRCA1):c.2646_2648delTGC (p.Cys882_Ser1217delinsTer) rs80357513
NM_007294.3(BRCA1):c.2647_2648insGGCA (p.Ala883Glyfs) rs1555589236
NM_007294.3(BRCA1):c.2648_2649insGGCA (p.Thr884Alafs) rs886040057
NM_007294.3(BRCA1):c.2649_2650del (p.Thr884Ilefs) rs886040058
NM_007294.3(BRCA1):c.2649_2650insGGCA (p.Thr884Glyfs) rs886038003
NM_007294.3(BRCA1):c.2650_2651insGGCA (p.Thr884Argfs) rs1555589228
NM_007294.3(BRCA1):c.2652dupA (p.Phe885Ilefs) rs886040059
NM_007294.3(BRCA1):c.2654delT (p.Phe885Serfs) rs398122663
NM_007294.3(BRCA1):c.2654dupT (p.Ser886Leufs) rs398122663
NM_007294.3(BRCA1):c.2657_2658delCT (p.Ser886Cysfs) rs397508990
NM_007294.3(BRCA1):c.2658_2659insA (p.Ala887Serfs) rs80357541
NM_007294.3(BRCA1):c.2659_2660insA (p.Ala887Aspfs) rs397508991
NM_007294.3(BRCA1):c.2659dupG (p.Ala887Glyfs) rs1555589203
NM_007294.3(BRCA1):c.2660_2661insA (p.His888Profs) rs1555589195
NM_007294.3(BRCA1):c.2665dupT (p.Ser889Phefs) rs397508992
NM_007294.3(BRCA1):c.2666dupC (p.Gly890Trpfs) rs876660425
NM_007294.3(BRCA1):c.2670delG (p.Ser891Profs) rs80357659
NM_007294.3(BRCA1):c.2671delT (p.Ser891Profs) rs397508993
NM_007294.3(BRCA1):c.2675T>G (p.Leu892Ter) rs397508994
NM_007294.3(BRCA1):c.2675_2678delTAAA (p.Leu892Terfs) rs80357518
NM_007294.3(BRCA1):c.2677A>T (p.Lys893Ter) rs80357170
NM_007294.3(BRCA1):c.2678dup (p.Lys894Glufs) rs886040060
NM_007294.3(BRCA1):c.2679_2680delGA (p.Lys894Thrfs) rs397508995
NM_007294.3(BRCA1):c.2679_2682delGAAA (p.Lys893Asnfs) rs80357596
NM_007294.3(BRCA1):c.2680A>T (p.Lys894Ter) rs876659457
NM_007294.3(BRCA1):c.2681_2682delAA (p.Lys894Thrfs) rs80357971
NM_007294.3(BRCA1):c.2682delA (p.Lys894Asnfs) rs80357971
NM_007294.3(BRCA1):c.2683C>T (p.Gln895Ter) rs397508997
NM_007294.3(BRCA1):c.2683_2686delCAAA (p.Gln895Valfs) rs397508998
NM_007294.3(BRCA1):c.2683_2693del (p.Gln895Serfs) rs886040061
NM_007294.3(BRCA1):c.2685_2686delAA (p.Pro897Lysfs) rs80357636
NM_007294.3(BRCA1):c.2686delA (p.Ser896Valfs) rs80357636
NM_007294.3(BRCA1):c.2686dupA (p.Ser896Lysfs) rs80357636
NM_007294.3(BRCA1):c.2687_2693delGTCCAAA (p.Ser896Lysfs) rs886040062
NM_007294.3(BRCA1):c.2688_2689insA (p.Pro897Thrfs) rs1555589140
NM_007294.3(BRCA1):c.2689_2690insAC (p.Pro897Hisfs) rs1555589138
NM_007294.3(BRCA1):c.2690_2691dup (p.Lys898Glnfs) rs1555589128
NM_007294.3(BRCA1):c.2693_2694dupAA (p.Val899Lysfs) rs80357549
NM_007294.3(BRCA1):c.2694del (p.Val899Serfs) rs80357549
NM_007294.3(BRCA1):c.2694dupA (p.Val899Serfs) rs80357549
NM_007294.3(BRCA1):c.269_281delTTTGTGCTTTTCA (p.Ile90Serfs) rs80359879
NM_007294.3(BRCA1):c.2702_2703delTT (p.Phe901Terfs) rs80357899
NM_007294.3(BRCA1):c.2704del (p.Glu902Asnfs) rs886040064
NM_007294.3(BRCA1):c.2706_2707dupAT (p.Cys903Tyrfs) rs80357717
NM_007294.3(BRCA1):c.2707delT (p.Cys903Valfs) rs1064794864
NM_007294.3(BRCA1):c.2709T>A (p.Cys903Ter) rs1555589094
NM_007294.3(BRCA1):c.2709_2710delTG (p.Cys903Terfs) rs886040065
NM_007294.3(BRCA1):c.2709delT (p.Cys903Trpfs) rs80357594
NM_007294.3(BRCA1):c.2710G>T (p.Glu904Ter) rs80357035
NM_007294.3(BRCA1):c.2710del (p.Glu904Asnfs) rs886040066
NM_007294.3(BRCA1):c.2713C>T (p.Gln905Ter) rs397509002
NM_007294.3(BRCA1):c.2717delA (p.Lys906Argfs) rs876659072
NM_007294.3(BRCA1):c.2719G>T (p.Glu907Ter) rs876658593
NM_007294.3(BRCA1):c.2719_2722delGAAG (p.Glu907Lysfs) rs80357731
NM_007294.3(BRCA1):c.2719delG (p.Glu907Lysfs) rs879255481
NM_007294.3(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.3(BRCA1):c.2726_2730delATCAA (p.Asn909Argfs) rs80357712
NM_007294.3(BRCA1):c.2726delA (p.Asn909Ilefs) rs80357614
NM_007294.3(BRCA1):c.2726dupA (p.Asn909Lysfs) rs80357614
NM_007294.3(BRCA1):c.2727_2730delTCAA (p.Asn909Lysfs) rs80357605
NM_007294.3(BRCA1):c.2728C>T (p.Gln910Ter) rs397509004
NM_007294.3(BRCA1):c.2728delC (p.Gln910Lysfs) rs397509005
NM_007294.3(BRCA1):c.273_274delTG (p.Ala92Phefs) rs587776485
NM_007294.3(BRCA1):c.2740G>T (p.Glu914Ter) rs80357419
NM_007294.3(BRCA1):c.2744_2745delCT (p.Ser915Terfs) rs80357540
NM_007294.3(BRCA1):c.2745dupT (p.Asn916Terfs) rs397509008
NM_007294.3(BRCA1):c.2748delT (p.Asn916Lysfs) rs398122667
NM_007294.3(BRCA1):c.2749dupA (p.Ile917Asnfs) rs80357942
NM_007294.3(BRCA1):c.2750del (p.Ile917Thrfs) rs886040067
NM_007294.3(BRCA1):c.2751delC (p.Lys918Serfs) rs886040068
NM_007294.3(BRCA1):c.2753_2755delAGCinsCA (p.Lys918Thrfs) rs886040069
NM_007294.3(BRCA1):c.2755_2756insGGGTG (p.Pro919Argfs) rs1555589008
NM_007294.3(BRCA1):c.2760delA (p.Gln921Argfs) rs1064795769
NM_007294.3(BRCA1):c.2761C>T (p.Gln921Ter) rs80357377
NM_007294.3(BRCA1):c.2762delA (p.Gln921Argfs) rs80357703
NM_007294.3(BRCA1):c.2764_2767delACAG (p.Thr922Leufs) rs80357822
NM_007294.3(BRCA1):c.2766delA (p.Val923Leufs) rs80357812
NM_007294.3(BRCA1):c.2767_2770delGTTA (p.Val923Ilefs) rs80357661
NM_007294.3(BRCA1):c.2774delT (p.Ile925Thrfs) rs398122669
NM_007294.3(BRCA1):c.2776_2777del (p.Thr926Cysfs) rs886040070
NM_007294.3(BRCA1):c.2776_2777insTA (p.Thr926Ilefs) rs886040071
NM_007294.3(BRCA1):c.2778_2779insAT (p.Ala927Metfs) rs886040072
NM_007294.3(BRCA1):c.2778dup (p.Ala927Cysfs) rs886040072
NM_007294.3(BRCA1):c.2783delG (p.Gly928Alafs) rs1064795600
NM_007294.3(BRCA1):c.2787_2788insTTATCACTGCAGGCTTT (p.Pro930Leufs) rs886040073
NM_007294.3(BRCA1):c.2788_2789insTTATCACTGCAGGCTTT (p.Pro930Leufs) rs1555588952
NM_007294.3(BRCA1):c.2796_2799delTGGT (p.Gly933Argfs) rs80357840
NM_007294.3(BRCA1):c.2796delT (p.Gly933Valfs) rs1555588942
NM_007294.3(BRCA1):c.2798_2799delGT (p.Gly933Alafs) rs397509011
NM_007294.3(BRCA1):c.2799delT (p.Gln934Argfs) rs80357998
NM_007294.3(BRCA1):c.2800C>T (p.Gln934Ter) rs80357223
NM_007294.3(BRCA1):c.2805delA (p.Asp936Ilefs) rs397509012
NM_007294.3(BRCA1):c.2805dupA (p.Asp936Argfs) rs397509012
NM_007294.3(BRCA1):c.2806_2807delGA (p.Asp936Terfs) rs886038004
NM_007294.3(BRCA1):c.2806_2809delGATA (p.Asp936Serfs) rs80357832
NM_007294.3(BRCA1):c.2808_2811delTAAG (p.Lys937Glnfs) rs397509013
NM_007294.3(BRCA1):c.2809A>T (p.Lys937Ter) rs1555588915
NM_007294.3(BRCA1):c.280C>T (p.Gln94Ter) rs886037972
NM_007294.3(BRCA1):c.2812_2813delCC (p.Pro938Serfs) rs730882056
NM_007294.3(BRCA1):c.2812_2813delCCinsG (p.Pro938Glufs) rs273899689
NM_007294.3(BRCA1):c.2814del (p.Val939Leufs) rs886040074
NM_007294.3(BRCA1):c.2823delT (p.Asn941Lysfs) rs886040075
NM_007294.3(BRCA1):c.2830delT (p.Cys944Valfs) rs397509014
NM_007294.3(BRCA1):c.2832T>A (p.Cys944Ter) rs80357458
NM_007294.3(BRCA1):c.2834_2835delGT (p.Ser945Asnfs) rs397509015
NM_007294.3(BRCA1):c.2834_2836delGTAinsC (p.Ser945Thrfs) rs386134270
NM_007294.3(BRCA1):c.2835dupT (p.Ile946Tyrfs) rs80357519
NM_007294.3(BRCA1):c.2836_2837delAT (p.Ile946Glnfs) rs397509016
NM_007294.3(BRCA1):c.2840_2841delAA (p.Lys947Argfs) rs80357984
NM_007294.3(BRCA1):c.2843del (p.Gly948Glufs) rs886040076
NM_007294.3(BRCA1):c.2844_2853delAGGCTCTAGG (p.Gly949Phefs) rs397509017
NM_007294.3(BRCA1):c.2848dupT (p.Ser950Phefs) rs397509018
NM_007294.3(BRCA1):c.2850_2851insC (p.Arg951Glnfs) rs886040077
NM_007294.3(BRCA1):c.2850dup (p.Arg951Terfs) rs1555588846
NM_007294.3(BRCA1):c.2851_2852insC (p.Arg951Thrfs) rs1555588844
NM_007294.3(BRCA1):c.2856_2857delTT (p.Phe952Leufs) rs397509019
NM_007294.3(BRCA1):c.2861_2864del (p.Leu954Hisfs) rs886040078
NM_007294.3(BRCA1):c.2861dupT (p.Ser955Ilefs) rs886040079
NM_007294.3(BRCA1):c.2864C>A (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2864C>G (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2864_2865insT (p.Ser956Ilefs) rs397507205
NM_007294.3(BRCA1):c.2866_2870delTCTCA (p.Ser956Valfs) rs80357819
NM_007294.3(BRCA1):c.2866dup (p.Ser956Phefs) rs1555588822
NM_007294.3(BRCA1):c.2868delT (p.Gln957Serfs) rs80357929
NM_007294.3(BRCA1):c.2869C>T (p.Gln957Ter) rs80356973
NM_007294.3(BRCA1):c.2870dupA (p.Phe958Valfs) rs397509020
NM_007294.3(BRCA1):c.2871_2872insA (p.Phe958Ilefs) rs80357693
NM_007294.3(BRCA1):c.2872_2873insA (p.Phe958Tyrfs) rs1555588803
NM_007294.3(BRCA1):c.2872_2876delTTCAG (p.Phe958Argfs) rs397509021
NM_007294.3(BRCA1):c.2875del (p.Arg959Glufs) rs886040080
NM_007294.3(BRCA1):c.2878_2879del (p.Gly960Glnfs) rs886040081
NM_007294.3(BRCA1):c.2882delA (p.Asn961Thrfs) rs886040082
NM_007294.3(BRCA1):c.2887delA (p.Thr963Leufs) rs80357559
NM_007294.3(BRCA1):c.2889_2890delTG (p.Gly964Thrfs) rs80357890
NM_007294.3(BRCA1):c.288_292delCACAGins7
NM_007294.3(BRCA1):c.2890G>T (p.Gly964Ter) rs879254027
NM_007294.3(BRCA1):c.2898delT (p.Thr967Leufs) rs886038005
NM_007294.3(BRCA1):c.2902_2903insTC (p.Pro968Leufs) rs398122670
NM_007294.3(BRCA1):c.2903_2904insTC (p.Asn969Glnfs) rs886040083
NM_007294.3(BRCA1):c.2903dup (p.Asn969Lysfs) rs1555588756
NM_007294.3(BRCA1):c.2904_2905insTC (p.Asn969Serfs) rs1555588752
NM_007294.3(BRCA1):c.2906_2908delATAinsCT (p.Asn969Thrfs) rs886040084
NM_007294.3(BRCA1):c.2906del (p.Asn969Ilefs) rs886040085
NM_007294.3(BRCA1):c.290_291delCA (p.Thr97Argfs) rs80357738
NM_007294.3(BRCA1):c.2910delA (p.Lys970Asnfs) rs80357893
NM_007294.3(BRCA1):c.2912_2913delAT (p.His971Argfs) rs878854940
NM_007294.3(BRCA1):c.2914G>T (p.Gly972Ter) rs397509023
NM_007294.3(BRCA1):c.2915delG (p.Gly972Aspfs) rs80357573
NM_007294.3(BRCA1):c.2917_2920del (p.Leu973Tyrfs) rs886040086
NM_007294.3(BRCA1):c.2920_2921delTT (p.Leu974Thrfs) rs80357611
NM_007294.3(BRCA1):c.2921T>A (p.Leu974Ter) rs80356872
NM_007294.3(BRCA1):c.2921dupT (p.Leu974Phefs) rs80357611
NM_007294.3(BRCA1):c.2923C>T (p.Gln975Ter) rs80357497
NM_007294.3(BRCA1):c.2927delA (p.Asn976Thrfs) rs886038006
NM_007294.3(BRCA1):c.2929_2930dupCC (p.Tyr978Hisfs) rs397509025
NM_007294.3(BRCA1):c.2933dupA (p.Tyr978Terfs) rs878853292
NM_007294.3(BRCA1):c.2934T>A (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934T>G (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934delT (p.Arg979Valfs) rs80357741
NM_007294.3(BRCA1):c.2938delA (p.Ile980Tyrfs) rs730881439
NM_007294.3(BRCA1):c.2940delA (p.Pro981Hisfs) rs80357876
NM_007294.3(BRCA1):c.2945delC (p.Pro982Hisfs) rs730881461
NM_007294.3(BRCA1):c.2947delC (p.Leu983Phefs) rs876659108
NM_007294.3(BRCA1):c.2951_2952del (p.Phe984Serfs) rs80357627
NM_007294.3(BRCA1):c.2952delT (p.Ile986Serfs) rs80357627
NM_007294.3(BRCA1):c.2952dupT (p.Pro985Serfs) rs80357627
NM_007294.3(BRCA1):c.2955delC (p.Ile986Serfs) rs397509027
NM_007294.3(BRCA1):c.2959A>T (p.Lys987Ter) rs878854941
NM_007294.3(BRCA1):c.2960_2964delAGTCA (p.Lys987Ilefs) rs1555588625
NM_007294.3(BRCA1):c.2960dup (p.Ser988Valfs) rs886040088
NM_007294.3(BRCA1):c.2963C>A (p.Ser988Ter) rs397507206
NM_007294.3(BRCA1):c.2967delT (p.Phe989Leufs) rs397509028
NM_007294.3(BRCA1):c.2970del (p.Thr992Leufs) rs886040089
NM_007294.3(BRCA1):c.2971A>T (p.Lys991Ter) rs886040090
NM_007294.3(BRCA1):c.2973_2979delAACTAAA (p.Lys991Asnfs) rs397509030
NM_007294.3(BRCA1):c.2973_2989del17 (p.Thr992Serfs) rs397509031
NM_007294.3(BRCA1):c.2980delT (p.Cys994Valfs) rs80357502
NM_007294.3(BRCA1):c.2981_2982delGT (p.Cys994Terfs) rs397507207
NM_007294.3(BRCA1):c.2981del (p.Cys994Leufs) rs886040091
NM_007294.3(BRCA1):c.2983A>T (p.Lys995Ter) rs879255315
NM_007294.3(BRCA1):c.2989_2990dupAA (p.Asn997Lysfs) rs80357829
NM_007294.3(BRCA1):c.2990delA (p.Asn997Ilefs) rs80357829
NM_007294.3(BRCA1):c.2995_2996delCTinsTA (p.Leu999Ter) rs273899692
NM_007294.3(BRCA1):c.2999delA (p.Glu1000Glyfs) rs80357991
NM_007294.3(BRCA1):c.2T>C (p.Met1Thr) rs80357111
NM_007294.3(BRCA1):c.2T>G (p.Met1Arg) rs80357111
NM_007294.3(BRCA1):c.3001G>T (p.Glu1001Ter) rs886038007
NM_007294.3(BRCA1):c.3005delA (p.Asn1002Thrfs) rs80357601
NM_007294.3(BRCA1):c.3006_3009del (p.Asn1002Lysfs) rs886040092
NM_007294.3(BRCA1):c.3008_3009delTT (p.Phe1003Terfs) rs80357617
NM_007294.3(BRCA1):c.301+1G>A rs587782173
NM_007294.3(BRCA1):c.301+1G>C rs587782173
NM_007294.3(BRCA1):c.301+2dupT rs273899694
NM_007294.3(BRCA1):c.3010G>T (p.Glu1004Ter) rs786202534
NM_007294.3(BRCA1):c.3013delG (p.Glu1005Asnfs) rs80357937
NM_007294.3(BRCA1):c.3015delA (p.Glu1005Aspfs) rs886038008
NM_007294.3(BRCA1):c.3016_3020delCATTC (p.His1006Asnfs) rs1135401855
NM_007294.3(BRCA1):c.3018_3021delTTCA (p.His1006Glnfs) rs80357749
NM_007294.3(BRCA1):c.302-1G>A rs80358116
NM_007294.3(BRCA1):c.302-1G>C rs80358116
NM_007294.3(BRCA1):c.302-1G>T rs80358116
NM_007294.3(BRCA1):c.302-2A>C rs80358011
NM_007294.3(BRCA1):c.302-2A>G rs80358011
NM_007294.3(BRCA1):c.302-2A>T rs80358011
NM_007294.3(BRCA1):c.302-2_302-1del rs483353093
NM_007294.3(BRCA1):c.302-2delA rs273899695
NM_007294.3(BRCA1):c.302-3C>G rs80358051
NM_007294.3(BRCA1):c.302-?_593+?del
NM_007294.3(BRCA1):c.3020C>G (p.Ser1007Ter) rs80357168
NM_007294.3(BRCA1):c.3020_3023del (p.Ser1007Cysfs) rs886040093
NM_007294.3(BRCA1):c.3024dup (p.Ser1009Valfs) rs886040094
NM_007294.3(BRCA1):c.3026C>A (p.Ser1009Ter) rs273899696
NM_007294.3(BRCA1):c.3029_3030delCT (p.Pro1010Argfs) rs80357510
NM_007294.3(BRCA1):c.3037_3038delGA (p.Glu1013Asnfs) rs397507208
NM_007294.3(BRCA1):c.303T>A (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.303T>G (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.3044dupG (p.Asn1016Lysfs) rs80357746
NM_007294.3(BRCA1):c.3048_3052dupTGAGA (p.Asn1018Metfs) rs80357856
NM_007294.3(BRCA1):c.3049G>T (p.Glu1017Ter) rs80357004
NM_007294.3(BRCA1):c.3052_3053ins5
NM_007294.3(BRCA1):c.3053_3054insTGAGA (p.Ile1019Glufs) rs80357547
NM_007294.3(BRCA1):c.3054_3055insTGAGA (p.Ile1019Terfs) rs1555588469
NM_007294.3(BRCA1):c.3056_3059delTTCC (p.Ile1019Lysfs) rs1135401856
NM_007294.3(BRCA1):c.3062delG (p.Ser1021Ilefs) rs1135401857
NM_007294.3(BRCA1):c.3066delA (p.Val1023Terfs) rs786202906
NM_007294.3(BRCA1):c.3075_3076ins76 (p.?)
