ClinVar Miner

List of variants in gene BRCA1 studied for Hereditary breast and ovarian cancer syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2878
Download table as spreadsheet
HGVS dbSNP
NC_000017.10:g.(?_41196312)_(41197819_?)del
NC_000017.10:g.(?_41196312)_(41209152_?)del
NC_000017.10:g.(?_41196312)_(41251897_?)del
NC_000017.10:g.(?_41197675)_(41197839_?)del
NC_000017.10:g.(?_41197675)_(41199740_?)del
NC_000017.10:g.(?_41197675)_(41199740_?)dup
NC_000017.10:g.(?_41197675)_(41203154_?)del
NC_000017.10:g.(?_41197675)_(41209172_?)dup
NC_000017.10:g.(?_41197689)_(41199726_?)del
NC_000017.10:g.(?_41197689)_(41258556_?)del
NC_000017.10:g.(?_41197689)_(41267802_?)del
NC_000017.10:g.(?_41197689)_(41267802_?)dup
NC_000017.10:g.(?_41197695)_(41203134_?)del
NC_000017.10:g.(?_41199654)_(41251903_?)del
NC_000017.10:g.(?_41201118)_(41203154_?)dup
NC_000017.10:g.(?_41201201)_(41209076_?)del
NC_000017.10:g.(?_41203074)_(41203140_?)del
NC_000017.10:g.(?_41209049)_(41209172_?)del
NC_000017.10:g.(?_41209049)_(41215988_?)dup
NC_000017.10:g.(?_41209063)_(41209158_?)del
NC_000017.10:g.(?_41209063)_(41209158_?)dup
NC_000017.10:g.(?_41209063)_(41226544_?)del
NC_000017.10:g.(?_41215330)_(41215988_?)dup
NC_000017.10:g.(?_41215344)_(41215396_?)del
NC_000017.10:g.(?_41219605)_(41219732_?)dup
NC_000017.10:g.(?_41219605)_(41228651_?)dup
NC_000017.10:g.(?_41219619)_(41228637_?)dup
NC_000017.10:g.(?_41222939)_(41228637_?)del
NC_000017.10:g.(?_41226328)_(41267816_?)del
NC_000017.10:g.(?_41226342)_(41246883_?)del
NC_000017.10:g.(?_41226342)_(41267802_?)del
NC_000017.10:g.(?_41228505)_(41234592_?)dup
NC_000017.10:g.(?_41234401)_(41234612_?)del
NC_000017.10:g.(?_41234401)_(41234612_?)dup
NC_000017.10:g.(?_41234401)_(41258570_?)dup
NC_000017.10:g.(?_41234415)_(41258556_?)dup
NC_000017.10:g.(?_41242941)_(41258570_?)del
NC_000017.10:g.(?_41242955)_(41258556_?)del
NC_000017.10:g.(?_41247857)_(41258556_?)del
NC_000017.10:g.(?_41249255)_(41258556_?)dup
NC_000017.10:g.(?_41251772)_(41251917_?)dup
NC_000017.10:g.(?_41251772)_(41267816_?)del
NC_000017.10:g.(?_41251772)_(41267816_?)dup
NC_000017.10:g.(?_41256119)_(41267816_?)del
NC_000017.10:g.(?_41256133)_(41267802_?)del
NC_000017.10:g.(?_41256865)_(41258570_?)del
NC_000017.10:g.(?_41258467)_(41258556_?)del
NC_000017.10:g.(?_41258467)_(41258556_?)dup
NC_000017.10:g.(?_41267737)_(41267802_?)dup
NG_005905.2:g.145185_151339del6155
NG_005905.2:g.160396_164568del4173
NG_005905.2:g.163181_169408del6228
NM_007294.3(BRCA1):c.(?_-1)_80+?del
NM_007294.3(BRCA1):c.(?_-1)_80+?dup
NM_007294.3(BRCA1):c.*1113G>A rs111791349
NM_007294.3(BRCA1):c.*1285C>A rs757676381
NM_007294.3(BRCA1):c.*1286C>T rs548275991
NM_007294.3(BRCA1):c.*1287C>T rs12516
NM_007294.3(BRCA1):c.*1292T>C rs182218567
NM_007294.3(BRCA1):c.*1323A>G rs189382442
NM_007294.3(BRCA1):c.*1327G>A rs184237074
NM_007294.3(BRCA1):c.*291C>T rs878854928
NM_007294.3(BRCA1):c.*36C>G rs3092995
NM_007294.3(BRCA1):c.*387T>G rs886052973
NM_007294.3(BRCA1):c.*421G>T rs8176318
NM_007294.3(BRCA1):c.*465G>A rs886052972
NM_007294.3(BRCA1):c.*485G>A rs527725740
NM_007294.3(BRCA1):c.*528G>C rs1060504556
NM_007294.3(BRCA1):c.*58C>T rs137892861
NM_007294.3(BRCA1):c.*693C>T rs540031582
NM_007294.3(BRCA1):c.*743G>T rs886052971
NM_007294.3(BRCA1):c.*750A>G rs138782023
NM_007294.3(BRCA1):c.*781C>T rs8176319
NM_007294.3(BRCA1):c.*854_*855delCA rs886052969
NM_007294.3(BRCA1):c.*854delC rs886052970
NM_007294.3(BRCA1):c.*872_*873delAA rs59541324
NM_007294.3(BRCA1):c.*873delA rs59541324
NM_007294.3(BRCA1):c.-16A>G rs777262055
NM_007294.3(BRCA1):c.-19-?_441+?dup
NM_007294.3(BRCA1):c.-19-?_5406+?dup
NM_007294.3(BRCA1):c.-19-?_80+?del
NM_007294.3(BRCA1):c.-19-?_80+?dup
NM_007294.3(BRCA1):c.1000C>A (p.Pro334Thr) rs1555592700
NM_007294.3(BRCA1):c.1001C>T (p.Pro334Leu) rs41286290
NM_007294.3(BRCA1):c.1005C>A (p.Ser335Arg) rs876660367
NM_007294.3(BRCA1):c.1008A>G (p.Thr336=) rs1060504568
NM_007294.3(BRCA1):c.1012A>G (p.Lys338Glu) rs397508826
NM_007294.3(BRCA1):c.1012A>T (p.Lys338Ter) rs397508826
NM_007294.3(BRCA1):c.1016A>C (p.Lys339Thr) rs587781737
NM_007294.3(BRCA1):c.1016A>G (p.Lys339Arg) rs587781737
NM_007294.3(BRCA1):c.1016del (p.Lys339fs) rs80357569
NM_007294.3(BRCA1):c.1016dup (p.Val340fs) rs80357569
NM_007294.3(BRCA1):c.1017G>A (p.Lys339=) rs863224416
NM_007294.3(BRCA1):c.1018del (p.Lys339_Val340insTer) rs80357774
NM_007294.3(BRCA1):c.101del (p.Pro34fs) rs80357750
NM_007294.3(BRCA1):c.1021G>A (p.Asp341Asn) rs756987689
NM_007294.3(BRCA1):c.1022A>C (p.Asp341Ala) rs1567801162
NM_007294.3(BRCA1):c.1025T>A (p.Leu342Gln)
NM_007294.3(BRCA1):c.1026G>A (p.Leu342=) rs1171