NM_007294.3(BRCA1):c.3075_3076insGGAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGATCATTCCAAGTACAGTGAGCACA (p.Ile1026Glyfs) rs886040095
NM_007294.3(BRCA1):c.3076_3077ins76 (p.?)
NM_007294.3(BRCA1):c.3076_3077insGGAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGATCATTCCAAGTACAGTGAGCACA (p.Ile1026Argfs) rs1555588427
NM_007294.3(BRCA1):c.3084_3094delTAATAACATTA (p.Asn1029Argfs) rs80357647
NM_007294.3(BRCA1):c.3087_3100dup (p.Asn1034Ilefs) rs80357967
NM_007294.3(BRCA1):c.3091dupA (p.Ile1031Asnfs) rs1555588399
NM_007294.3(BRCA1):c.3097G>T (p.Glu1033Ter) rs273899698
NM_007294.3(BRCA1):c.3107_3112delTTAAAG (p.Phe1036_Cys1372delinsTer) rs80357920
NM_007294.3(BRCA1):c.3108delT (p.Phe1036Leufs) rs80357841
NM_007294.3(BRCA1):c.3108dupT (p.Lys1037Terfs) rs80357841
NM_007294.3(BRCA1):c.3109_3110insT (p.Lys1037Ilefs) rs886040096
NM_007294.3(BRCA1):c.310del (p.Ser104Alafs) rs886040097
NM_007294.3(BRCA1):c.310dupA (p.Ser104Lysfs) rs1555596484
NM_007294.3(BRCA1):c.3110_3111insT (p.Lys1037Asnfs) rs1555588381
NM_007294.3(BRCA1):c.3112G>T (p.Glu1038Ter) rs80357161
NM_007294.3(BRCA1):c.3114_3117delAGCCinsGA (p.Ala1039Lysfs) rs273899700
NM_007294.3(BRCA1):c.3115delG (p.Ala1039Profs) rs886040098
NM_007294.3(BRCA1):c.3117_3120del (p.Ser1040Glnfs) rs886040099
NM_007294.3(BRCA1):c.3122C>G (p.Ser1041Ter) rs397509035
NM_007294.3(BRCA1):c.3125_3134delGCAATATTAA (p.Ser1042Metfs) rs397509036
NM_007294.3(BRCA1):c.3129_3138delTATTAATGAA (p.Asn1043Lysfs) rs730881462
NM_007294.3(BRCA1):c.3132delT (p.Asn1045Metfs) rs879255316
NM_007294.3(BRCA1):c.3138_3141delAGTA (p.Gly1048Profs) rs1064794177
NM_007294.3(BRCA1):c.3143delG (p.Gly1048Valfs) rs886040100
NM_007294.3(BRCA1):c.3145delT (p.Ser1049Profs) rs397509038
NM_007294.3(BRCA1):c.3150_3208dup59 (p.Ala1070Valfs) rs1555588199
NM_007294.3(BRCA1):c.3155delA (p.Asn1052Metfs) rs397509040
NM_007294.3(BRCA1):c.3157G>T (p.Glu1053Ter) rs786203587
NM_007294.3(BRCA1):c.3157delG (p.Glu1053Lysfs) rs397509041
NM_007294.3(BRCA1):c.3157dupG (p.Glu1053Glyfs) rs397509042
NM_007294.3(BRCA1):c.3158_3159insG (p.Val1054Serfs) rs80357769
NM_007294.3(BRCA1):c.3164_3165ins4
NM_007294.3(BRCA1):c.3164delG (p.Gly1055Alafs) rs397509043
NM_007294.3(BRCA1):c.3168delC (p.Ser1057Valfs) rs397509044
NM_007294.3(BRCA1):c.3169_3172delAGTA (p.Ser1057Leufs) rs397509045
NM_007294.3(BRCA1):c.3174delT (p.Asn1059Metfs) rs397507210
NM_007294.3(BRCA1):c.3178G>T (p.Glu1060Ter) rs80357424
NM_007294.3(BRCA1):c.317delA (p.Asn106Ilefs) rs80357950
NM_007294.3(BRCA1):c.3181delA (p.Ile1061Terfs) rs80357702
NM_007294.3(BRCA1):c.3182del (p.Ile1061Lysfs) rs886040101
NM_007294.3(BRCA1):c.3183delA (p.Ile1061Metfs) rs397509046
NM_007294.3(BRCA1):c.3188_3189delCCinsG (p.Ser1063Terfs) rs273899701
NM_007294.3(BRCA1):c.3193dupG (p.Asp1065Glyfs) rs80357511
NM_007294.3(BRCA1):c.3194_3195insG (p.Asp1065Glufs) rs80357883
NM_007294.3(BRCA1):c.3196G>T (p.Glu1066Ter) rs1555588220
NM_007294.3(BRCA1):c.3196dup (p.Glu1066Glyfs) rs1555588222
NM_007294.3(BRCA1):c.3203_3206del (p.Ile1068Lysfs) rs886040102
NM_007294.3(BRCA1):c.3204delT (p.Gln1069Lysfs) rs398122673
NM_007294.3(BRCA1):c.3205delC (p.Gln1069Lysfs) rs886040103
NM_007294.3(BRCA1):c.3210dup (p.Glu1071Argfs) rs886040104
NM_007294.3(BRCA1):c.3211_3212dup (p.Leu1072Asnfs) rs886040105
NM_007294.3(BRCA1):c.3211dupG (p.Glu1071Glyfs) rs397509047
NM_007294.3(BRCA1):c.3214delC (p.Leu1072Terfs) rs80357923
NM_007294.3(BRCA1):c.3217_3218del (p.Gly1073Terfs) rs886040106
NM_007294.3(BRCA1):c.321delT (p.Phe107Leufs) rs80357544
NM_007294.3(BRCA1):c.3226A>T (p.Arg1076Ter) rs886038009
NM_007294.3(BRCA1):c.3226delA (p.Arg1076Glufs) rs273899703
NM_007294.3(BRCA1):c.3228_3229delAG (p.Gly1077Alafs) rs80357635
NM_007294.3(BRCA1):c.3239T>A (p.Leu1080Ter) rs80357145
NM_007294.3(BRCA1):c.3243_3288dup (p.Ser1097Cysfs) rs1555588016
NM_007294.3(BRCA1):c.3247_3251delATGCT (p.Met1083Terfs) rs1135401859
NM_007294.3(BRCA1):c.3253dupA (p.Arg1085Lysfs) rs80357517
NM_007294.3(BRCA1):c.3254_3255dupGA (p.Leu1086Aspfs) rs80357624
NM_007294.3(BRCA1):c.3255dupA (p.Leu1086Ilefs) rs1555588090
NM_007294.3(BRCA1):c.3256_3257insGA (p.Leu1086Terfs) rs80357764
NM_007294.3(BRCA1):c.3257T>A (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3257T>G (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3257_3258insGA (p.Gly1087Lysfs) rs1555588074
NM_007294.3(BRCA1):c.3257delT (p.Leu1086Terfs) rs80357858
NM_007294.3(BRCA1):c.3257dupT (p.Leu1086Phefs) rs80357858
NM_007294.3(BRCA1):c.3258del (p.Val1088Phefs) rs886040107
NM_007294.3(BRCA1):c.3262_3277del (p.Val1088Serfs) rs886040108
NM_007294.3(BRCA1):c.3262delG (p.Val1088Phefs) rs397509049
NM_007294.3(BRCA1):c.3266T>A (p.Leu1089Ter) rs886040110
NM_007294.3(BRCA1):c.3266del (p.Leu1089Cysfs) rs886040109
NM_007294.3(BRCA1):c.3268C>T (p.Gln1090Ter) rs80357402
NM_007294.3(BRCA1):c.3279_3280delCT (p.Tyr1094Terfs) rs886038010
NM_007294.3(BRCA1):c.3279delC (p.Tyr1094Ilefs) rs397509050
NM_007294.3(BRCA1):c.3282T>G (p.Tyr1094Ter) rs886040111
NM_007294.3(BRCA1):c.3285delA (p.Lys1095Asnfs) rs397509051
NM_007294.3(BRCA1):c.3286C>T (p.Gln1096Ter) rs80357485
NM_007294.3(BRCA1):c.3286delC (p.Gln1096Lysfs) rs80357533
NM_007294.3(BRCA1):c.3288_3289delAA (p.Leu1098Serfs) rs80357686
NM_007294.3(BRCA1):c.3288_3289ins46 (p.?)
NM_007294.3(BRCA1):c.3289delA (p.Ser1097Valfs) rs80357686
NM_007294.3(BRCA1):c.3289dupA (p.Ser1097Lysfs) rs80357686
NM_007294.3(BRCA1):c.3292_3293delCT (p.Leu1098Serfs) rs80357992
NM_007294.3(BRCA1):c.3294delT (p.Pro1099Leufs) rs876658626
NM_007294.3(BRCA1):c.3296delC (p.Pro1099Leufs) rs80357815
NM_007294.3(BRCA1):c.329_330delAG (p.Lys110Argfs) rs80357754
NM_007294.3(BRCA1):c.329delA (p.Lys110Argfs) rs80357604
NM_007294.3(BRCA1):c.329dupA (p.Glu111Glyfs) rs80357604
NM_007294.3(BRCA1):c.32_33insC (p.Gln12Thrfs) rs80357811
NM_007294.3(BRCA1):c.3308_3309insC (p.Lys1104Terfs) rs886040113
NM_007294.3(BRCA1):c.3309T>A (p.Cys1103Ter) rs80357317
NM_007294.3(BRCA1):c.3309_3310insC (p.Lys1104Glnfs) rs1555587980
NM_007294.3(BRCA1):c.330_331insA (p.Glu111Argfs) rs886040112
NM_007294.3(BRCA1):c.3314delA (p.His1105Leufs) rs397509054
NM_007294.3(BRCA1):c.3317delC (p.Pro1106Leufs) rs1555587972
NM_007294.3(BRCA1):c.3319G>T (p.Glu1107Ter) rs80357106
NM_007294.3(BRCA1):c.331del (p.Glu111Lysfs) rs886040114
NM_007294.3(BRCA1):c.3323_3324delTA (p.Ile1108Lysfs) rs786202791
NM_007294.3(BRCA1):c.3323_3326delTAAA (p.Ile1108Lysfs) rs80357763
NM_007294.3(BRCA1):c.3325_3329delAAAAA (p.Lys1109Alafs) rs80357575
NM_007294.3(BRCA1):c.3326_3329delAAAA (p.Lys1109Serfs) rs80357575
NM_007294.3(BRCA1):c.3329_3330delAG (p.Lys1110Thrfs) rs80357525
NM_007294.3(BRCA1):c.3329delA (p.Lys1110Serfs) rs80357575
NM_007294.3(BRCA1):c.3329dupA (p.Gln1111Alafs) rs80357575
NM_007294.3(BRCA1):c.3330_3331insA (p.Gln1111Thrfs) rs80357996
NM_007294.3(BRCA1):c.3330delG (p.Lys1110Asnfs) rs886038011
NM_007294.3(BRCA1):c.3331C>T (p.Gln1111Ter) rs80357089
NM_007294.3(BRCA1):c.3331_3334delCAAG (p.Gln1111Asnfs) rs80357701
NM_007294.3(BRCA1):c.3331_3335del (p.Gln1111Ilefs) rs886040115
NM_007294.3(BRCA1):c.3331del (p.Gln1111Lysfs) rs886040116
NM_007294.3(BRCA1):c.3333_3336delAGAA (p.Gln1111Hisfs) rs397509057
NM_007294.3(BRCA1):c.3333delA (p.Glu1112Asnfs) rs80357966
NM_007294.3(BRCA1):c.3333dup (p.Glu1112Argfs) rs80357966
NM_007294.3(BRCA1):c.3334delG (p.Glu1112Asnfs) rs1555587944
NM_007294.3(BRCA1):c.3339T>G (p.Tyr1113Ter) rs80357421
NM_007294.3(BRCA1):c.3339_3341del (p.Tyr1113_Ser1448delinsTer) rs886040117
NM_007294.3(BRCA1):c.3340G>T (p.Glu1114Ter) rs80357278
NM_007294.3(BRCA1):c.3342_3345delAGAA (p.Glu1115Terfs) rs397509058
NM_007294.3(BRCA1):c.3343delG (p.Glu1115Lysfs) rs273899705
NM_007294.3(BRCA1):c.3351dupT (p.Gln1118Serfs) rs80357785
NM_007294.3(BRCA1):c.3352C>T (p.Gln1118Ter) rs397507215
NM_007294.3(BRCA1):c.3354_3355delGA (p.Gln1118Hisfs) rs397509059
NM_007294.3(BRCA1):c.3357delT (p.Val1120Leufs) rs80357827
NM_007294.3(BRCA1):c.3358_3359delGT (p.Val1120Terfs) rs80357945
NM_007294.3(BRCA1):c.3358_3368del (p.Val1120Phefs) rs886040118
NM_007294.3(BRCA1):c.3359_3360delTT (p.Val1120Glufs) rs80357843
NM_007294.3(BRCA1):c.3359_3363delTTAAT (p.Val1120Aspfs) rs397509060
NM_007294.3(BRCA1):c.335_338delATAA (p.Asn112Thrfs) rs587782666
NM_007294.3(BRCA1):c.335del (p.Asn112Ilefs) rs886040119
NM_007294.3(BRCA1):c.335dup (p.Asn112Lysfs) rs886040119
NM_007294.3(BRCA1):c.3360dup (p.Asn1121Terfs) rs886040120
NM_007294.3(BRCA1):c.3362delA (p.Asn1121Ilefs) rs80357865
NM_007294.3(BRCA1):c.3365_3366delCA (p.Thr1122Argfs) rs80357892
NM_007294.3(BRCA1):c.3373dup (p.Ser1125Phefs) rs886040121
NM_007294.3(BRCA1):c.3375_3376delTC (p.Pro1126Ilefs) rs80357828
NM_007294.3(BRCA1):c.3377delC (p.Pro1126Hisfs) rs397509061
NM_007294.3(BRCA1):c.3381T>G (p.Tyr1127Ter) rs781319410
NM_007294.3(BRCA1):c.3384_3391del (p.Ile1129Terfs) rs886040122
NM_007294.3(BRCA1):c.3388_3408del21ins16 (p.?)
NM_007294.3(BRCA1):c.3388delT (p.Ser1130Glnfs) rs886040123
NM_007294.3(BRCA1):c.3389C>G (p.Ser1130Ter) rs80357405
NM_007294.3(BRCA1):c.3390delA (p.Asp1131Ilefs) rs80357900
NM_007294.3(BRCA1):c.3395del (p.Asn1132Thrfs) rs886040124
NM_007294.3(BRCA1):c.3396del (p.Leu1133Terfs) rs886040125
NM_007294.3(BRCA1):c.3397_3398delTT (p.Leu1133Argfs) rs80357577
NM_007294.3(BRCA1):c.3398T>A (p.Leu1133Ter) rs80356971
NM_007294.3(BRCA1):c.3398T>G (p.Leu1133Ter) rs80356971
NM_007294.3(BRCA1):c.3400G>T (p.Glu1134Ter) rs80357018
NM_007294.3(BRCA1):c.3403C>T (p.Gln1135Ter) rs80357136
NM_007294.3(BRCA1):c.3412G>T (p.Gly1138Ter) rs886040126
NM_007294.3(BRCA1):c.3413delG (p.Gly1138Glufs) rs397509063
NM_007294.3(BRCA1):c.3413dup (p.Ser1139Lysfs) rs397509063
NM_007294.3(BRCA1):c.3416_3427delGTAGTCATGCATinsC (p.Ser1139Thrfs) rs886040128
NM_007294.3(BRCA1):c.3416delG (p.Ser1139Ilefs) rs397509064
NM_007294.3(BRCA1):c.3416dup (p.Ser1139Argfs) rs1555587739
NM_007294.3(BRCA1):c.3417delT (p.Ser1139Argfs) rs273899706
NM_007294.3(BRCA1):c.3420dupT (p.His1141Serfs) rs397509065
NM_007294.3(BRCA1):c.3424delG (p.Ala1142Hisfs) rs1555587718
NM_007294.3(BRCA1):c.3428delCinsTA (p.Ser1143Leufs) rs397509066
NM_007294.3(BRCA1):c.342_343delTC (p.Pro115Terfs) rs80357881
NM_007294.3(BRCA1):c.342delT (p.Pro115Leufs) rs886040129
NM_007294.3(BRCA1):c.3430C>T (p.Gln1144Ter) rs80357369
NM_007294.3(BRCA1):c.3436_3439delTGTT (p.Cys1146Leufs) rs397509067
NM_007294.3(BRCA1):c.343_344delCC (p.Pro115Terfs)
NM_007294.3(BRCA1):c.3442G>T (p.Glu1148Ter) rs886038012
NM_007294.3(BRCA1):c.3442delG (p.Glu1148Argfs) rs80357808
NM_007294.3(BRCA1):c.3450delT (p.Asp1151Metfs) rs397509068
NM_007294.3(BRCA1):c.3450dupT (p.Asp1151Terfs) rs397509069
NM_007294.3(BRCA1):c.3458_3462delTGTTA (p.Leu1153Argfs) rs886038014
NM_007294.3(BRCA1):c.3459_3460delGT (p.Leu1154Argfs) rs886038013
NM_007294.3(BRCA1):c.3461T>G (p.Leu1154Ter) rs886040130
NM_007294.3(BRCA1):c.3462dupA (p.Asp1155Argfs) rs80357857
NM_007294.3(BRCA1):c.3468delT (p.Asp1156Glufs) rs397509070
NM_007294.3(BRCA1):c.346delG (p.Glu116Asnfs) rs762635795
NM_007294.3(BRCA1):c.3472G>T (p.Glu1158Ter) rs397509072
NM_007294.3(BRCA1):c.3477_3479delAAAinsC (p.Lys1160Glyfs) rs273899707
NM_007294.3(BRCA1):c.3477_3480delAAAG (p.Ile1159Metfs) rs80357781
NM_007294.3(BRCA1):c.3478_3479del (p.Lys1160Glyfs) rs273899707
NM_007294.3(BRCA1):c.3478_3487delAAGGAAGATA (p.Lys1160Leufs) rs786203694
NM_007294.3(BRCA1):c.3479_3483del (p.Lys1160Argfs) rs886040132
NM_007294.3(BRCA1):c.3479_3488delAGGAAGATAC (p.Lys1160Ilefs) rs397509073
NM_007294.3(BRCA1):c.3479delA (p.Lys1160Argfs) rs273899707
NM_007294.3(BRCA1):c.3481G>T (p.Glu1161Ter) rs786203438
NM_007294.3(BRCA1):c.3481_3491delGAAGATACTAG (p.Glu1161Phefs) rs80357877
NM_007294.3(BRCA1):c.3481_3493delGAAGATACTAGTT (p.Glu1161Leufs) rs1555587588
NM_007294.3(BRCA1):c.3481delG (p.Glu1161Lysfs) rs397509074
NM_007294.3(BRCA1):c.3482_3492del (p.Glu1161Valfs) rs886040133
NM_007294.3(BRCA1):c.3485_3488del (p.Asp1162Valfs) rs886040134
NM_007294.3(BRCA1):c.3485_3491del (p.Asp1162Valfs) rs886040135
NM_007294.3(BRCA1):c.3485delA (p.Asp1162Valfs) rs80357509
NM_007294.3(BRCA1):c.3489_3499del (p.Ser1164Lysfs) rs886040136
NM_007294.3(BRCA1):c.3494_3495delTT (p.Phe1165Cysfs) rs397509076
NM_007294.3(BRCA1):c.3496delG (p.Ala1166Leufs) rs886038015
NM_007294.3(BRCA1):c.3498del (p.Glu1167Lysfs) rs886040137
NM_007294.3(BRCA1):c.34C>T (p.Gln12Ter) rs80357134
NM_007294.3(BRCA1):c.34dup (p.Gln12Profs) rs1555601009
NM_007294.3(BRCA1):c.3503delA (p.Asn1168Metfs) rs397507216
NM_007294.3(BRCA1):c.3503dupA (p.Asn1168Lysfs) rs397507216
NM_007294.3(BRCA1):c.3504_3505insA (p.Asp1169Argfs) rs886040138
NM_007294.3(BRCA1):c.3505_3509delGACAT (p.Asp1169Terfs) rs397509078
NM_007294.3(BRCA1):c.3506dup (p.Asp1169Glufs) rs1555587573
NM_007294.3(BRCA1):c.3511A>T (p.Lys1171Ter) rs730882164
NM_007294.3(BRCA1):c.3512delA (p.Lys1171Argfs) rs886040139
NM_007294.3(BRCA1):c.3514G>T (p.Glu1172Ter) rs397509079
NM_007294.3(BRCA1):c.3516_3517ins100 (p.?)
NM_007294.3(BRCA1):c.3526delG (p.Val1176Phefs) rs1064794016
NM_007294.3(BRCA1):c.3531delT (p.Phe1177Leufs) rs80357621
NM_007294.3(BRCA1):c.3531dupT (p.Ser1178Terfs) rs80357621
NM_007294.3(BRCA1):c.3534del (p.Ser1178Argfs) rs886040140
NM_007294.3(BRCA1):c.3540_3541delCG (p.Val1181Profs) rs397509080
NM_007294.3(BRCA1):c.3541_3542del (p.Val1181Profs) rs886040141
NM_007294.3(BRCA1):c.3541delG (p.Val1181Serfs) rs886038016
NM_007294.3(BRCA1):c.3544C>T (p.Gln1182Ter) rs80357296
NM_007294.3(BRCA1):c.3547_3550delAAAGinsGAT (p.Lys1183Aspfs) rs886038017
NM_007294.3(BRCA1):c.3548_3549delAA (p.Lys1183Argfs) rs80357956
NM_007294.3(BRCA1):c.3549_3550delAG (p.Gly1184Argfs) rs730882057
NM_007294.3(BRCA1):c.3549_3550delAGinsT (p.Lys1183Asnfs) rs273899709
NM_007294.3(BRCA1):c.3553G>T (p.Glu1185Ter) rs397509081
NM_007294.3(BRCA1):c.355A>T (p.Lys119Ter) rs886040142
NM_007294.3(BRCA1):c.3564dup (p.Ser1189Glufs) rs886040143
NM_007294.3(BRCA1):c.3569_3570delCT (p.Pro1190Glnfs) rs80357845
NM_007294.3(BRCA1):c.3570delT (p.Ser1191Alafs) rs886038018
NM_007294.3(BRCA1):c.3571_3572ins4
NM_007294.3(BRCA1):c.3571delA (p.Ser1191Alafs) rs886040145
NM_007294.3(BRCA1):c.3576_3577insAA (p.Phe1193Asnfs) rs1555587476
NM_007294.3(BRCA1):c.3578dupT (p.Thr1194Hisfs) rs397509083
NM_007294.3(BRCA1):c.357_358delAGinsT (p.Lys119Asnfs) rs886040144
NM_007294.3(BRCA1):c.3580_3581insT (p.Thr1194Ilefs) rs1555587464
NM_007294.3(BRCA1):c.3580delA (p.Thr1194Profs) rs80357663
NM_007294.3(BRCA1):c.3582_3589delCCATACAC (p.His1195Phefs) rs886040146
NM_007294.3(BRCA1):c.3583_3590del (p.His1195Phefs) rs886040147
NM_007294.3(BRCA1):c.3583delC (p.His1195Ilefs) rs273900710
NM_007294.3(BRCA1):c.3586dupA (p.Thr1196Asnfs) rs80357531
NM_007294.3(BRCA1):c.3587dup (p.His1197Thrfs) rs886040148
NM_007294.3(BRCA1):c.3590delA (p.His1197Leufs) rs1555587442
NM_007294.3(BRCA1):c.3592_3593dupTT (p.Leu1198Phefs) rs80357562
NM_007294.3(BRCA1):c.3593T>A (p.Leu1198Ter) rs397509085
NM_007294.3(BRCA1):c.3596_3602delCTCAGGG (p.Ala1199Valfs) rs397509086
NM_007294.3(BRCA1):c.3598C>T (p.Gln1200Ter) rs62625307
NM_007294.3(BRCA1):c.3599_3600delAG (p.Gln1200Argfs) rs398122674
NM_007294.3(BRCA1):c.3604del (p.Tyr1202Thrfs) rs886040150
NM_007294.3(BRCA1):c.3605dup (p.Tyr1202Terfs) rs886040151
NM_007294.3(BRCA1):c.3607C>T (p.Arg1203Ter) rs62625308
NM_007294.3(BRCA1):c.3612delA (p.Ala1206Profs) rs80357980
NM_007294.3(BRCA1):c.3616delG (p.Ala1206Profs) rs886038019
NM_007294.3(BRCA1):c.3619A>T (p.Lys1207Ter) rs80357455
NM_007294.3(BRCA1):c.361dupG (p.Glu121Glyfs) rs886040152
NM_007294.3(BRCA1):c.3620dupA (p.Lys1208Glufs) rs80357926
NM_007294.3(BRCA1):c.3621_3626delGAAATTinsAA (p.Leu1209Serfs) rs397509087
NM_007294.3(BRCA1):c.3624delA (p.Lys1208Asnfs) rs80357512
NM_007294.3(BRCA1):c.3624dupA (p.Leu1209Ilefs) rs80357512
NM_007294.3(BRCA1):c.3625_3626insA (p.Leu1209Tyrfs) rs886040153
NM_007294.3(BRCA1):c.3626T>G (p.Leu1209Ter) rs786203884
NM_007294.3(BRCA1):c.3626delT (p.Leu1209Terfs) rs80357571
NM_007294.3(BRCA1):c.3626dupT (p.Leu1209Phefs) rs80357571
NM_007294.3(BRCA1):c.3627dupA (p.Glu1210Argfs) rs80357729
NM_007294.3(BRCA1):c.3628delG (p.Glu1210Serfs) rs397509090
NM_007294.3(BRCA1):c.3629_3630delAG (p.Glu1210Valfs) rs80357589
NM_007294.3(BRCA1):c.3629dupA (p.Ser1211Valfs) rs886040154
NM_007294.3(BRCA1):c.3631_3634del (p.Ser1211Glnfs) rs886040156
NM_007294.3(BRCA1):c.3635C>G (p.Ser1212Ter) rs886038021
NM_007294.3(BRCA1):c.3637G>T (p.Glu1213Ter) rs1135401864
NM_007294.3(BRCA1):c.3637delG (p.Glu1213Lysfs) rs1555587365
NM_007294.3(BRCA1):c.363_364del (p.Glu121Aspfs) rs886040155
NM_007294.3(BRCA1):c.3640G>T (p.Glu1214Ter) rs80356923
NM_007294.3(BRCA1):c.3642_3643delGA (p.Asn1215Leufs) rs80357805
NM_007294.3(BRCA1):c.3644_3648delACTTA (p.Asn1215Ilefs) rs1060505051
NM_007294.3(BRCA1):c.3647T>A (p.Leu1216Ter) rs397509091
NM_007294.3(BRCA1):c.3647T>G (p.Leu1216Ter) rs397509091
NM_007294.3(BRCA1):c.3648_3652delATCTA (p.Ser1217Terfs) rs1555587333
NM_007294.3(BRCA1):c.3648dupA (p.Ser1217Ilefs) rs80357902
NM_007294.3(BRCA1):c.3649_3650insA (p.Ser1217Tyrfs) rs80357831
NM_007294.3(BRCA1):c.3649dupT (p.Ser1217Phefs) rs1555587345
NM_007294.3(BRCA1):c.3650_3651insA (p.Ser1218Terfs) rs1555587337
NM_007294.3(BRCA1):c.3651dup (p.Ser1218Terfs) rs886040157
NM_007294.3(BRCA1):c.3658delG (p.Asp1220Metfs) rs786202963
NM_007294.3(BRCA1):c.3661G>T (p.Glu1221Ter) rs80357310
NM_007294.3(BRCA1):c.3664G>T (p.Glu1222Ter) rs80357356
NM_007294.3(BRCA1):c.3665_3666delAG (p.Glu1222Alafs) rs1555587316
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.3669del (p.Cys1225Alafs) rs886040158
NM_007294.3(BRCA1):c.3671_3672ins4
NM_007294.3(BRCA1):c.3672delC (p.Cys1225Alafs) rs398122677
NM_007294.3(BRCA1):c.3675C>A (p.Cys1225Ter) rs879254023
NM_007294.3(BRCA1):c.3676_3679delTTCC (p.Phe1226Asnfs) rs80357671
NM_007294.3(BRCA1):c.3679C>T (p.Gln1227Ter) rs886040159
NM_007294.3(BRCA1):c.3683delA (p.His1228Profs) rs397507217
NM_007294.3(BRCA1):c.3689T>G (p.Leu1230Ter) rs80357162
NM_007294.3(BRCA1):c.368delC (p.Ser123Leufs) rs431825397
NM_007294.3(BRCA1):c.3693dupT (p.Gly1232Trpfs) rs397509092
NM_007294.3(BRCA1):c.3695_3698delGTAA (p.Gly1232Glufs) rs397509093
NM_007294.3(BRCA1):c.3695delG (p.Gly1232Valfs) rs886038022
NM_007294.3(BRCA1):c.3697A>T (p.Lys1233Ter) rs774679104
NM_007294.3(BRCA1):c.3699delA (p.Val1234Terfs) rs80357873
NM_007294.3(BRCA1):c.36_39del (p.Asn13Serfs) rs886040149
NM_007294.3(BRCA1):c.3700_3704delGTAAA (p.Val1234Glnfs) rs80357609
NM_007294.3(BRCA1):c.3704_3707delACAA (p.Asn1235Ilefs) rs397509094
NM_007294.3(BRCA1):c.3704delA (p.Asn1235Thrfs) rs397509095
NM_007294.3(BRCA1):c.3705_3747dup (p.Glu1250Glnfs) rs797044631
NM_007294.3(BRCA1):c.3706_3707delAA (p.Asn1236Tyrfs) rs80357666
NM_007294.3(BRCA1):c.3706_3713delAATATACC (p.Asn1236Phefs) rs80357552
NM_007294.3(BRCA1):c.3710_3711dupTA (p.Pro1238Tyrfs) rs777371832
NM_007294.3(BRCA1):c.3710_3714delTACCT (p.Pro1238Serfs) rs1135401865
NM_007294.3(BRCA1):c.3710delT (p.Ile1237Asnfs) rs80357564
NM_007294.3(BRCA1):c.3714_3747delTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC (p.Gln1240Valfs) rs886038023
NM_007294.3(BRCA1):c.3715_3717delTCTinsC (p.Ser1239Profs) rs273900714
NM_007294.3(BRCA1):c.3715delT (p.Ser1239Leufs) rs397509096
NM_007294.3(BRCA1):c.3716dupC (p.Gln1240Serfs) rs397509097
NM_007294.3(BRCA1):c.3718C>T (p.Gln1240Ter) rs80356903
NM_007294.3(BRCA1):c.3722_3740del19 (p.Ser1241Leufs) rs80359882
NM_007294.3(BRCA1):c.3729_3730insGACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGG (p.His1244Aspfs) rs886040895
NM_007294.3(BRCA1):c.372del (p.Ile125Serfs) rs886040160
NM_007294.3(BRCA1):c.3730_3731insGACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGG (p.His1244Argfs) rs1555587210
NM_007294.3(BRCA1):c.3731_3738del (p.His1244Argfs) rs886040161
NM_007294.3(BRCA1):c.3731_3743del (p.His1244Leufs) rs886040162
NM_007294.3(BRCA1):c.3736delA (p.Thr1246Profs) rs80357578
NM_007294.3(BRCA1):c.3748G>T (p.Glu1250Ter) rs28897686
NM_007294.3(BRCA1):c.3748_3749insC (p.Glu1250Alafs) rs1555587165
NM_007294.3(BRCA1):c.3750del (p.Glu1250Aspfs) rs886040163
NM_007294.3(BRCA1):c.3753T>A (p.Cys1251Ter) rs397509098
NM_007294.3(BRCA1):c.3754_3755delCT (p.Leu1252Valfs) rs1135401866
NM_007294.3(BRCA1):c.3756_3757delGT (p.Ser1253Terfs) rs397509099
NM_007294.3(BRCA1):c.3756_3759delGTCT (p.Ser1253Argfs) rs80357868
NM_007294.3(BRCA1):c.3756_3760del (p.Ser1253Glufs) rs886040164
NM_007294.3(BRCA1):c.3758_3759delCT (p.Ser1253Terfs) rs1555587135
NM_007294.3(BRCA1):c.3759_3760delTA (p.Lys1254Glufs) rs80357520
NM_007294.3(BRCA1):c.3759delT (p.Lys1254Argfs) rs431825398
NM_007294.3(BRCA1):c.3759dupT (p.Lys1254Terfs) rs80357687
NM_007294.3(BRCA1):c.375_376insT (p.Gln126Serfs) rs397509101
NM_007294.3(BRCA1):c.3760_3761insT (p.Lys1254Ilefs) rs80357986
NM_007294.3(BRCA1):c.3761_3762insT (p.Lys1254Asnfs) rs80357928
NM_007294.3(BRCA1):c.3761_3762insTT (p.Lys1254Asnfs) rs80357928
NM_007294.3(BRCA1):c.3762_3763delGA (p.Asn1255Hisfs) rs80357645
NM_007294.3(BRCA1):c.3762_3763insTT (p.Asn1255Leufs) rs1555587113
NM_007294.3(BRCA1):c.3763_3764delAA (p.Asn1255Hisfs) rs397509103
NM_007294.3(BRCA1):c.3764dupA (p.Asn1255Lysfs) rs80357848
NM_007294.3(BRCA1):c.3765del (p.Asn1255Lysfs) rs886040165
NM_007294.3(BRCA1):c.3766dupA (p.Thr1256Asnfs) rs80357704
NM_007294.3(BRCA1):c.3767_3768delCA (p.Thr1256Argfs) rs730881440
NM_007294.3(BRCA1):c.376C>T (p.Gln126Ter) rs1085307902
NM_007294.3(BRCA1):c.376_377insT (p.Gln126Leufs) rs1555596382
NM_007294.3(BRCA1):c.3770_3771delAG (p.Glu1257Glyfs) rs80357579
NM_007294.3(BRCA1):c.3770_3777delAGGAGAAT (p.Glu1257Valfs) rs886038024
NM_007294.3(BRCA1):c.3771_3772delGG (p.Asn1259Phefs) rs80357810
NM_007294.3(BRCA1):c.3771_3772delGGinsC (p.Glu1257Aspfs) rs397507218
NM_007294.3(BRCA1):c.3771_3778delGGAGAATT (p.Glu1257Aspfs) rs397509104
NM_007294.3(BRCA1):c.3772G>T (p.Glu1258Ter) rs397509105
NM_007294.3(BRCA1):c.3772_3776delGAGAA (p.Glu1258Phefs) rs1135401867
NM_007294.3(BRCA1):c.3774_3775delGA (p.Asn1259Phefs) rs397509106
NM_007294.3(BRCA1):c.3778_3779insA (p.Leu1260Tyrfs) rs80357849
NM_007294.3(BRCA1):c.3779T>G (p.Leu1260Ter) rs886038025
NM_007294.3(BRCA1):c.3779delT (p.Leu1260Tyrfs) rs80357798
NM_007294.3(BRCA1):c.3780dup (p.Leu1261Ilefs) rs1555587063
NM_007294.3(BRCA1):c.3782T>G (p.Leu1261Ter) rs397507219
NM_007294.3(BRCA1):c.3782delT (p.Leu1261Tyrfs) rs80357545
NM_007294.3(BRCA1):c.3785C>A (p.Ser1262Ter) rs80357269
NM_007294.3(BRCA1):c.3794delA (p.Asn1265Ilefs) rs80357767
NM_007294.3(BRCA1):c.37_40delAATG (p.Asn13Serfs) rs80357530
NM_007294.3(BRCA1):c.3800T>G (p.Leu1267Ter) rs587782190
NM_007294.3(BRCA1):c.3810C>A (p.Cys1270Ter) rs886040166
NM_007294.3(BRCA1):c.3813dupT (p.Asn1272Terfs) rs397509108
NM_007294.3(BRCA1):c.3814_3815insT (p.Asn1272Ilefs) rs397509109
NM_007294.3(BRCA1):c.3815_3816insT (p.Gln1273Profs) rs1555587013
NM_007294.3(BRCA1):c.3817C>T (p.Gln1273Ter) rs80357208
NM_007294.3(BRCA1):c.3819_3823delGGTAA (p.Gln1273Hisfs) rs886037785
NM_007294.3(BRCA1):c.3820delG (p.Val1274Terfs) rs80357616
NM_007294.3(BRCA1):c.3820dupG (p.Val1274Glyfs) rs80357616
NM_007294.3(BRCA1):c.3821dup (p.Ile1275Asnfs) rs886040167
NM_007294.3(BRCA1):c.3824dup (p.Leu1276Ilefs) rs1555586989
NM_007294.3(BRCA1):c.3825dupA (p.Leu1276Ilefs) rs397507220
NM_007294.3(BRCA1):c.3830dupC (p.Ala1279Glyfs) rs80357878
NM_007294.3(BRCA1):c.3833delA (p.Lys1278Argfs) rs1135401868
NM_007294.3(BRCA1):c.3835delG (p.Ala1279Hisfs) rs1060505047
NM_007294.3(BRCA1):c.3837_3840del (p.Ser1280Argfs) rs886040168
NM_007294.3(BRCA1):c.3839_3843del (p.Ser1280Terfs) rs886040169
NM_007294.3(BRCA1):c.3839_3843delCTCAGins4
NM_007294.3(BRCA1):c.3839_3843delCTCAGinsAGGC (p.Ser1280Terfs) rs273900717
NM_007294.3(BRCA1):c.3840_3850del (p.Gln1281Profs) rs886040170
NM_007294.3(BRCA1):c.3841C>T (p.Gln1281Ter) rs80356866
NM_007294.3(BRCA1):c.3841_3842delCA (p.Gln1281Glyfs) rs80357584
NM_007294.3(BRCA1):c.3844delG (p.Glu1282Asnfs) rs397509113
NM_007294.3(BRCA1):c.3851_3852dupAC (p.Leu1285Thrfs) rs397507221
NM_007294.3(BRCA1):c.3853delC (p.Ser1286Valfs) rs397507222
NM_007294.3(BRCA1):c.3856delA (p.Ser1286Valfs) rs80357855
NM_007294.3(BRCA1):c.3858_3861delTGAG (p.Ser1286Argfs) rs80357842
NM_007294.3(BRCA1):c.385_386delGGinsC (p.Gly129Profs) rs886040171
NM_007294.3(BRCA1):c.3862G>T (p.Glu1288Ter) rs876659708
NM_007294.3(BRCA1):c.3862delG (p.Glu1288Lysfs) rs273900718
NM_007294.3(BRCA1):c.3867_3871delAAAAT (p.Lys1290Phefs) rs80357560
NM_007294.3(BRCA1):c.3868A>T (p.Lys1290Ter) rs80357254
NM_007294.3(BRCA1):c.3869_3870delAA (p.Lys1290Metfs) rs80357918
NM_007294.3(BRCA1):c.386delG (p.Gly129Alafs) rs1135401836
NM_007294.3(BRCA1):c.3871_3872insC (p.Cys1291Serfs) rs397509114
NM_007294.3(BRCA1):c.3872_3873insC (p.Ser1292Phefs) rs1555586891
NM_007294.3(BRCA1):c.3874delT (p.Ser1292Leufs) rs587780802
NM_007294.3(BRCA1):c.3876delT (p.Ala1293Leufs) rs397509115
NM_007294.3(BRCA1):c.3880_3883delAGCT (p.Ser1294Cysfs) rs397509116
NM_007294.3(BRCA1):c.3885del (p.Leu1295Phefs) rs886040172
NM_007294.3(BRCA1):c.3889delT (p.Ser1297Leufs) rs886038027
NM_007294.3(BRCA1):c.3893C>A (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3893C>G (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3895C>T (p.Gln1299Ter) rs80357038
NM_007294.3(BRCA1):c.3901_3902delAG (p.Ser1301Terfs) rs80357646
NM_007294.3(BRCA1):c.3904G>T (p.Glu1302Ter) rs80357461
NM_007294.3(BRCA1):c.3907_3908delTTinsGGA (p.Leu1303Glyfs) rs80357634
NM_007294.3(BRCA1):c.3908_3909dup (p.Glu1304Trpfs) rs886040174
NM_007294.3(BRCA1):c.3908dupT (p.Leu1303Phefs) rs80357634
NM_007294.3(BRCA1):c.390C>A (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.390C>G (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.3910G>T (p.Glu1304Ter) rs886038028
NM_007294.3(BRCA1):c.3910delG (p.Glu1304Lysfs) rs397509117
NM_007294.3(BRCA1):c.3914delA (p.Asp1305Alafs) rs397509118
NM_007294.3(BRCA1):c.3916_3917delTT (p.Leu1306Aspfs) rs80357678
NM_007294.3(BRCA1):c.3917del (p.Leu1306Terfs) rs886040175
NM_007294.3(BRCA1):c.391A>T (p.Arg131Ter) rs80357207
NM_007294.3(BRCA1):c.3926delA (p.Asn1309Ilefs) rs397509119
NM_007294.3(BRCA1):c.3927_3930delTACA (p.Asn1309Lysfs) rs397509120
NM_007294.3(BRCA1):c.3928dupA (p.Thr1310Asnfs) rs886040176
NM_007294.3(BRCA1):c.3931_3934delAACA (p.Asn1311Profs) rs80357864
NM_007294.3(BRCA1):c.3931_3934dupAACA (p.Thr1312Lysfs) rs80357864
NM_007294.3(BRCA1):c.3932delA (p.Asn1311Thrfs) rs80357504
NM_007294.3(BRCA1):c.3937C>T (p.Gln1313Ter) rs80357318
NM_007294.3(BRCA1):c.3947_3950del (p.Phe1316Terfs) rs886040177
NM_007294.3(BRCA1):c.3952_3955del (p.Ile1318Valfs) rs886040178
NM_007294.3(BRCA1):c.3954delT (p.Ile1318Metfs) rs1135401870
NM_007294.3(BRCA1):c.3956_3957delGT (p.Gly1319Valfs) rs1135401871
NM_007294.3(BRCA1):c.3959del (p.Ser1320Phefs) rs886040179
NM_007294.3(BRCA1):c.3961del (p.Ser1321Profs) rs886040180
NM_007294.3(BRCA1):c.3964A>T (p.Lys1322Ter) rs80357343
NM_007294.3(BRCA1):c.3966delA (p.Lys1322Asnfs) rs80357979
NM_007294.3(BRCA1):c.3967C>T (p.Gln1323Ter) rs80357262
NM_007294.3(BRCA1):c.3967delC (p.Gln1323Lysfs) rs397509122
NM_007294.3(BRCA1):c.3968_3971delAAAT (p.Gln1323Argfs) rs886040181
NM_007294.3(BRCA1):c.3969_3970delAA (p.Gln1323Hisfs) rs587782834
NM_007294.3(BRCA1):c.3972_3974delGAGinsAA (p.Met1324Ilefs) rs886040182
NM_007294.3(BRCA1):c.3972delG (p.Met1324Ilefs) rs80357987
NM_007294.3(BRCA1):c.3973delA (p.Arg1325Glyfs) rs80357904
NM_007294.3(BRCA1):c.3979C>T (p.Gln1327Ter) rs876659720
NM_007294.3(BRCA1):c.397delC (p.Arg133Valfs) rs886037973
NM_007294.3(BRCA1):c.3981delG (p.Gln1327Hisfs) rs397509123
NM_007294.3(BRCA1):c.3982dupT (p.Ser1328Phefs) rs397509124
NM_007294.3(BRCA1):c.3985_3987delGAAinsTTTC (p.Glu1329Phefs) rs886040183
NM_007294.3(BRCA1):c.3990_3993del (p.Ser1330Argfs) rs886040184
NM_007294.3(BRCA1):c.3991C>T (p.Gln1331Ter) rs397507224
NM_007294.3(BRCA1):c.3995_4001delGAGTTGG (p.Gly1332Valfs) rs886040185
NM_007294.3(BRCA1):c.3999_4008delTGGTCTGAGT (p.Gly1334Thrfs) rs754792932
NM_007294.3(BRCA1):c.3999delT (p.Gly1334Valfs) rs397509125
NM_007294.3(BRCA1):c.399_400delTG (p.Ala134Glnfs) rs80357568
NM_007294.3(BRCA1):c.3G>C (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.3G>T (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.4001delG (p.Gly1334Valfs) rs397509127
NM_007294.3(BRCA1):c.4002_4005delTCTG (p.Leu1335Valfs) rs397509128
NM_007294.3(BRCA1):c.4013delA (p.Lys1338Argfs) rs886038029
NM_007294.3(BRCA1):c.4015G>T (p.Glu1339Ter) rs80357021
NM_007294.3(BRCA1):c.4015dupG (p.Glu1339Glyfs) rs886038030
NM_007294.3(BRCA1):c.4016_4017insTT (p.Glu1339Aspfs) rs886040187
NM_007294.3(BRCA1):c.4018_4019dup (p.Leu1340Phefs) rs1555586639
NM_007294.3(BRCA1):c.4033G>T (p.Glu1345Ter) rs886040188
NM_007294.3(BRCA1):c.4035delA (p.Glu1346Lysfs) rs80357711
NM_007294.3(BRCA1):c.4036delG (p.Glu1346Lysfs) rs886040189
NM_007294.3(BRCA1):c.4038_4039delAA (p.Gly1348Asnfs) rs273900721
NM_007294.3(BRCA1):c.4038_4041delAAGA (p.Arg1347Glufs) rs431825404
NM_007294.3(BRCA1):c.4039dup (p.Arg1347Lysfs) rs273900721
NM_007294.3(BRCA1):c.403A>T (p.Lys135Ter) rs879255485
NM_007294.3(BRCA1):c.4041_4042delAG (p.Gly1348Asnfs) rs80357727
NM_007294.3(BRCA1):c.4042G>T (p.Gly1348Ter) rs886040191
NM_007294.3(BRCA1):c.4043delG (p.Gly1348Glufs) rs397509130
NM_007294.3(BRCA1):c.4049dupG (p.Glu1352Glyfs) rs397509131
NM_007294.3(BRCA1):c.4050_4051insG (p.Leu1351Valfs) rs483353092
NM_007294.3(BRCA1):c.4051_4052insG (p.Leu1351Cysfs) rs1555586564
NM_007294.3(BRCA1):c.4052T>A (p.Leu1351Ter) rs397509132
NM_007294.3(BRCA1):c.4052dupT (p.Leu1351Phefs) rs80357779
NM_007294.3(BRCA1):c.4054G>T (p.Glu1352Ter) rs80357202
NM_007294.3(BRCA1):c.4057G>T (p.Glu1353Ter) rs80357178
NM_007294.3(BRCA1):c.4057_4061delGAAAA (p.Glu1353Terfs) rs397509133
NM_007294.3(BRCA1):c.4062_4065delTAAT (p.Asn1355Lysfs) rs398122679
NM_007294.3(BRCA1):c.4062_4066del (p.Asn1354Lysfs) rs886040192
NM_007294.3(BRCA1):c.4062_4068delTAATCAA (p.Asn1354Lysfs) rs397509134
NM_007294.3(BRCA1):c.4064_4066delATCinsT (p.Asn1355Ilefs) rs1060502345
NM_007294.3(BRCA1):c.4065_4068delTCAA (p.Asn1355Lysfs) rs80357508
NM_007294.3(BRCA1):c.4066C>T (p.Gln1356Ter) rs886040193
NM_007294.3(BRCA1):c.4066_4069delCAAG (p.Gln1356Lysfs) rs397509135
NM_007294.3(BRCA1):c.4066del (p.Gln1356Lysfs) rs886040194
NM_007294.3(BRCA1):c.4069G>T (p.Glu1357Ter) rs886040195
NM_007294.3(BRCA1):c.406del (p.Arg136Aspfs) rs80357709
NM_007294.3(BRCA1):c.406dupA (p.Arg136Lysfs) rs80357709
NM_007294.3(BRCA1):c.4070_4071insTTGA (p.Glu1357Aspfs) rs1555586517
NM_007294.3(BRCA1):c.4071del (p.Glu1358Serfs) rs886040197
NM_007294.3(BRCA1):c.4072G>T (p.Glu1358Ter) rs397509136
NM_007294.3(BRCA1):c.4074_4090del (p.Gln1359Leufs) rs886040198
NM_007294.3(BRCA1):c.4075C>T (p.Gln1359Ter) rs80357456
NM_007294.3(BRCA1):c.4079del (p.Ser1360Thrfs) rs886040199
NM_007294.3(BRCA1):c.407delG (p.Arg136Asnfs) rs886040200
NM_007294.3(BRCA1):c.4085delA (p.Asp1362Valfs) rs80357737
NM_007294.3(BRCA1):c.4088C>A (p.Ser1363Ter) rs398122680
NM_007294.3(BRCA1):c.4088C>G (p.Ser1363Ter) rs398122680
NM_007294.3(BRCA1):c.4092_4093delCT (p.Leu1365Argfs) rs397509137
NM_007294.3(BRCA1):c.4094T>G (p.Leu1365Ter) rs398122681
NM_007294.3(BRCA1):c.4094delT (p.Leu1365Terfs) rs397509138
NM_007294.3(BRCA1):c.4096+1G>A rs80358178
NM_007294.3(BRCA1):c.4097-1G>A rs80358070
NM_007294.3(BRCA1):c.4097-2A>G rs80358019
NM_007294.3(BRCA1):c.4097-78_4185+69del rs1555586010
NM_007294.3(BRCA1):c.4099G>T (p.Glu1367Ter) rs786202998
NM_007294.3(BRCA1):c.40_41del (p.Val14Hisfs) rs886040186
NM_007294.3(BRCA1):c.40del (p.Val14Serfs) rs886040201
NM_007294.3(BRCA1):c.4107_4108insATCT (p.Ser1370Ilefs) rs886040202
NM_007294.3(BRCA1):c.4107_4110dupATCT (p.Gly1371Ilefs) rs397509139
NM_007294.3(BRCA1):c.4108_4109insATCT (p.Ser1370Tyrfs) rs1555586260
NM_007294.3(BRCA1):c.4110_4111delTG (p.Gly1371Valfs) rs80357529
NM_007294.3(BRCA1):c.4111_4112insATCT (p.Gly1371Aspfs) rs80357935
NM_007294.3(BRCA1):c.4112_4113insATCT (p.Cys1372Serfs) rs1555586240
NM_007294.3(BRCA1):c.4113delG (p.Cys1372Valfs) rs80357861
NM_007294.3(BRCA1):c.4116T>A (p.Cys1372Ter) rs397509140
NM_007294.3(BRCA1):c.4116_4117delTG (p.Cys1372Terfs) rs80357804
NM_007294.3(BRCA1):c.4116_4117insTT (p.Glu1373Leufs) rs398122682
NM_007294.3(BRCA1):c.4116del (p.Cys1372Trpfs) rs886040204
NM_007294.3(BRCA1):c.4117G>T (p.Glu1373Ter) rs80357259
NM_007294.3(BRCA1):c.4117_4118insTT (p.Glu1373Valfs) rs1555586212
NM_007294.3(BRCA1):c.411_414del (p.Leu138Argfs) rs886040203
NM_007294.3(BRCA1):c.411del (p.Leu138Tyrfs) rs886040205
NM_007294.3(BRCA1):c.411dup (p.Leu138Serfs) rs886040205
NM_007294.3(BRCA1):c.4120_4121delAG (p.Ser1374Terfs) rs80357787
NM_007294.3(BRCA1):c.4122_4123delTG (p.Ser1374Argfs) rs80357691
NM_007294.3(BRCA1):c.4123G>T (p.Glu1375Ter) rs80357397
NM_007294.3(BRCA1):c.4126_4129del (p.Thr1376Alafs) rs886040206
NM_007294.3(BRCA1):c.4127del (p.Thr1376Lysfs) rs886040207
NM_007294.3(BRCA1):c.4128_4129delAA (p.Ser1377Argfs) rs80357921
NM_007294.3(BRCA1):c.4129del (p.Ser1377Alafs) rs886040208
NM_007294.3(BRCA1):c.412_418delCTACAGA (p.Leu138Valfs) rs80357816
NM_007294.3(BRCA1):c.4136_4137delCT (p.Ser1379Terfs) rs397509141
NM_007294.3(BRCA1):c.4137_4138del (p.Glu1380Argfs) rs886040209
NM_007294.3(BRCA1):c.4137delT (p.Glu1380Lysfs) rs1064793746
NM_007294.3(BRCA1):c.4139_4140delAA (p.Glu1380Glyfs) rs886038032
NM_007294.3(BRCA1):c.4146C>A (p.Cys1382Ter) rs1057517574
NM_007294.3(BRCA1):c.4146_4155dupCTCAGGGCTA (p.Ser1386Leufs) rs483353079
NM_007294.3(BRCA1):c.4148C>G (p.Ser1383Ter) rs80357071
NM_007294.3(BRCA1):c.4155_4156ins10 (p.?)
NM_007294.3(BRCA1):c.4158_4162delCTCTC (p.Ser1387Glufs) rs397509142
NM_007294.3(BRCA1):c.415C>T (p.Gln139Ter) rs80357372
NM_007294.3(BRCA1):c.4161_4162delTC (p.Gln1388Glufs) rs80357565
NM_007294.3(BRCA1):c.4162C>T (p.Gln1388Ter) rs876660601
NM_007294.3(BRCA1):c.4162_4163del (p.Gln1388Glufs) rs886040210
NM_007294.3(BRCA1):c.4163_4166delAGAG (p.Gln1388Leufs) rs80357532
NM_007294.3(BRCA1):c.4163dupA (p.Ser1389Glufs) rs80357788
NM_007294.3(BRCA1):c.4165_4166delAG (p.Ser1389Terfs) rs80357572
NM_007294.3(BRCA1):c.4165_4166dupAG (p.Ser1389Argfs) rs80357572
NM_007294.3(BRCA1):c.4167_4168delTG (p.Ser1389Argfs) rs397509144
NM_007294.3(BRCA1):c.4167_4168insAG (p.Asp1390Argfs) rs80357847
NM_007294.3(BRCA1):c.4167_4170delTGAC (p.Ser1389Argfs) rs80357538
NM_007294.3(BRCA1):c.4167delT (p.Ser1389Argfs) rs397509145
NM_007294.3(BRCA1):c.4168_4169delGA (p.Asp1390Hisfs) rs1555586103
NM_007294.3(BRCA1):c.4168_4169dup (p.Asp1390Glufs) rs1555586100
NM_007294.3(BRCA1):c.416dupA (p.Ser140Glufs) rs786203432
NM_007294.3(BRCA1):c.4175del (p.Leu1392Terfs) rs886040211
NM_007294.3(BRCA1):c.4182_4183dupTC (p.Gln1395Leufs) rs80357742
NM_007294.3(BRCA1):c.4183C>T (p.Gln1395Ter) rs80357260
NM_007294.3(BRCA1):c.4185+1G>A rs80358076
NM_007294.3(BRCA1):c.4185+1G>T rs80358076
NM_007294.3(BRCA1):c.4185+1delG
NM_007294.3(BRCA1):c.4185+2T>A rs431825406
NM_007294.3(BRCA1):c.4185+2T>C rs431825406
NM_007294.3(BRCA1):c.4185+2_4185+22del21insA rs273900724
NM_007294.3(BRCA1):c.4185G>A (p.Gln1395=) rs80356857
NM_007294.3(BRCA1):c.4185_4185+3delGGTA rs397509149
NM_007294.3(BRCA1):c.4186-1643_4357+2020del
NM_007294.3(BRCA1):c.4186-1787_4357+4122dup
NM_007294.3(BRCA1):c.4186-832_4357+1955del
NM_007294.3(BRCA1):c.4186-?_4357+?del
NM_007294.3(BRCA1):c.4186-?_4357+?dup172
NM_007294.3(BRCA1):c.4186-?_4484+?del
NM_007294.3(BRCA1):c.4186-?_4675+?del
NM_007294.3(BRCA1):c.4186-?_5193+?del
NM_007294.3(BRCA1):c.4186-?_5277+?del
NM_007294.3(BRCA1):c.4186C>T (p.Gln1396Ter) rs80357011
NM_007294.3(BRCA1):c.418dup (p.Ser140Lysfs) rs886040212
NM_007294.3(BRCA1):c.4193_4194insGG (p.Asp1398Glufs) rs886038033
NM_007294.3(BRCA1):c.4194_4195insGG (p.Thr1399Glyfs) rs1555584262
NM_007294.3(BRCA1):c.4195_4196delAC (p.Thr1399Hisfs) rs80357649
NM_007294.3(BRCA1):c.4197del (p.Met1400Cysfs) rs886040213
NM_007294.3(BRCA1):c.4201C>T (p.Gln1401Ter) rs397509151
NM_007294.3(BRCA1):c.4205del (p.His1402Leufs) rs886040214
NM_007294.3(BRCA1):c.4206_4207del (p.His1402Glnfs) rs886040215
NM_007294.3(BRCA1):c.4210delC (p.Leu1404Terfs) rs80357765
NM_007294.3(BRCA1):c.4214delT (p.Ile1405Lysfs) rs273900728
NM_007294.3(BRCA1):c.4216A>T (p.Lys1406Ter) rs886040216
NM_007294.3(BRCA1):c.4218del (p.Lys1406Asnfs) rs886040217
NM_007294.3(BRCA1):c.4222C>T (p.Gln1408Ter) rs80356989
NM_007294.3(BRCA1):c.4225C>T (p.Gln1409Ter) rs886040218
NM_007294.3(BRCA1):c.4228G>T (p.Glu1410Ter) rs397509152
NM_007294.3(BRCA1):c.4237G>T (p.Glu1413Ter) rs397509153
NM_007294.3(BRCA1):c.4239del (p.Glu1413Aspfs) rs886040219
NM_007294.3(BRCA1):c.4240dupC (p.Leu1414Profs) rs397509154
NM_007294.3(BRCA1):c.4243G>T (p.Glu1415Ter) rs1057519558
NM_007294.3(BRCA1):c.4243_4244insT (p.Glu1415Valfs) rs1555584178
NM_007294.3(BRCA1):c.4243delG (p.Glu1415Lysfs) rs80357981
NM_007294.3(BRCA1):c.4250delT (p.Val1417Glyfs) rs587782879
NM_007294.3(BRCA1):c.4251_4252delGT (p.Leu1418Argfs) rs80357977
NM_007294.3(BRCA1):c.4253T>G (p.Leu1418Ter) rs397509157
NM_007294.3(BRCA1):c.4255G>T (p.Glu1419Ter) rs80357309
NM_007294.3(BRCA1):c.4258C>T (p.Gln1420Ter) rs80357305
NM_007294.3(BRCA1):c.4266delG (p.Ser1423Alafs) rs397509158
NM_007294.3(BRCA1):c.4266dupG (p.Ser1423Glufs) rs397509158
NM_007294.3(BRCA1):c.4270C>T (p.Gln1424Ter) rs886040220
NM_007294.3(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.3(BRCA1):c.4281_4282insTAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAAC (p.Ser1428_Arg1762delinsTer) rs886040896
NM_007294.3(BRCA1):c.4282_4283delAG (p.Ser1428Leufs) rs397509159
NM_007294.3(BRCA1):c.4284_4285delCTinsG (p.Ser1428Argfs) rs886040221
NM_007294.3(BRCA1):c.4284_4285insG (p.Tyr1429Valfs) rs1555584122
NM_007294.3(BRCA1):c.4285_4286insG (p.Tyr1429Terfs) rs80357716
NM_007294.3(BRCA1):c.4285dup (p.Tyr1429Leufs) rs1555584118
NM_007294.3(BRCA1):c.4286_4287insG (p.Tyr1429Terfs) rs1555584110
NM_007294.3(BRCA1):c.4287C>A (p.Tyr1429Ter) rs397509160
NM_007294.3(BRCA1):c.4289dupC (p.Ser1431Phefs) rs80357556
NM_007294.3(BRCA1):c.4290_4296del (p.Ser1431Terfs) rs886040222
NM_007294.3(BRCA1):c.4300dupA (p.Ser1434Lysfs) rs80357790
NM_007294.3(BRCA1):c.4307_4308delCT (p.Ser1436Phefs) rs397509161
NM_007294.3(BRCA1):c.4309del (p.Ser1437Leufs) rs886040223
NM_007294.3(BRCA1):c.4310delC (p.Ser1437Leufs) rs1135401874
NM_007294.3(BRCA1):c.431delA (p.Asn144Ilefs) rs397509162
NM_007294.3(BRCA1):c.431dup (p.Asn144Lysfs) rs397509162
NM_007294.3(BRCA1):c.4321dupG (p.Asp1441Glyfs) rs80357748
NM_007294.3(BRCA1):c.4327C>G (p.Arg1443Gly) rs41293455
NM_007294.3(BRCA1):c.4327C>T (p.Arg1443Ter) rs41293455
NM_007294.3(BRCA1):c.4331_4332delAT (p.Asn1444Thrfs) rs397509163
NM_007294.3(BRCA1):c.4331_4338delATCCAGAA (p.Asn1444Thrfs) rs80357825
NM_007294.3(BRCA1):c.4335_4338dupAGAA (p.Gln1447Argfs) rs397509164
NM_007294.3(BRCA1):c.4338_4339ins4
NM_007294.3(BRCA1):c.4339C>T (p.Gln1447Ter) rs80357067
NM_007294.3(BRCA1):c.4342dup (p.Ser1448Lysfs) rs886040225
NM_007294.3(BRCA1):c.4348delT (p.Ser1450Glnfs) rs1135401932
NM_007294.3(BRCA1):c.4348dupT (p.Ser1450Phefs) rs80357548
NM_007294.3(BRCA1):c.4349C>G (p.Ser1450Ter) rs886040226
NM_007294.3(BRCA1):c.4354A>T (p.Lys1452Ter) rs398122685
NM_007294.3(BRCA1):c.4357+1G>A rs80358027
NM_007294.3(BRCA1):c.4357+1G>C rs80358027
NM_007294.3(BRCA1):c.4357+1G>T rs80358027
NM_007294.3(BRCA1):c.4357+1_4357+10del rs886040907
NM_007294.3(BRCA1):c.4357+1delG rs397509165
NM_007294.3(BRCA1):c.4357+2T>C rs80358152
NM_007294.3(BRCA1):c.4357+2T>G rs80358152
NM_007294.3(BRCA1):c.4357+6T>C rs80358143
NM_007294.3(BRCA1):c.4358-?_4484+?del
NM_007294.3(BRCA1):c.4358-?_4484+?dup
NM_007294.3(BRCA1):c.4358-?_4986+?del
NM_007294.3(BRCA1):c.4358-?_4986+?dup
NM_007294.3(BRCA1):c.4358-?_5074+?del
NM_007294.3(BRCA1):c.4358-?_5193+?del
NM_007294.3(BRCA1):c.4358-?_5277+?del
NM_007294.3(BRCA1):c.4358_4484del127 (p.Ala1453Glyfs) rs1555582530
NM_007294.3(BRCA1):c.4364T>G (p.Leu1455Ter) rs886040227
NM_007294.3(BRCA1):c.4370C>A (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4370C>G (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4372C>T (p.Gln1458Ter) rs80356932
NM_007294.3(BRCA1):c.4372_4373delCA (p.Gln1458Glufs) rs879255317
NM_007294.3(BRCA1):c.4373_4389del17 (p.Gln1458Profs) rs80359885
NM_007294.3(BRCA1):c.4375A>T (p.Lys1459Ter) rs886040228
NM_007294.3(BRCA1):c.4379delG (p.Ser1460Ilefs) rs786203149
NM_007294.3(BRCA1):c.437_440delCCTT (p.Ser146Cysfs) rs397509168
NM_007294.3(BRCA1):c.4386dupA (p.Tyr1463Ilefs) rs786204267
NM_007294.3(BRCA1):c.4387delT (p.Tyr1463Thrfs) rs397507229
NM_007294.3(BRCA1):c.4388_4389ins7
NM_007294.3(BRCA1):c.4389C>A (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4389C>G (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4389_4392dupCCCT (p.Ile1465Profs) rs879255282
NM_007294.3(BRCA1):c.438_439ins25 (p.?)
NM_007294.3(BRCA1):c.4391_4393delCTAinsTT (p.Pro1464Leufs) rs273900730
NM_007294.3(BRCA1):c.4391_4403delCTATAAGCCAGAAinsTT (p.Pro1464Leufs) rs273900731
NM_007294.3(BRCA1):c.4391delC (p.Pro1464Leufs) rs80357916
NM_007294.3(BRCA1):c.4391dupC (p.Ile1465Tyrfs) rs80357916
NM_007294.3(BRCA1):c.4392delT (p.Ile1465Terfs) rs1064793577
NM_007294.3(BRCA1):c.4393delA (p.Ile1465Terfs) rs397507230
NM_007294.3(BRCA1):c.4394dup (p.Ser1466Lysfs) rs1555582670
NM_007294.3(BRCA1):c.4397_4398insA (p.Ser1466Argfs) rs886040229
NM_007294.3(BRCA1):c.4398_4399insA (p.Gln1467Thrfs) rs1555582663
NM_007294.3(BRCA1):c.4399C>T (p.Gln1467Ter) rs397509171
NM_007294.3(BRCA1):c.4401delG (p.Asn1468Ilefs) rs587781611
NM_007294.3(BRCA1):c.4408G>T (p.Glu1470Ter) rs886040230
NM_007294.3(BRCA1):c.441+1G>A rs397509172
NM_007294.3(BRCA1):c.441+2T>G rs397509173
NM_007294.3(BRCA1):c.4412delG (p.Gly1471Alafs) rs1064793951
NM_007294.3(BRCA1):c.4416_4417delTTinsG (p.Ser1473Leufs) rs397509174
NM_007294.3(BRCA1):c.4417del (p.Ser1473Leufs) rs886040231
NM_007294.3(BRCA1):c.442-1129_547+223del
NM_007294.3(BRCA1):c.442-2A>C rs80358155
NM_007294.3(BRCA1):c.442-7T>A rs886040909
NM_007294.3(BRCA1):c.442-952_547dup
NM_007294.3(BRCA1):c.442-?_4185+?del
NM_007294.3(BRCA1):c.442-?_4357+?del
NM_007294.3(BRCA1):c.442-?_5277+?dup
NM_007294.3(BRCA1):c.442-?_5467+?del
NM_007294.3(BRCA1):c.442-?_547+?del
NM_007294.3(BRCA1):c.442-?_547+?dup
NM_007294.3(BRCA1):c.442-?_593+?del
NM_007294.3(BRCA1):c.442-?_670+?del
NM_007294.3(BRCA1):c.4427dupA (p.Phe1477Valfs) rs397507231
NM_007294.3(BRCA1):c.4432G>T (p.Glu1478Ter) rs876659878
NM_007294.3(BRCA1):c.4435delG (p.Val1479Cysfs) rs397509176
NM_007294.3(BRCA1):c.4447delA (p.Ser1483Valfs) rs397509177
NM_007294.3(BRCA1):c.4450_4451ins4
NM_007294.3(BRCA1):c.4452_4455delTACC (p.Thr1485Valfs) rs397509178
NM_007294.3(BRCA1):c.4453_4474del (p.Thr1485Glufs) rs886040232
NM_007294.3(BRCA1):c.4456delA (p.Ser1486Valfs) rs397509179
NM_007294.3(BRCA1):c.4457delG (p.Ser1486Ilefs) rs397509180
NM_007294.3(BRCA1):c.445G>T (p.Glu149Ter) rs876658381
NM_007294.3(BRCA1):c.445delG (p.Glu149Lysfs) rs1060502327
NM_007294.3(BRCA1):c.4463dupA (p.Asn1488Lysfs) rs80357620
NM_007294.3(BRCA1):c.4468G>T (p.Glu1490Ter) rs138608489
NM_007294.3(BRCA1):c.4474G>T (p.Gly1492Ter) rs863224511
NM_007294.3(BRCA1):c.4480G>T (p.Glu1494Ter) rs80357148
NM_007294.3(BRCA1):c.4482_4483delAA (p.Arg1495Valfs) rs80357854
NM_007294.3(BRCA1):c.4483delA (p.Arg1495Glyfs) rs80357854
NM_007294.3(BRCA1):c.4484+1G>A rs80358063
NM_007294.3(BRCA1):c.4484+1G>T rs80358063
NM_007294.3(BRCA1):c.4484+1delG rs397509181
NM_007294.3(BRCA1):c.4484+5G>C rs886040910
NM_007294.3(BRCA1):c.4484G>A (p.Arg1495Lys) rs80357389
NM_007294.3(BRCA1):c.4484G>C (p.Arg1495Thr) rs80357389
NM_007294.3(BRCA1):c.4484G>T (p.Arg1495Met) rs80357389
NM_007294.3(BRCA1):c.4485-1G>A rs80358189
NM_007294.3(BRCA1):c.4485-1G>C rs80358189
NM_007294.3(BRCA1):c.4485-1G>T rs80358189
NM_007294.3(BRCA1):c.4485-2A>G rs80358054
NM_007294.3(BRCA1):c.4485-?_4675+?del
NM_007294.3(BRCA1):c.4485-?_4675+?dup
NM_007294.3(BRCA1):c.4485-?_4986+?del
NM_007294.3(BRCA1):c.4485-?_5074+?del
NM_007294.3(BRCA1):c.4487C>A (p.Ser1496Ter) rs80356953
NM_007294.3(BRCA1):c.4487C>G (p.Ser1496Ter) rs80356953
NM_007294.3(BRCA1):c.4493delC (p.Pro1498Leufs) rs398122687
NM_007294.3(BRCA1):c.4503C>A (p.Cys1501Ter) rs747539984
NM_007294.3(BRCA1):c.4507_4511delTCATT (p.Ser1503Argfs) rs1135401877
NM_007294.3(BRCA1):c.4508C>A (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4508C>G (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4516delG (p.Asp1506Ilefs) rs273900736
NM_007294.3(BRCA1):c.4523G>A (p.Trp1508Ter) rs786202631
NM_007294.3(BRCA1):c.4523_4526delGGTAinsTGCCCATCATTAGATGAG (p.Trp1508Leufs) rs1064794004
NM_007294.3(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.3(BRCA1):c.4527C>A (p.Tyr1509Ter) rs886040233
NM_007294.3(BRCA1):c.4528delA (p.Met1510Cysfs) rs397509182
NM_007294.3(BRCA1):c.4532dup (p.His1511Glnfs) rs1555582009
NM_007294.3(BRCA1):c.4533_4534delCA (p.His1511Glnfs) rs80357534
NM_007294.3(BRCA1):c.4534_4535delAG (p.Ser1512Leufs) rs397509183
NM_007294.3(BRCA1):c.4552C>T (p.Gln1518Ter) rs80356881
NM_007294.3(BRCA1):c.4566C>A (p.Tyr1522Ter) rs886040234
NM_007294.3(BRCA1):c.4566C>G (p.Tyr1522Ter) rs886040234
NM_007294.3(BRCA1):c.4569_4570insCC (p.Ser1524Profs) rs886040235
NM_007294.3(BRCA1):c.4569_4572del (p.Ser1524Lysfs) rs886040236
NM_007294.3(BRCA1):c.456_457delCA (p.Ser153Cysfs) rs80357882
NM_007294.3(BRCA1):c.456delC (p.Ser153Valfs) rs876659830
NM_007294.3(BRCA1):c.4570delT (p.Ser1524Leufs) rs878853293
NM_007294.3(BRCA1):c.4571_4572insCC (p.Gln1525Leufs) rs1555581948
NM_007294.3(BRCA1):c.4573C>T (p.Gln1525Ter) rs886040237
NM_007294.3(BRCA1):c.4574_4575delAA (p.Gln1525Argfs) rs80357813
NM_007294.3(BRCA1):c.4575_4585delAGAGGAGCTCA (p.Gln1525Hisfs) rs397509184
NM_007294.3(BRCA1):c.4576G>T (p.Glu1526Ter) rs878853294
NM_007294.3(BRCA1):c.457_458delAG (p.Ser153Cysfs) rs397509185
NM_007294.3(BRCA1):c.457_458ins21 (p.?)
NM_007294.3(BRCA1):c.4587_4590delTAAG (p.Ile1529Metfs) rs431825409
NM_007294.3(BRCA1):c.4591del (p.Val1531Leufs) rs886040238
NM_007294.3(BRCA1):c.4593dup (p.Val1532Cysfs) rs886040239
NM_007294.3(BRCA1):c.4595_4596insCT (p.Asp1533Leufs) rs80357699
NM_007294.3(BRCA1):c.4596_4597insCT (p.Asp1533Leufs) rs1555581894
NM_007294.3(BRCA1):c.45delT (p.Asn16Metfs) rs730881457
NM_007294.3(BRCA1):c.4603G>T (p.Glu1535Ter) rs80357366
NM_007294.3(BRCA1):c.4609C>T (p.Gln1537Ter) rs80357229
NM_007294.3(BRCA1):c.4609_4610insCC (p.Gln1537Profs) rs886038035
NM_007294.3(BRCA1):c.460_467delGTCCAACT (p.Val154Leufs) rs1060502362
NM_007294.3(BRCA1):c.4610_4611insCC (p.Gln1537Hisfs) rs1555581882
NM_007294.3(BRCA1):c.4611_4612insG (p.Gln1538Alafs) rs80357915
NM_007294.3(BRCA1):c.4612C>T (p.Gln1538Ter) rs80356992
NM_007294.3(BRCA1):c.4612_4613insG (p.Gln1538Argfs) rs1555581879
NM_007294.3(BRCA1):c.4618G>T (p.Glu1540Ter) rs80357277
NM_007294.3(BRCA1):c.4618_4621delGAAGinsAAA (p.Glu1540Lysfs) rs886040240
NM_007294.3(BRCA1):c.4621G>T (p.Glu1541Ter) rs80357248
NM_007294.3(BRCA1):c.4622_4623delAG (p.Glu1541Valfs) rs886040241
NM_007294.3(BRCA1):c.4625_4626delCT (p.Ser1542Trpfs) rs80357542
NM_007294.3(BRCA1):c.463C>T (p.Gln155Ter) rs80357180
NM_007294.3(BRCA1):c.4644_4645ins8
NM_007294.3(BRCA1):c.4646_4665del20 (p.Glu1549Alafs) rs397509186
NM_007294.3(BRCA1):c.4647_4648dupAA (p.Thr1550Lysfs) rs869025213
NM_007294.3(BRCA1):c.464_465delAA (p.Gln155Profs) rs886037974
NM_007294.3(BRCA1):c.4654_4673del20 (p.Tyr1552Argfs) rs876659293
NM_007294.3(BRCA1):c.4655_4658delACTT (p.Tyr1552Cysfs) rs80357561
NM_007294.3(BRCA1):c.4655dupA (p.Tyr1552Terfs) rs587782143
NM_007294.3(BRCA1):c.4656C>G (p.Tyr1552Ter) rs80357151
NM_007294.3(BRCA1):c.465delA (p.Gln155Hisfs) rs1555594954
NM_007294.3(BRCA1):c.4666C>T (p.Gln1556Ter) rs1555581812
NM_007294.3(BRCA1):c.4668dup (p.Asp1557Argfs) rs886040242
NM_007294.3(BRCA1):c.466dupC (p.Leu156Profs) rs397507236
NM_007294.3(BRCA1):c.4674delA (p.Glu1559Argfs) rs886040911
NM_007294.3(BRCA1):c.4675+1G>A rs80358044
NM_007294.3(BRCA1):c.4675+1G>C rs80358044
NM_007294.3(BRCA1):c.4675+2T>A rs879255293
NM_007294.3(BRCA1):c.4675+2T>C rs879255293
NM_007294.3(BRCA1):c.4675+3A>T rs80358082
NM_007294.3(BRCA1):c.4675G>A (p.Glu1559Lys) rs80356988
NM_007294.3(BRCA1):c.4675G>C (p.Glu1559Gln) rs80356988
NM_007294.3(BRCA1):c.4676-1420_4986+900del
NM_007294.3(BRCA1):c.4676-1G>A rs80358008
NM_007294.3(BRCA1):c.4676-1G>T rs80358008
NM_007294.3(BRCA1):c.4676-2A>G rs80358096
NM_007294.3(BRCA1):c.4676-?_4986+?del
NM_007294.3(BRCA1):c.4676-?_5074+?del
NM_007294.3(BRCA1):c.4676-?_5193+?del
NM_007294.3(BRCA1):c.4676-?_5467+?del
NM_007294.3(BRCA1):c.4678G>T (p.Gly1560Ter) rs80357349
NM_007294.3(BRCA1):c.4678_4679delGG (p.Gly1560Asnfs) rs1555581104
NM_007294.3(BRCA1):c.4681delA (p.Thr1561Profs) rs397509187
NM_007294.3(BRCA1):c.4684_4685delCC (p.Pro1562Leufs) rs397509188
NM_007294.3(BRCA1):c.4688dup (p.Tyr1563Terfs) rs886040243
NM_007294.3(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.3(BRCA1):c.4695dupA (p.Ser1566Ilefs) rs397509189
NM_007294.3(BRCA1):c.4696_4697insA (p.Ser1566Tyrfs) rs483353095
NM_007294.3(BRCA1):c.4697_4698insA (p.Gly1567Trpfs) rs1555581078
NM_007294.3(BRCA1):c.4698_4704dupTGGAATC (p.Ser1569Trpfs) rs879255318
NM_007294.3(BRCA1):c.4699_4708del (p.Gly1567Serfs) rs886040244
NM_007294.3(BRCA1):c.4700_4710delGAATCAGCCTCinsA (p.Gly1567Aspfs) rs886040245
NM_007294.3(BRCA1):c.4709dupT (p.Phe1571Leufs) rs864622132
NM_007294.3(BRCA1):c.470_471delCT (p.Ser157Terfs) rs80357887
NM_007294.3(BRCA1):c.470_477delCTAACCTT (p.Ser157Trpfs) rs397509190
NM_007294.3(BRCA1):c.4712_4716delTCTCT (p.Phe1571Terfs) rs80357718
NM_007294.3(BRCA1):c.4712delT (p.Phe1571Serfs) rs886037790
NM_007294.3(BRCA1):c.4724delC (p.Pro1575Leufs) rs397509191
NM_007294.3(BRCA1):c.4741G>T (p.Glu1581Ter) rs397509193
NM_007294.3(BRCA1):c.4743del (p.Asp1582Thrfs) rs886040246
NM_007294.3(BRCA1):c.4745delA (p.Asp1582Alafs) rs80357907
NM_007294.3(BRCA1):c.4749_4750delAG (p.Arg1583Serfs) rs80357641
NM_007294.3(BRCA1):c.4754_4755delCA (p.Pro1585Argfs) rs80357837
NM_007294.3(BRCA1):c.4758_4759insA (p.Ser1587Ilefs) rs886040247
NM_007294.3(BRCA1):c.4759_4760insA (p.Ser1587Tyrfs) rs1555580980
NM_007294.3(BRCA1):c.475delC (p.Gly160Glufs) rs886037976
NM_007294.3(BRCA1):c.4760C>G (p.Ser1587Ter) rs397509195
NM_007294.3(BRCA1):c.4764_4765delTC (p.Arg1589Cysfs) rs80357795
NM_007294.3(BRCA1):c.4764delT (p.Arg1589Valfs) rs397509196
NM_007294.3(BRCA1):c.4775_4779delACATAinsC (p.Asn1592Thrfs) rs397507237
NM_007294.3(BRCA1):c.4784del (p.Ser1595Phefs) rs886040248
NM_007294.3(BRCA1):c.4787C>A (p.Ser1596Ter) rs80357429
NM_007294.3(BRCA1):c.4799dupT (p.Leu1600Phefs) rs587782392
NM_007294.3(BRCA1):c.4801A>T (p.Lys1601Ter) rs80357303
NM_007294.3(BRCA1):c.4806delT (p.Gln1604Asnfs) rs886038036
NM_007294.3(BRCA1):c.4810C>T (p.Gln1604Ter) rs80357352
NM_007294.3(BRCA1):c.4823_4824insG (p.Glu1609Argfs) rs1555580865
NM_007294.3(BRCA1):c.4834C>T (p.Gln1612Ter) rs786202064
NM_007294.3(BRCA1):c.4834_4835delCA (p.Gln1612Glufs) rs1555580840
NM_007294.3(BRCA1):c.4834del (p.Gln1612Argfs) rs886040249
NM_007294.3(BRCA1):c.4836dupG (p.Ser1613Glufs) rs397509198
NM_007294.3(BRCA1):c.4837_4838delAGinsGCC (p.Ser1613Alafs) rs730880287
NM_007294.3(BRCA1):c.4837delA (p.Ser1613Valfs) rs397509199
NM_007294.3(BRCA1):c.4838_4839insC (p.Pro1614Serfs) rs397509200
NM_007294.3(BRCA1):c.4841dup (p.Ala1615Serfs) rs1555580813
NM_007294.3(BRCA1):c.4843dupG (p.Ala1615Glyfs) rs80357615
NM_007294.3(BRCA1):c.485_486delTG (p.Val162Glufs) rs80357708
NM_007294.3(BRCA1):c.485_486dup (p.Arg163Terfs) rs80357708
NM_007294.3(BRCA1):c.485dupT (p.Arg163Glufs) rs587781427
NM_007294.3(BRCA1):c.4860_4941del82 (p.Asp1621Lysfs) rs1555580648
NM_007294.3(BRCA1):c.4868C>G (p.Ala1623Gly) rs80356862
NM_007294.3(BRCA1):c.4873_4885delTATAATGCAATGG (p.Tyr1625Lysfs) rs397509201
NM_007294.3(BRCA1):c.4875T>A (p.Tyr1625Ter) rs886040251
NM_007294.3(BRCA1):c.4877del (p.Asn1626Metfs) rs886040252
NM_007294.3(BRCA1):c.4878dup (p.Ala1627Cysfs) rs886040253
NM_007294.3(BRCA1):c.4885dup (p.Glu1629Glyfs) rs886040254
NM_007294.3(BRCA1):c.4887_4893del (p.Glu1630Terfs) rs886040255
NM_007294.3(BRCA1):c.4888_4889delGA (p.Glu1630Lysfs) rs879255490
NM_007294.3(BRCA1):c.488delG (p.Arg163Lysfs) rs397509202
NM_007294.3(BRCA1):c.4891del (p.Ser1631Valfs) rs80357656
NM_007294.3(BRCA1):c.4891dupA (p.Ser1631Lysfs) rs80357656
NM_007294.3(BRCA1):c.4895_4896delTG (p.Val1632Glufs) rs886038037
NM_007294.3(BRCA1):c.4901_4919del19 (p.Arg1634Lysfs) rs1555580678
NM_007294.3(BRCA1):c.4903G>T (p.Glu1635Ter) rs200432771
NM_007294.3(BRCA1):c.4903delG (p.Glu1635Argfs) rs1555580697
NM_007294.3(BRCA1):c.4905_4906delGA (p.Lys1636Alafs) rs397509203
NM_007294.3(BRCA1):c.490delA (p.Thr164Leufs) rs863224512
NM_007294.3(BRCA1):c.4910delC (p.Pro1637Glnfs) rs397509204
NM_007294.3(BRCA1):c.4921del (p.Ala1641Leufs) rs886040257
NM_007294.3(BRCA1):c.4930G>T (p.Glu1644Ter) rs397509205
NM_007294.3(BRCA1):c.4932_4933dupAA (p.Arg1645Lysfs) rs80357833
NM_007294.3(BRCA1):c.4935_4936insAA (p.Val1646Lysfs) rs1555580653
NM_007294.3(BRCA1):c.4936delG (p.Val1646Serfs) rs80357653
NM_007294.3(BRCA1):c.493_494delCT (p.Leu165Glufs) rs397509206
NM_007294.3(BRCA1):c.493delC (p.Leu165Terfs) rs80357551
NM_007294.3(BRCA1):c.4941delC (p.Asn1647Lysfs) rs80357905
NM_007294.3(BRCA1):c.4944_4945delAA (p.Arg1649Asnfs) rs80357655
NM_007294.3(BRCA1):c.4945_4947delAGAinsTTTT (p.Arg1649Phefs) rs397509207
NM_007294.3(BRCA1):c.4945delA (p.Arg1649Glufs) rs80357655
NM_007294.3(BRCA1):c.494dupT (p.Arg166Glufs) rs80357762
NM_007294.3(BRCA1):c.4964_4979delCTGGCCTGACCCCAGA (p.Ser1655Terfs) rs397509209
NM_007294.3(BRCA1):c.4964_4982del19 (p.Ser1655Tyrfs) rs80359876
NM_007294.3(BRCA1):c.4966_4984del19 (p.Gly1656Leufs) rs80359884
NM_007294.3(BRCA1):c.4969delC (p.Leu1657Terfs) rs886038038
NM_007294.3(BRCA1):c.4972delA (p.Thr1658Profs) rs1060505044
NM_007294.3(BRCA1):c.4976del (p.Pro1659Glnfs) rs879255295
NM_007294.3(BRCA1):c.4981G>T (p.Glu1661Ter) rs80357401
NM_007294.3(BRCA1):c.4986+1G>A rs80358162
NM_007294.3(BRCA1):c.4986+1G>T rs80358162
NM_007294.3(BRCA1):c.4986+1_4986+2ins65
NM_007294.3(BRCA1):c.4986+2T>C rs397509210
NM_007294.3(BRCA1):c.4986+3G>C rs80358023
NM_007294.3(BRCA1):c.4986+4A>C rs80358087
NM_007294.3(BRCA1):c.4986+4A>T rs80358087
NM_007294.3(BRCA1):c.4986+5G>A rs397509211
NM_007294.3(BRCA1):c.4986+5G>C rs397509211
NM_007294.3(BRCA1):c.4986+6T>C rs80358086
NM_007294.3(BRCA1):c.4986+6T>G rs80358086
NM_007294.3(BRCA1):c.4987-1G=
NM_007294.3(BRCA1):c.4987-1G>A rs730881495
NM_007294.3(BRCA1):c.4987-1G>T rs730881495
NM_007294.3(BRCA1):c.4987-2341_5074+2676del
NM_007294.3(BRCA1):c.4987-2508_5074+84del
NM_007294.3(BRCA1):c.4987-2A>G rs397509212
NM_007294.3(BRCA1):c.4987-577_5074+343del
NM_007294.3(BRCA1):c.4987-5T>A rs397509214
NM_007294.3(BRCA1):c.4987-5T>C rs397509214
NM_007294.3(BRCA1):c.4987-?_5074+?del
NM_007294.3(BRCA1):c.4987-?_5152+?del
NM_007294.3(BRCA1):c.4987-?_5193+?del
NM_007294.3(BRCA1):c.4987-?_5277+?del
NM_007294.3(BRCA1):c.4987_5074del88 (p.Val1665Serfs) rs1555579598
NM_007294.3(BRCA1):c.4987delA (p.Met1663Cysfs) rs886040912
NM_007294.3(BRCA1):c.4995_5007dup (p.Arg1670Valfs) rs1555579747
NM_007294.3(BRCA1):c.4996_4997dupTA (p.Lys1667Thrfs) rs1555579782
NM_007294.3(BRCA1):c.4997dupA (p.Tyr1666Terfs) rs876658947
NM_007294.3(BRCA1):c.4998C>A (p.Tyr1666Ter) rs730882165
NM_007294.3(BRCA1):c.4999A>T (p.Lys1667Ter) rs80357204
NM_007294.3(BRCA1):c.5005delG (p.Ala1669Profs) rs80357938
NM_007294.3(BRCA1):c.5007_5008ins13 (p.?)
NM_007294.3(BRCA1):c.5008_5009insC (p.Arg1670Thrfs) rs1555579738
NM_007294.3(BRCA1):c.500_501del (p.Thr167Lysfs) rs886040258
NM_007294.3(BRCA1):c.5013dup (p.His1672Thrfs) rs886040259
NM_007294.3(BRCA1):c.5019del (p.His1673Glnfs) rs886040260
NM_007294.3(BRCA1):c.5026_5027del (p.Leu1676Asnfs) rs397509217
NM_007294.3(BRCA1):c.5026_5036delTTAACTAATCT (p.Leu1676Asnfs) rs80357894
NM_007294.3(BRCA1):c.5027T>A (p.Leu1676Ter) rs786203754
NM_007294.3(BRCA1):c.5027T>G (p.Leu1676Ter) rs786203754
NM_007294.3(BRCA1):c.5027_5031delTAACT (p.Leu1676Terfs) rs431825410
NM_007294.3(BRCA1):c.5027del (p.Leu1676Terfs) rs397509217
NM_007294.3(BRCA1):c.5027dupT (p.Leu1676Phefs) rs397509217
NM_007294.3(BRCA1):c.502A>T (p.Lys168Ter) rs886040263
NM_007294.3(BRCA1):c.5030_5033delCTAA (p.Thr1677Ilefs) rs80357580
NM_007294.3(BRCA1):c.5030_5033dup (p.Leu1679Terfs) rs80357580
NM_007294.3(BRCA1):c.5033_5034ins4
NM_007294.3(BRCA1):c.5035_5039delCTAAT (p.Leu1679Tyrfs) rs80357623
NM_007294.3(BRCA1):c.5035delC (p.Leu1679Terfs) rs80357896
NM_007294.3(BRCA1):c.5038_5041dup (p.Thr1681Asnfs) rs1555579686
NM_007294.3(BRCA1):c.5039_5040delTT (p.Ile1680Asnfs) rs1135401935
NM_007294.3(BRCA1):c.5040delT (p.Thr1681Leufs) rs80357673
NM_007294.3(BRCA1):c.5041_5042insTTAA (p.Thr1681Ilefs) rs886040264
NM_007294.3(BRCA1):c.5042delC (p.Thr1681Metfs) rs886040265
NM_007294.3(BRCA1):c.5043_5044insTAAT (p.Glu1682Terfs) rs1555579675
NM_007294.3(BRCA1):c.5044_5048delGAAGAinsT (p.Glu1682Terfs) rs886040266
NM_007294.3(BRCA1):c.5047G>T (p.Glu1683Ter) rs80356879
NM_007294.3(BRCA1):c.5050_5051delAC (p.Thr1684Tyrfs) rs879255283
NM_007294.3(BRCA1):c.5051delC (p.Thr1684Ilefs) rs1135401881
NM_007294.3(BRCA1):c.5053A>G (p.Thr1685Ala) rs80356890
NM_007294.3(BRCA1):c.5054C>T (p.Thr1685Ile) rs80357043
NM_007294.3(BRCA1):c.5054_5057dupCTCA (p.Val1687Serfs) rs879254050
NM_007294.3(BRCA1):c.5056dupC (p.His1686Profs) rs80357974
NM_007294.3(BRCA1):c.5057A>G (p.His1686Arg) rs730882166
NM_007294.3(BRCA1):c.5058_5059insCAAC (p.Val1687Glnfs) rs886040267
NM_007294.3(BRCA1):c.5059_5060insCAAC (p.Val1687Alafs) rs1555579630
NM_007294.3(BRCA1):c.505C>T (p.Gln169Ter) rs80357133
NM_007294.3(BRCA1):c.5062_5064delGTT (p.Val1688del) rs80358344
NM_007294.3(BRCA1):c.5065dup (p.Met1689Asnfs) rs886040268
NM_007294.3(BRCA1):c.5066T>G (p.Met1689Arg) rs80357061
NM_007294.3(BRCA1):c.5068A>T (p.Lys1690Ter) rs397507239
NM_007294.3(BRCA1):c.5071dupA (p.Thr1691Asnfs) rs80357672
NM_007294.3(BRCA1):c.5072C>T (p.Thr1691Ile) rs80357034
NM_007294.3(BRCA1):c.5074+1G>A rs80358053
NM_007294.3(BRCA1):c.5074+1G>C rs80358053
NM_007294.3(BRCA1):c.5074+1G>T rs80358053
NM_007294.3(BRCA1):c.5074+2T>C rs80358089
NM_007294.3(BRCA1):c.5074+3A>G rs80358181
NM_007294.3(BRCA1):c.5074G>A (p.Asp1692Asn) rs80187739
NM_007294.3(BRCA1):c.5074G>C (p.Asp1692His) rs80187739
NM_007294.3(BRCA1):c.5074G>T (p.Asp1692Tyr) rs80187739
NM_007294.3(BRCA1):c.5075-1G>A rs1800747
NM_007294.3(BRCA1):c.5075-1G>C rs1800747
NM_007294.3(BRCA1):c.5075-2A>C rs80358066
NM_007294.3(BRCA1):c.5075-2A>G rs80358066
NM_007294.3(BRCA1):c.5075-2A>T rs80358066
NM_007294.3(BRCA1):c.5075-2del rs886040913
NM_007294.3(BRCA1):c.5075-8T>G rs397509221
NM_007294.3(BRCA1):c.5075-?_5152+?del
NM_007294.3(BRCA1):c.5075-?_5193+?del
NM_007294.3(BRCA1):c.5075-?_5193+?dup
NM_007294.3(BRCA1):c.5075-?_5277+?del
NM_007294.3(BRCA1):c.5075-?_5277+?dup203
NM_007294.3(BRCA1):c.5075_5078delATGC (p.Asp1692Valfs) rs397509223
NM_007294.3(BRCA1):c.5076del (p.Asp1692Glufs) rs886040269
NM_007294.3(BRCA1):c.5077_5080delGCTGinsTTGATTCTGC (p.Ala1693_Glu1694delinsLeuIleLeuGln) rs397509224
NM_007294.3(BRCA1):c.5078_5080delCTG (p.Ala1693del) rs80358345
NM_007294.3(BRCA1):c.5080G>T (p.Glu1694Ter) rs80356896
NM_007294.3(BRCA1):c.5083_5084insG (p.Phe1695Cysfs) rs886040270
NM_007294.3(BRCA1):c.5084_5085delTT (p.Phe1695Cysfs) rs80357760
NM_007294.3(BRCA1):c.5084_5085insG (p.Phe1695Leufs) rs1555578648
NM_007294.3(BRCA1):c.5091_5092delTG (p.Cys1697Terfs) rs80357710
NM_007294.3(BRCA1):c.5091delT (p.Cys1697Trpfs) rs1135401882
NM_007294.3(BRCA1):c.5095C>T (p.Arg1699Trp) rs55770810
NM_007294.3(BRCA1):c.5096G>A (p.Arg1699Gln) rs41293459
NM_007294.3(BRCA1):c.5098delA (p.Thr1700Hisfs) rs483353099
NM_007294.3(BRCA1):c.5102_5103delTG (p.Leu1701Glnfs) rs80357608
NM_007294.3(BRCA1):c.5102delT (p.Leu1701Argfs) rs1555578613
NM_007294.3(BRCA1):c.5106delA (p.Lys1702Asnfs) rs80357553
NM_007294.3(BRCA1):c.5109T>G (p.Tyr1703Ter) rs80356974
NM_007294.3(BRCA1):c.510delG (p.Ile171Tyrfs) rs1060505052
NM_007294.3(BRCA1):c.5112delT (p.Leu1705Terfs) rs397509228
NM_007294.3(BRCA1):c.5114_5121del (p.Leu1705Argfs) rs886040271
NM_007294.3(BRCA1):c.5116G>A (p.Gly1706Arg) rs886040864
NM_007294.3(BRCA1):c.5117G>A (p.Gly1706Glu) rs80356860
NM_007294.3(BRCA1):c.5123C>A (p.Ala1708Glu) rs28897696
NM_007294.3(BRCA1):c.5123delC (p.Ala1708Glyfs) rs886038040
NM_007294.3(BRCA1):c.5126delG (p.Gly1709Glufs) rs80357874
NM_007294.3(BRCA1):c.5128G>T (p.Gly1710Ter) rs397509229
NM_007294.3(BRCA1):c.5129delG (p.Gly1710Glufs) rs1135401829
NM_007294.3(BRCA1):c.512dupT (p.Gln172Thrfs) rs587781487
NM_007294.3(BRCA1):c.5131A>T (p.Lys1711Ter) rs886040272
NM_007294.3(BRCA1):c.5133delA (p.Lys1711Asnfs) rs730880288
NM_007294.3(BRCA1):c.5133dupA (p.Trp1712Metfs) rs730880288
NM_007294.3(BRCA1):c.5135G>A (p.Trp1712Ter) rs876658672
NM_007294.3(BRCA1):c.5136G>A (p.Trp1712Ter) rs80357418
NM_007294.3(BRCA1):c.5137delG (p.Val1713Terfs) rs80357997
NM_007294.3(BRCA1):c.5143A>C (p.Ser1715Arg) rs80357222
NM_007294.3(BRCA1):c.5145C>G (p.Ser1715Arg) rs80357094
NM_007294.3(BRCA1):c.5145delC (p.Tyr1716Ilefs) rs80357870
NM_007294.3(BRCA1):c.5148T>A (p.Tyr1716Ter) rs397509230
NM_007294.3(BRCA1):c.5148T>G (p.Tyr1716Ter) rs397509230
NM_007294.3(BRCA1):c.5148_5149insC (p.Phe1717Leufs) rs1555578542
NM_007294.3(BRCA1):c.514C>T (p.Gln172Ter) rs80356947
NM_007294.3(BRCA1):c.514delC (p.Gln172Asnfs) rs80357872
NM_007294.3(BRCA1):c.5150delT (p.Phe1717Serfs) rs80357720
NM_007294.3(BRCA1):c.5152+1G>A rs80358094
NM_007294.3(BRCA1):c.5152+1G>C rs80358094
NM_007294.3(BRCA1):c.5152+1G>T rs80358094
NM_007294.3(BRCA1):c.5152+2T>A rs886040914
NM_007294.3(BRCA1):c.5152+2dupT rs397509231
NM_007294.3(BRCA1):c.5152+3A>C rs80358124
NM_007294.3(BRCA1):c.5152+3_5152+4insT rs273901744
NM_007294.3(BRCA1):c.5152+5G>A rs80358165
NM_007294.3(BRCA1):c.5153-1G>A rs80358137
NM_007294.3(BRCA1):c.5153-1G>C rs80358137
NM_007294.3(BRCA1):c.5153-2A>G rs786202545
NM_007294.3(BRCA1):c.5153-2delA rs273901746
NM_007294.3(BRCA1):c.5153-?_5193+?del
NM_007294.3(BRCA1):c.5153G>A (p.Trp1718Ter) rs41293461
NM_007294.3(BRCA1):c.5154G>A (p.Trp1718Ter) rs80357239
NM_007294.3(BRCA1):c.5155delG (p.Val1719Terfs) rs80357743
NM_007294.3(BRCA1):c.5155dup (p.Val1719Glyfs) rs80357743
NM_007294.3(BRCA1):c.5156_5157delTG (p.Val1719Aspfs) rs80357895
NM_007294.3(BRCA1):c.5156_5157insAATA (p.Thr1720Ilefs) rs1555578407
NM_007294.3(BRCA1):c.5161C>T (p.Gln1721Ter) rs878854957
NM_007294.3(BRCA1):c.5161_5165del (p.Gln1721Tyrfs) rs886040274
NM_007294.3(BRCA1):c.5162delA (p.Gln1721Argfs) rs397509233
NM_007294.3(BRCA1):c.5163_5164insC (p.Ser1722Leufs) rs886040275
NM_007294.3(BRCA1):c.5165C>T (p.Ser1722Phe) rs80357104
NM_007294.3(BRCA1):c.5165dup (p.Ile1723Tyrfs) rs1555578376
NM_007294.3(BRCA1):c.5167delAinsTTT (p.Ile1723Phefs) rs730882167
NM_007294.3(BRCA1):c.516delA (p.Gln172Hisfs) rs879254223
NM_007294.3(BRCA1):c.5173G>T (p.Glu1725Ter) rs80357291
NM_007294.3(BRCA1):c.5176delA (p.Arg1726Glufs) rs876658478
NM_007294.3(BRCA1):c.5177_5178delGA (p.Arg1726Lysfs) rs80357730
NM_007294.3(BRCA1):c.5179A>T (p.Lys1727Ter) rs80357347
NM_007294.3(BRCA1):c.5179_5192delAAAATGCTGAATGA (p.Lys1727Alafs) rs397509234
NM_007294.3(BRCA1):c.5181_5182delAA (p.Lys1727Asnfs) rs34570933
NM_007294.3(BRCA1):c.5182delA (p.Met1728Cysfs) rs34570933
NM_007294.3(BRCA1):c.5186delT (p.Leu1729Argfs) rs398122692
NM_007294.3(BRCA1):c.518del (p.Pro173Leufs) rs886040276
NM_007294.3(BRCA1):c.5193+1G>A rs80358004
NM_007294.3(BRCA1):c.5193+1G>C rs80358004
NM_007294.3(BRCA1):c.5193+1G>T rs80358004
NM_007294.3(BRCA1):c.5193+1delG rs397509236
NM_007294.3(BRCA1):c.5193+2T>G rs886040915
NM_007294.3(BRCA1):c.5193+2delT rs273901751
NM_007294.3(BRCA1):c.5193+3_5193+15del rs273901752
NM_007294.3(BRCA1):c.5194-12G>A rs80358079
NM_007294.3(BRCA1):c.5194-1699_5277+1996delins236
NM_007294.3(BRCA1):c.5194-1730_5277+1996delins268
NM_007294.3(BRCA1):c.5194-1G>A rs80358173
NM_007294.3(BRCA1):c.5194-1G>C rs80358173
NM_007294.3(BRCA1):c.5194-1G>T rs80358173
NM_007294.3(BRCA1):c.5194-2A>G rs80358069
NM_007294.3(BRCA1):c.5194-452_5277+3638del
NM_007294.3(BRCA1):c.5194-5858_5277+2206del
NM_007294.3(BRCA1):c.5194-?_5277+?del
NM_007294.3(BRCA1):c.5194-?_5277+?delinsG
NM_007294.3(BRCA1):c.5194-?_5277+?dup
NM_007294.3(BRCA1):c.519delT (p.Gln174Lysfs) rs886037784
NM_007294.3(BRCA1):c.51delT (p.Met18Cysfs) rs886037967
NM_007294.3(BRCA1):c.5201_5202insC (p.Glu1735Terfs) rs1555576982
NM_007294.3(BRCA1):c.5202delT (p.Phe1734Leufs) rs876659867
NM_007294.3(BRCA1):c.5205delA (p.Val1736Serfs) rs587781258
NM_007294.3(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.3(BRCA1):c.5207delT (p.Val1736Alafs) rs397509239
NM_007294.3(BRCA1):c.5208_5247del40insTC (p.Arg1737Glnfs) rs886040277
NM_007294.3(BRCA1):c.5209A>T (p.Arg1737Ter) rs80357496
NM_007294.3(BRCA1):c.5209_5248del40insTC (p.Arg1737Serfs) rs273901753
NM_007294.3(BRCA1):c.5209dup (p.Arg1737Lysfs) rs886040278
NM_007294.3(BRCA1):c.520delC (p.Gln174Lysfs) rs80357639
NM_007294.3(BRCA1):c.5210_5211insC (p.Arg1737Serfs) rs1555576964
NM_007294.3(BRCA1):c.5212G>A (p.Gly1738Arg) rs80356937
NM_007294.3(BRCA1):c.5212G>T (p.Gly1738Ter) rs80356937
NM_007294.3(BRCA1):c.5213G>A (p.Gly1738Glu) rs80357450
NM_007294.3(BRCA1):c.5213del (p.Gly1738Glufs) rs886040279
NM_007294.3(BRCA1):c.5215_5216delGA (p.Asp1739Cysfs) rs1064794467
NM_007294.3(BRCA1):c.5216A>T (p.Asp1739Val) rs80357227
NM_007294.3(BRCA1):c.5221_5224del (p.Val1741Metfs) rs886040280
NM_007294.3(BRCA1):c.5229_5230delAA (p.Arg1744Lysfs) rs80357852
NM_007294.3(BRCA1):c.5230_5237del (p.Arg1744Profs) rs886040281
NM_007294.3(BRCA1):c.5230delA (p.Arg1744Glufs) rs397509240
NM_007294.3(BRCA1):c.5231delG (p.Arg1744Lysfs) rs397509241
NM_007294.3(BRCA1):c.5232_5238delAAACCACins12 (p.?)
NM_007294.3(BRCA1):c.5234dupA (p.Asn1745Lysfs) rs886038042
NM_007294.3(BRCA1):c.5236delC (p.His1746Thrfs) rs876659483
NM_007294.3(BRCA1):c.5237delA (p.His1746Profs) rs1555576907
NM_007294.3(BRCA1):c.5239C>T (p.Gln1747Ter) rs80357367
NM_007294.3(BRCA1):c.5239delC (p.Gln1747Lysfs) rs886040282
NM_007294.3(BRCA1):c.5239dup (p.Gln1747Profs) rs886040282
NM_007294.3(BRCA1):c.5241delA (p.Gly1748Valfs) rs80357791
NM_007294.3(BRCA1):c.5243delG (p.Gly1748Valfs) rs80357676
NM_007294.3(BRCA1):c.5247_5248insTC (p.Lys1750Serfs) rs1555576878
NM_007294.3(BRCA1):c.5248_5249insTC (p.Lys1750Ilefs) rs1555576871
NM_007294.3(BRCA1):c.5249delA (p.Lys1750Serfs) rs879253993
NM_007294.3(BRCA1):c.5249dup (p.Arg1751Alafs) rs879253993
NM_007294.3(BRCA1):c.5251C>T (p.Arg1751Ter) rs80357123
NM_007294.3(BRCA1):c.5257dupA (p.Arg1753Lysfs) rs397509245
NM_007294.3(BRCA1):c.5259delA (p.Glu1754Asnfs) rs80357925
NM_007294.3(BRCA1):c.5260G>T (p.Glu1754Ter) rs80357432
NM_007294.3(BRCA1):c.5266C>T (p.Gln1756Ter) rs397509247
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs397507247
NM_007294.3(BRCA1):c.5267_5268insC (p.Gln1756Hisfs) rs886040284
NM_007294.3(BRCA1):c.5268_5269insC (p.Asp1757Argfs) rs431825414
NM_007294.3(BRCA1):c.5268_5274delGGACAGA (p.Asp1757Argfs) rs886038043
NM_007294.3(BRCA1):c.5269_5270insC (p.Asp1757Alafs) rs1555576840
NM_007294.3(BRCA1):c.5269_5273delGACAG (p.Asp1757Lysfs) rs786202040
NM_007294.3(BRCA1):c.5270_5276delACAGAAA (p.Asp1757Glyfs) rs397509248
NM_007294.3(BRCA1):c.5271_5277del (p.Asp1757Glufs)
NM_007294.3(BRCA1):c.5276delA (p.Lys1759Argfs) rs80357732
NM_007294.3(BRCA1):c.5277+1G>A rs80358150
NM_007294.3(BRCA1):c.5277+1_5277+6del
NM_007294.3(BRCA1):c.5277+1delG rs273901754
NM_007294.3(BRCA1):c.5277+833_5277+1671delins141
NM_007294.3(BRCA1):c.5277G>A (p.Lys1759=) rs80356854
NM_007294.3(BRCA1):c.5278-1G>A rs80358099
NM_007294.3(BRCA1):c.5278-1G>C rs80358099
NM_007294.3(BRCA1):c.5278-1G>T rs80358099
NM_007294.3(BRCA1):c.5278-2A>G rs397509253
NM_007294.3(BRCA1):c.5278-2del rs878853285
NM_007294.3(BRCA1):c.5278-?_5332+?del
NM_007294.3(BRCA1):c.5278-?_5406+?del
NM_007294.3(BRCA1):c.5278-?_5406+?dup
NM_007294.3(BRCA1):c.5278-?_5467+?del
NM_007294.3(BRCA1):c.5278-?_5467+?dup
NM_007294.3(BRCA1):c.5282del (p.Phe1761Serfs) rs886040285
NM_007294.3(BRCA1):c.5284delA (p.Arg1762Glyfs) rs80357684
NM_007294.3(BRCA1):c.5289delG (p.Leu1764Terfs) rs80357886
NM_007294.3(BRCA1):c.5289dupG (p.Leu1764Alafs) rs80357886
NM_007294.3(BRCA1):c.5291T>C (p.Leu1764Pro) rs80357281
NM_007294.3(BRCA1):c.5293G>T (p.Glu1765Ter) rs397509256
NM_007294.3(BRCA1):c.5297T>A (p.Ile1766Asn) rs80357463
NM_007294.3(BRCA1):c.5297T>G (p.Ile1766Ser) rs80357463
NM_007294.3(BRCA1):c.5299del (p.Cys1767Valfs) rs886040286
NM_007294.3(BRCA1):c.529delT (p.Ser177Leufs) rs80357758
NM_007294.3(BRCA1):c.5300_5301del (p.Cys1767Leufs) rs886040287
NM_007294.3(BRCA1):c.5301T>A (p.Cys1767Ter) rs886040288
NM_007294.3(BRCA1):c.5302delT (p.Cys1768Alafs) rs886040289
NM_007294.3(BRCA1):c.5304delC (p.Tyr1769Metfs) rs80357959
NM_007294.3(BRCA1):c.5307T>A (p.Tyr1769Ter) rs397509258
NM_007294.3(BRCA1):c.5310_5311delGC (p.Pro1771Leufs) rs587781825
NM_007294.3(BRCA1):c.5310delG (p.Phe1772Serfs) rs80357581
NM_007294.3(BRCA1):c.5310dupG (p.Pro1771Alafs) rs80357581
NM_007294.3(BRCA1):c.5311_5332+1del rs886040916
NM_007294.3(BRCA1):c.5315delT (p.Phe1772Serfs) rs397509261
NM_007294.3(BRCA1):c.5319dupC (p.Asn1774Glnfs) rs80357823
NM_007294.3(BRCA1):c.531del (p.Val178Serfs) rs886040290
NM_007294.3(BRCA1):c.531dupT (p.Val178Cysfs) rs864622350
NM_007294.3(BRCA1):c.5320_5321delAA (p.Asn1774Hisfs) rs80357818
NM_007294.3(BRCA1):c.5323_5324delAT (p.Met1775Alafs) rs397509262
NM_007294.3(BRCA1):c.5324T>A (p.Met1775Lys) rs41293463
NM_007294.3(BRCA1):c.5324T>G (p.Met1775Arg) rs41293463
NM_007294.3(BRCA1):c.5328delC (p.Thr1777Glnfs) rs80357751
NM_007294.3(BRCA1):c.5328dupC (p.Thr1777Hisfs) rs80357751
NM_007294.3(BRCA1):c.5331_5332+1delinsCAACAT rs878853286
NM_007294.3(BRCA1):c.5331_5332+6delinsCAACAT rs886040917
NM_007294.3(BRCA1):c.5332+1G>A rs80358041
NM_007294.3(BRCA1):c.5332+1G>C rs80358041
NM_007294.3(BRCA1):c.5332+1G>T rs80358041
NM_007294.3(BRCA1):c.5332+2T>A rs80358182
NM_007294.3(BRCA1):c.5332+2T>C rs80358182
NM_007294.3(BRCA1):c.5332G>A (p.Asp1778Asn) rs80357112
NM_007294.3(BRCA1):c.5333-198_5387del rs1555575109
NM_007294.3(BRCA1):c.5333-1G>C rs80358126
NM_007294.3(BRCA1):c.5333-1G>T rs80358126
NM_007294.3(BRCA1):c.5333-2A>C rs397509264
NM_007294.3(BRCA1):c.5333-36_5406+400del rs1555574977
NM_007294.3(BRCA1):c.5333-3T>G rs397509265
NM_007294.3(BRCA1):c.5333-?_5406+?del
NM_007294.3(BRCA1):c.5335C>T (p.Gln1779Ter) rs397509267
NM_007294.3(BRCA1):c.5335delC (p.Gln1779Asnfs) rs80357590
NM_007294.3(BRCA1):c.5338delC (p.Leu1780Trpfs) rs886038045
NM_007294.3(BRCA1):c.5339T>C (p.Leu1780Pro) rs80357474
NM_007294.3(BRCA1):c.5341G>T (p.Glu1781Ter) rs397509268
NM_007294.3(BRCA1):c.5341_5343delGAAinsTG (p.Glu1781Cysfs) rs886040291
NM_007294.3(BRCA1):c.5341delG (p.Glu1781Asnfs) rs80357694
NM_007294.3(BRCA1):c.5345G>A (p.Trp1782Ter) rs80357219
NM_007294.3(BRCA1):c.5346G>A (p.Trp1782Ter) rs80357284
NM_007294.3(BRCA1):c.5348del (p.Met1783Argfs) rs886040292
NM_007294.3(BRCA1):c.5352dupA (p.Gln1785Thrfs) rs80357744
NM_007294.3(BRCA1):c.5353C>T (p.Gln1785Ter) rs80356969
NM_007294.3(BRCA1):c.5353_5354dup (p.Gln1785Hisfs) rs886040293
NM_007294.3(BRCA1):c.5359T>A (p.Cys1787Ser) rs80357065
NM_007294.3(BRCA1):c.5359_5363delTGTGGinsAGTGA (p.Cys1787_Gly1788delinsSerAsp) rs786203663
NM_007294.3(BRCA1):c.5360_5361delGTinsAG (p.Cys1787Ter) rs397509270
NM_007294.3(BRCA1):c.5361_5362delTG (p.Cys1787Trpfs) rs886040294
NM_007294.3(BRCA1):c.5363G>A (p.Gly1788Asp) rs80357069
NM_007294.3(BRCA1):c.5363G>T (p.Gly1788Val) rs80357069
NM_007294.3(BRCA1):c.5366delC (p.Ala1789Valfs) rs760188581
NM_007294.3(BRCA1):c.5368delT (p.Ser1790Leufs) rs879254116
NM_007294.3(BRCA1):c.5369_5385delCTGTGGTGAAGGAGCTT (p.Ser1790Phefs) rs397509272
NM_007294.3(BRCA1):c.536delA (p.Tyr179Serfs) rs397509273
NM_007294.3(BRCA1):c.5370_5397delTGTGGTGAAGGAGCTTTCATCATTCACC (p.Val1791Leufs) rs80359878
NM_007294.3(BRCA1):c.5377A>T (p.Lys1793Ter) rs397509274
NM_007294.3(BRCA1):c.5380G>T (p.Glu1794Ter) rs776323117
NM_007294.3(BRCA1):c.5386delT (p.Ser1796Hisfs) rs80357838
NM_007294.3(BRCA1):c.5386dupT (p.Ser1796Phefs) rs80357838
NM_007294.3(BRCA1):c.5387C>A (p.Ser1796Ter) rs80357055
NM_007294.3(BRCA1):c.5389dup (p.Ser1797Phefs) rs886040295
NM_007294.3(BRCA1):c.5390C>G (p.Ser1797Ter) rs879255492
NM_007294.3(BRCA1):c.5391delA (p.Phe1798Serfs) rs774988515
NM_007294.3(BRCA1):c.5398delC (p.Gly1801Alafs) rs1064794662
NM_007294.3(BRCA1):c.5406+1G>A rs80358028
NM_007294.3(BRCA1):c.5406+1_5406+3delGTA rs397509277
NM_007294.3(BRCA1):c.5406+2del rs273901765
NM_007294.3(BRCA1):c.5406+3A>T rs397509278
NM_007294.3(BRCA1):c.5406+5G>A rs80358073
NM_007294.3(BRCA1):c.5406+5G>C rs80358073
NM_007294.3(BRCA1):c.5406+5G>T rs80358073
NM_007294.3(BRCA1):c.5407-1G>A rs80358029
NM_007294.3(BRCA1):c.5407-1G>C rs80358029
NM_007294.3(BRCA1):c.5407-2A>G rs80358002
NM_007294.3(BRCA1):c.5407-2A>T rs80358002
NM_007294.3(BRCA1):c.5407-?_5467+?del
NM_007294.3(BRCA1):c.5407-?_5467+?dup
NM_007294.3(BRCA1):c.5407_5414delGGTGTCCA (p.Gly1803Profs) rs886040865
NM_007294.3(BRCA1):c.5417delC (p.Pro1806Glnfs) rs80357558
NM_007294.3(BRCA1):c.5419delA (p.Ile1807Leufs) rs80357934
NM_007294.3(BRCA1):c.5419dup (p.Ile1807Asnfs) rs80357934
NM_007294.3(BRCA1):c.5427dup (p.Val1810Cysfs) rs1555574739
NM_007294.3(BRCA1):c.5430_5431insGA (p.Gln1811Aspfs) rs1555574722
NM_007294.3(BRCA1):c.5431C>T (p.Gln1811Ter) rs397509283
NM_007294.3(BRCA1):c.5434C>G (p.Pro1812Ala) rs1800751
NM_007294.3(BRCA1):c.5440delG (p.Ala1814Profs) rs80357946
NM_007294.3(BRCA1):c.5444G>A (p.Trp1815Ter) rs80356962
NM_007294.3(BRCA1):c.5445G>A (p.Trp1815Ter) rs397509284
NM_007294.3(BRCA1):c.5449G>T (p.Glu1817Ter) rs80356868
NM_007294.3(BRCA1):c.5450_5451delAG (p.Glu1817Glyfs) rs397509286
NM_007294.3(BRCA1):c.5453A>G (p.Asp1818Gly) rs80357477
NM_007294.3(BRCA1):c.5463_5464insT (p.His1822Serfs) rs1057518636
NM_007294.3(BRCA1):c.5464_5465insT (p.His1822Leufs) rs273902769
NM_007294.3(BRCA1):c.5466dup (p.Ala1823Cysfs) rs1555574698
NM_007294.3(BRCA1):c.5467+1G>A rs80358145
NM_007294.3(BRCA1):c.5467+1del rs886040918
NM_007294.3(BRCA1):c.5467+2T>C rs80358009
NM_007294.3(BRCA1):c.5467+2T>G rs80358009
NM_007294.3(BRCA1):c.5467G>A (p.Ala1823Thr) rs80357212
NM_007294.3(BRCA1):c.5468-11_5520dup rs1555574411
NM_007294.3(BRCA1):c.5468-1G>A rs80358048
NM_007294.3(BRCA1):c.5468-285_*4016delinsCA
NM_007294.3(BRCA1):c.5468-2A>G rs398122699
NM_007294.3(BRCA1):c.5468-2A>T rs398122699
NM_007294.3(BRCA1):c.5468-40T>A rs80358151
NM_007294.3(BRCA1):c.547+1G>A rs80358030
NM_007294.3(BRCA1):c.547+1G>T rs80358030
NM_007294.3(BRCA1):c.547+2T>A rs80358047
NM_007294.3(BRCA1):c.547+3A>T rs886040919
NM_007294.3(BRCA1):c.5470_5477delATTGGGCA (p.Ile1824Aspfs) rs80357973
NM_007294.3(BRCA1):c.5474_5481delGGCAGATG (p.Gly1825Valfs) rs730881441
NM_007294.3(BRCA1):c.5479_5480insGA (p.Met1827Argfs) rs80357757
NM_007294.3(BRCA1):c.548-?_4185+?del
NM_007294.3(BRCA1):c.548-?_5193+?del
NM_007294.3(BRCA1):c.5483delG (p.Cys1828Leufs) rs397509288
NM_007294.3(BRCA1):c.5484_5485delTG (p.Cys1828Terfs) rs886038046
NM_007294.3(BRCA1):c.5485dupG (p.Glu1829Glyfs) rs768401297
NM_007294.3(BRCA1):c.5486_5510del (p.Glu1829Glyfs) rs886040297
NM_007294.3(BRCA1):c.5490delA (p.Pro1831Leufs) rs80357976
NM_007294.3(BRCA1):c.5492delC (p.Pro1831Leufs) rs80357582
NM_007294.3(BRCA1):c.5493_5494insTT (p.Val1832Leufs) rs886040298
NM_007294.3(BRCA1):c.5495_5496insTT (p.Val1833Trpfs) rs1555574436
NM_007294.3(BRCA1):c.5496_5499delGGTG (p.Val1833Profs) rs878853296
NM_007294.3(BRCA1):c.5496_5506delGGTGACCCGAGinsA (p.Val1833Serfs) rs273902775
NM_007294.3(BRCA1):c.5497G>A (p.Val1833Met) rs80357268
NM_007294.3(BRCA1):c.5497_5506delGTGACCCGAG (p.Val1833Serfs) rs273902775
NM_007294.3(BRCA1):c.5498_5511delTGACCCGAGAGTGG (p.Val1833Glyfs) rs80359873
NM_007294.3(BRCA1):c.5502_5503dup (p.Arg1835Profs) rs397509291
NM_007294.3(BRCA1):c.5503C>T (p.Arg1835Ter) rs41293465
NM_007294.3(BRCA1):c.5503_5506del (p.Arg1835Serfs) rs886040300
NM_007294.3(BRCA1):c.5503_5564del62 (p.Arg1835Thrfs) rs80359883
NM_007294.3(BRCA1):c.5503delC (p.Arg1835Glufs) rs397509291
NM_007294.3(BRCA1):c.5503dupC (p.Arg1835Profs) rs397509291
NM_007294.3(BRCA1):c.5506G>T (p.Glu1836Ter) rs80356942
NM_007294.3(BRCA1):c.5509_5510delTG (p.Trp1837Glyfs) rs1135401888
NM_007294.3(BRCA1):c.5510G>A (p.Trp1837Ter) rs80357307
NM_007294.3(BRCA1):c.5511G>A (p.Trp1837Ter) rs80356914
NM_007294.3(BRCA1):c.5512delG (p.Val1838Cysfs) rs80357839
NM_007294.3(BRCA1):c.5513T>A (p.Val1838Glu) rs80357107
NM_007294.3(BRCA1):c.5518delG (p.Asp1840Thrfs) rs1555574414
NM_007294.3(BRCA1):c.5521delA (p.Ser1841Valfs) rs80357721
NM_007294.3(BRCA1):c.5524_5531delGTAGCACT (p.Val1842Leufs) rs879255287
NM_007294.3(BRCA1):c.5525delT (p.Val1842Glufs) rs864622220
NM_007294.3(BRCA1):c.5532_5533delCT (p.Tyr1845Profs) rs1064793059
NM_007294.3(BRCA1):c.5533_5534insG (p.Tyr1845Terfs) rs1555574384
NM_007294.3(BRCA1):c.5533dupT (p.Tyr1845Leufs) rs397509294
NM_007294.3(BRCA1):c.5534_5539delACCAGTins20 (p.?)
NM_007294.3(BRCA1):c.5534delA (p.Tyr1845Serfs) rs1060505048
NM_007294.3(BRCA1):c.5535C>A (p.Tyr1845Ter) rs80356977
NM_007294.3(BRCA1):c.5535C>G (p.Tyr1845Ter) rs80356977
NM_007294.3(BRCA1):c.5536C>T (p.Gln1846Ter) rs80356873
NM_007294.3(BRCA1):c.5536del (p.Gln1846Serfs) rs886040301
NM_007294.3(BRCA1):c.5537_5556del (p.Gln1846Leufs) rs886040302
NM_007294.3(BRCA1):c.5541C>A (p.Cys1847Ter) rs397509295
NM_007294.3(BRCA1):c.5542C>T (p.Gln1848Ter) rs886040303
NM_007294.3(BRCA1):c.5548delC (p.Leu1850Trpfs) rs397509296
NM_007294.3(BRCA1):c.5551del (p.Asp1851Thrfs) rs886040304
NM_007294.3(BRCA1):c.5553dupC (p.Thr1852Hisfs) rs397509297
NM_007294.3(BRCA1):c.5556_5560del (p.Tyr1853Aspfs) rs886040305
NM_007294.3(BRCA1):c.5558dupA (p.Tyr1853Terfs) rs80357629
NM_007294.3(BRCA1):c.5559C>A (p.Tyr1853Ter) rs80357336
NM_007294.3(BRCA1):c.5559C>G (p.Tyr1853Ter) rs80357336
NM_007294.3(BRCA1):c.5560del (p.Leu1854Terfs) rs886040306
NM_007294.3(BRCA1):c.5563delAins6
NM_007294.3(BRCA1):c.55C>T (p.Gln19Ter) rs397509299
NM_007294.3(BRCA1):c.569_570insAACG (p.Val191Thrfs) rs397509300
NM_007294.3(BRCA1):c.594-2A>C rs80358033
NM_007294.3(BRCA1):c.594-?_4484+?del
NM_007294.3(BRCA1):c.594_597delTGTG (p.Ser198Argfs) rs797045175
NM_007294.3(BRCA1):c.61delA (p.Ile21Serfs) rs273902778
NM_007294.3(BRCA1):c.625_626ins20 (p.?)
NM_007294.3(BRCA1):c.626del (p.Pro209Leufs) rs886040920
NM_007294.3(BRCA1):c.628C>T (p.Gln210Ter) rs879255495
NM_007294.3(BRCA1):c.62_65del (p.Ile21Lysfs) rs886040307
NM_007294.3(BRCA1):c.62dupT (p.Glu23Argfs) rs397509303
NM_007294.3(BRCA1):c.640del (p.Asp214Metfs) rs886040921
NM_007294.3(BRCA1):c.64_65delTT (p.Leu22Argfs) rs397509304
NM_007294.3(BRCA1):c.64_65dupTT (p.Leu22Phefs) rs80357642
NM_007294.3(BRCA1):c.65T>A (p.Leu22Ter) rs80357438
NM_007294.3(BRCA1):c.65T>C (p.Leu22Ser) rs80357438
NM_007294.3(BRCA1):c.65delT (p.Leu22Terfs) rs80357642
NM_007294.3(BRCA1):c.667_668delAA (p.Lys223Glyfs) rs80357537
NM_007294.3(BRCA1):c.668delA (p.Lys223Argfs) rs80357537
NM_007294.3(BRCA1):c.668dupA (p.Ala224Glyfs) rs80357537
NM_007294.3(BRCA1):c.66dupA (p.Glu23Argfs) rs80357783
NM_007294.3(BRCA1):c.670+1G>T rs398122706
NM_007294.3(BRCA1):c.670+1delG rs886040922
NM_007294.3(BRCA1):c.671-1G>A rs80358020
NM_007294.3(BRCA1):c.671-1G>T rs80358020
NM_007294.3(BRCA1):c.671-215_901del rs1555592870
NM_007294.3(BRCA1):c.671-26_1781del
NM_007294.3(BRCA1):c.671-2A>C rs80358108
NM_007294.3(BRCA1):c.671-2A>G rs80358108
NM_007294.3(BRCA1):c.671-2A>T rs80358108
NM_007294.3(BRCA1):c.671-?_4185+?del
NM_007294.3(BRCA1):c.671-?_4484+?del
NM_007294.3(BRCA1):c.671-?_4675+?del
NM_007294.3(BRCA1):c.676delT (p.Cys226Valfs) rs80357941
NM_007294.3(BRCA1):c.678T>A (p.Cys226Ter) rs397509308
NM_007294.3(BRCA1):c.678_679insC (p.Glu227Argfs) rs1555593321
NM_007294.3(BRCA1):c.679G>T (p.Glu227Ter) rs879255319
NM_007294.3(BRCA1):c.67_68insC (p.Glu23Alafs) rs1555600897
NM_007294.3(BRCA1):c.685delT (p.Ser229Leufs) rs80357824
NM_007294.3(BRCA1):c.689_692delAGAC (p.Glu230Glyfs) rs886040308
NM_007294.3(BRCA1):c.68_69delAG (p.Glu23Valfs) rs386833395
NM_007294.3(BRCA1):c.68_69dupAG (p.Cys24Serfs) rs80357914
NM_007294.3(BRCA1):c.68_70delAGT (p.Glu23_Cys24delinsGly) rs1555600876
NM_007294.3(BRCA1):c.68del (p.Glu23Glyfs) rs886040309
NM_007294.3(BRCA1):c.68dupA (p.Cys24Valfs) rs397509309
NM_007294.3(BRCA1):c.695dup (p.Asp232Glufs) rs1555593302
NM_007294.3(BRCA1):c.697_698delGT (p.Val233Asnfs) rs80357747
NM_007294.3(BRCA1):c.697_699delGTA (p.Val233del) rs1555593294
NM_007294.3(BRCA1):c.69dup (p.Cys24Valfs) rs1555600893
NM_007294.3(BRCA1):c.700_704delACAAA (p.Thr234Tyrfs) rs1135401837
NM_007294.3(BRCA1):c.704del (p.Asn235Ilefs) rs886040310
NM_007294.3(BRCA1):c.707del (p.Thr236Metfs) rs886040311
NM_007294.3(BRCA1):c.70T>C (p.Cys24Arg) rs80357410
NM_007294.3(BRCA1):c.70_71insA (p.Cys24Terfs) rs80357536
NM_007294.3(BRCA1):c.70_71insTGTC (p.Cys24Leufs) rs80357536
NM_007294.3(BRCA1):c.70_73dupTGTC (p.Pro25Leufs) rs397509310
NM_007294.3(BRCA1):c.70_80delTGTCCCATCTG (p.Cys24Serfs) rs80357696
NM_007294.3(BRCA1):c.715delC (p.His239Ilefs) rs879255294
NM_007294.3(BRCA1):c.718C>T (p.Gln240Ter) rs886040313
NM_007294.3(BRCA1):c.71_72del (p.Cys24Serfs) rs886040312
NM_007294.3(BRCA1):c.71_72insA (p.Cys24Terfs) rs1555600873
NM_007294.3(BRCA1):c.729_730insGTAACAAATACTGAACATCATCAACCCAGTA (p.Asn244Valfs) rs886040314
NM_007294.3(BRCA1):c.72_73delTC (p.Pro25Hisfs) rs397509311
NM_007294.3(BRCA1):c.72_73insGTCT (p.Pro25Valfs) rs1555600872
NM_007294.3(BRCA1):c.730_731insGTAACAAATACTGAACATCATCAACCCAGTA (p.Asn244Serfs) rs1555593246
NM_007294.3(BRCA1):c.731delA (p.Asn244Metfs) rs80357700
NM_007294.3(BRCA1):c.737T>A (p.Leu246Ter) rs886037977
NM_007294.3(BRCA1):c.737delT (p.Leu246Terfs) rs397509312
NM_007294.3(BRCA1):c.742dupA (p.Thr248Asnfs) rs397509314
NM_007294.3(BRCA1):c.743_744insA (p.Thr249Hisfs) rs886040315
NM_007294.3(BRCA1):c.744delC (p.Thr249Leufs) rs1060502360
NM_007294.3(BRCA1):c.745_746delAC (p.Thr249Terfs) rs886037978
NM_007294.3(BRCA1):c.745dup (p.Thr249Asnfs) rs1555593207
NM_007294.3(BRCA1):c.74_75delCC (p.Pro25Hisfs) rs80357633
NM_007294.3(BRCA1):c.750_751del (p.Lys251Alafs) rs886040316
NM_007294.3(BRCA1):c.763G>T (p.Glu255Ter) rs80357009
NM_007294.3(BRCA1):c.770_771insGA (p.His257Glnfs) rs1555593134
NM_007294.3(BRCA1):c.770dup (p.His257Glnfs) rs1555593134
NM_007294.3(BRCA1):c.775delG (p.Glu259Lysfs) rs80357628
NM_007294.3(BRCA1):c.778_779dup (p.Tyr261Serfs) rs886040317
NM_007294.3(BRCA1):c.77T>A (p.Ile26Asn) rs879255496
NM_007294.3(BRCA1):c.783T>G (p.Tyr261Ter) rs80357321
NM_007294.3(BRCA1):c.784C>T (p.Gln262Ter) rs886037979
NM_007294.3(BRCA1):c.784delC (p.Gln262Argfs) rs886040318
NM_007294.3(BRCA1):c.788dupG (p.Ser264Terfs) rs886040319
NM_007294.3(BRCA1):c.791_794delGTTC (p.Ser264Metfs) rs80357707
NM_007294.3(BRCA1):c.794_795delCT (p.Ser265Cysfs) rs80357955
NM_007294.3(BRCA1):c.796_807delGTTTCAAACTTGinsA (p.Val266Thrfs) rs1064792958
NM_007294.3(BRCA1):c.799dupT (p.Ser267Phefs) rs80357724
NM_007294.3(BRCA1):c.80+1G>A rs80358010
NM_007294.3(BRCA1):c.80+1G>C rs80358010
NM_007294.3(BRCA1):c.80+1G>T rs80358010
NM_007294.3(BRCA1):c.80+2T>A rs80358128
NM_007294.3(BRCA1):c.80+2T>G rs80358128
NM_007294.3(BRCA1):c.80+5G>A rs80358045
NM_007294.3(BRCA1):c.800C>A (p.Ser267Ter) rs80357392
NM_007294.3(BRCA1):c.800C>G (p.Ser267Ter) rs80357392
NM_007294.3(BRCA1):c.807_808ins11 (p.?)
NM_007294.3(BRCA1):c.807_817dup (p.Pro273Argfs) rs886040320
NM_007294.3(BRCA1):c.809delA (p.His270Leufs) rs80357965
NM_007294.3(BRCA1):c.81-1588_134+1725del
NM_007294.3(BRCA1):c.81-1G>A rs80358018
NM_007294.3(BRCA1):c.81-1G>C rs80358018
NM_007294.3(BRCA1):c.81-2A>G rs397509326
NM_007294.3(BRCA1):c.81-2delA rs273902791
NM_007294.3(BRCA1):c.81-?_134+?del
NM_007294.3(BRCA1):c.81-?_134+?dup
NM_007294.3(BRCA1):c.81-?_4185+?del
NM_007294.3(BRCA1):c.81-?_441+?del
NM_007294.3(BRCA1):c.81-?_4986+?del
NM_007294.3(BRCA1):c.81-?_5152+?dup
NM_007294.3(BRCA1):c.81-?_5193+?del
NM_007294.3(BRCA1):c.81-?_547+?dup
NM_007294.3(BRCA1):c.814G>T (p.Glu272Ter) rs886040321
NM_007294.3(BRCA1):c.814_824dupGAGCCATGTGG (p.Thr276Serfs) rs1555593031
NM_007294.3(BRCA1):c.815_816insTCCATGTGGA (p.Glu272Aspfs) rs886040322
NM_007294.3(BRCA1):c.815_824dupAGCCATGTGG (p.Thr276Alafs) rs387906563
NM_007294.3(BRCA1):c.816_817insTCCATGTGGA (p.Pro273Serfs) rs1555593043
NM_007294.3(BRCA1):c.81_134del54 (p.Cys27_Ile379delinsTer) rs1555599208
NM_007294.3(BRCA1):c.822T>A (p.Cys274Ter) rs80357331
NM_007294.3(BRCA1):c.824_825ins10 (p.?)
NM_007294.3(BRCA1):c.825_828delCACAinsAAT (p.Thr276Ilefs) rs1555593020
NM_007294.3(BRCA1):c.828_829insT (p.Asn277Terfs) rs1555593017
NM_007294.3(BRCA1):c.829_830del (p.Asn277Tyrfs) rs886040323
NM_007294.3(BRCA1):c.829_836del (p.Asn277Cysfs) rs886040324
NM_007294.3(BRCA1):c.832dupA (p.Thr278Asnfs) rs886040325
NM_007294.3(BRCA1):c.833_834insA (p.His279Serfs) rs483353108
NM_007294.3(BRCA1):c.834_835insA (p.His279Thrfs) rs1555593007
NM_007294.3(BRCA1):c.835delC (p.His279Metfs) rs80357523
NM_007294.3(BRCA1):c.83_84delTG (p.Leu28Argfs) rs80357728
NM_007294.3(BRCA1):c.841_842dupAG (p.Ser281Argfs) rs80357792
NM_007294.3(BRCA1):c.843_846delCTCA (p.Ser282Tyrfs) rs80357919
NM_007294.3(BRCA1):c.844_850dupTCATTAC (p.Gln284Leufs) rs80357989
NM_007294.3(BRCA1):c.845C>A (p.Ser282Ter) rs786203027
NM_007294.3(BRCA1):c.848T>A (p.Leu283Ter) rs273902792
NM_007294.3(BRCA1):c.848T>G (p.Leu283Ter) rs273902792
NM_007294.3(BRCA1):c.848_879del32 (p.Leu283Terfs) rs886039501
NM_007294.3(BRCA1):c.850C>T (p.Gln284Ter) rs397509330
NM_007294.3(BRCA1):c.851_852delAG (p.Gln284Profs) rs80357719
NM_007294.3(BRCA1):c.851_852ins7
NM_007294.3(BRCA1):c.856G>T (p.Glu286Ter) rs886037980
NM_007294.3(BRCA1):c.85G>T (p.Glu29Ter) rs80357443
NM_007294.3(BRCA1):c.861_862dup (p.Ser288Thrfs) rs886040326
NM_007294.3(BRCA1):c.862delA (p.Ser288Alafs) rs886040327
NM_007294.3(BRCA1):c.869T>G (p.Leu290Ter) rs730881468
NM_007294.3(BRCA1):c.869delT (p.Leu290Tyrfs) rs1555592956
NM_007294.3(BRCA1):c.873dup (p.Leu292Thrfs) rs886040328
NM_007294.3(BRCA1):c.874del (p.Leu292Serfs) rs886040329
NM_007294.3(BRCA1):c.875delT (p.Leu292Profs) rs886037981
NM_007294.3(BRCA1):c.876_879delCACT (p.Thr293Lysfs) rs1555592938
NM_007294.3(BRCA1):c.880_884delAAAGA (p.Lys294Glnfs) rs1135401838
NM_007294.3(BRCA1):c.882delA (p.Asp295Thrfs) rs80357587
NM_007294.3(BRCA1):c.885_886delCA (p.Asp295Glufs) rs786204261
NM_007294.3(BRCA1):c.885_888delCAGA (p.Asp295Glufs) rs1060502359
NM_007294.3(BRCA1):c.886A>T (p.Arg296Ter) rs748675395
NM_007294.3(BRCA1):c.886delA (p.Arg296Glufs) rs869320786
NM_007294.3(BRCA1):c.891_896delGAATGTinsTC (p.Met297Ilefs) rs1064793967
NM_007294.3(BRCA1):c.892_895dupAATG (p.Val299Glufs) rs80357806
NM_007294.3(BRCA1):c.895_896delGT (p.Val299Argfs) rs80357670
NM_007294.3(BRCA1):c.897delA (p.Glu300Lysfs) rs886037982
NM_007294.3(BRCA1):c.898G>T (p.Glu300Ter) rs886040330
NM_007294.3(BRCA1):c.89T>A (p.Leu30Ter) rs397509331
NM_007294.3(BRCA1):c.8T>G (p.Leu3Ter) rs397509332
NM_007294.3(BRCA1):c.902_903insT (p.Lys301Asnfs) rs80357726
NM_007294.3(BRCA1):c.903_904insT (p.Ala302Cysfs) rs397509333
NM_007294.3(BRCA1):c.904delG (p.Ala302Leufs) rs273903793
NM_007294.3(BRCA1):c.905dup (p.Glu303Terfs) rs1555592859
NM_007294.3(BRCA1):c.909delA (p.Glu303Aspfs) rs397509334
NM_007294.3(BRCA1):c.911delT (p.Phe304Serfs) rs80357622
NM_007294.3(BRCA1):c.922_923delAG (p.Ser308Glnfs) rs80357644
NM_007294.3(BRCA1):c.922_924delAGCinsT (p.Ser308Terfs) rs397509335
NM_007294.3(BRCA1):c.923_924del (p.Ser308Lysfs) rs886040331
NM_007294.3(BRCA1):c.923delG (p.Ser308Thrfs) rs80357953
NM_007294.3(BRCA1):c.924delC (p.Ser308Argfs) rs397509336
NM_007294.3(BRCA1):c.925A>T (p.Lys309Ter) rs879255498
NM_007294.3(BRCA1):c.927delA (p.Lys309Asnfs) rs397509337
NM_007294.3(BRCA1):c.928C>T (p.Gln310Ter) rs397509338
NM_007294.3(BRCA1):c.929delA (p.Gln310Argfs) rs80357844
NM_007294.3(BRCA1):c.930delG (p.Gln310Hisfs) rs80357689
NM_007294.3(BRCA1):c.933delT (p.Gly312Alafs) rs1135401839
NM_007294.3(BRCA1):c.936delC (p.Leu313Terfs) rs398122709
NM_007294.3(BRCA1):c.93del (p.Lys32Argfs) rs886040332
NM_007294.3(BRCA1):c.944_1007del64 (p.Arg315Lysfs) rs1555592683
NM_007294.3(BRCA1):c.949C>T (p.Gln317Ter) rs80357211
NM_007294.3(BRCA1):c.949_953delCAACA (p.Gln317Terfs) rs80357555
NM_007294.3(BRCA1):c.952_1015del64 (p.His318Argfs) rs80359872
NM_007294.3(BRCA1):c.953del (p.His318Leufs) rs886040333
NM_007294.3(BRCA1):c.954_955insGT (p.Asn319Valfs) rs80357690
NM_007294.3(BRCA1):c.955_956insGT (p.Asn319Serfs) rs1555592770
NM_007294.3(BRCA1):c.958del (p.Arg320Aspfs) rs886040334
NM_007294.3(BRCA1):c.959_960delGA (p.Arg320Metfs) rs397509339
NM_007294.3(BRCA1):c.961delT (p.Trp321Glyfs) rs397509340
NM_007294.3(BRCA1):c.962G>A (p.Trp321Ter) rs80357292
NM_007294.3(BRCA1):c.963G>A (p.Trp321Ter) rs886040335
NM_007294.3(BRCA1):c.964_968delGCTGG (p.Ala322Lysfs) rs1555592744
NM_007294.3(BRCA1):c.964delG (p.Ala322Leufs) rs273903794
NM_007294.3(BRCA1):c.966del (p.Gly323Glufs) rs886040336
NM_007294.3(BRCA1):c.979del (p.Thr327Hisfs) rs886040337
NM_007294.3(BRCA1):c.980_981delCA (p.Thr327Metfs) rs80357610
NM_007294.3(BRCA1):c.981_982delAT (p.Cys328Terfs) rs80357772
NM_007294.3(BRCA1):c.984_985insC (p.Asn329Glnfs) rs80357775
NM_007294.3(BRCA1):c.984_988delTAATG (p.Cys328Terfs) rs786204262
NM_007294.3(BRCA1):c.985_986delAA (p.Asn329Terfs) rs397509341
NM_007294.3(BRCA1):c.985_986insC (p.Asn329Thrfs) rs1555592723
NM_007294.3(BRCA1):c.98_105del (p.Glu33Valfs) rs886040338
NM_007294.3(BRCA1):c.[5243_5277+2788del;5277+2916_5277+2946delinsGG]
NM_007294.3:c.133_137delinsT
NM_007294.3:c.2071_2171del101 rs1555590294
NM_007294.3:c.2255_2259delTAAGT
NM_007299.3(BRCA1):c.1865_1868delGAAA rs80357867
NM_007299.3(BRCA1):c.787+11_787+12delTT rs80357724
NM_007299.3(BRCA1):c.787+323delT rs1555592474
NM_007300.3(BRCA1):c.1731dup (p.Ser578Ilefs) rs1064797381
NM_007300.3(BRCA1):c.2488_2504dup (p.His835Glnfs) rs483353078
NP_009225.1(BRCA1):p.Ala521Ter
NP_009225.1(BRCA1):p.Cys39Ser
NP_009225.1(BRCA1):p.Gly1738Arg
NP_009225.1(BRCA1):p.Leu1086Ter
NP_009225.1(BRCA1):p.Leu1230Ter
NP_009225.1(BRCA1):p.Leu598Ter
NP_009225.1(BRCA1):p.Leu63Ter
NP_009225.1(BRCA1):p.Ser1383Ter
NP_009225.1(BRCA1):p.Ser713Ter
NP_009225.1(BRCA1):p.Ser864Ter
NP_009225.1(BRCA1):p.Ser868Ter
NP_009225.1(BRCA1):p.Ser955Ter
NP_009225.1(BRCA1):p.Trp1508Ter
NP_009225.1(BRCA1):p.Trp1712Ter
NP_009225.1(BRCA1):p.Trp1782Ter
NP_009225.1(BRCA1):p.Trp1815Ter
NP_009225.1(BRCA1):p.Trp321Ter
NP_009225.1(BRCA1):p.Tyr1563Ter
NP_009225.1(BRCA1):p.Tyr1703Ter
NP_009225.1(BRCA1):p.Tyr261Ter
NP_009225.1:p.Ser1007Ter
Single allele
U14680.1:n.2294delG
U14680.1:n.2494delC
U14680.1:n.3235_3238delCAGC
U14680.1:n.3702delA

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.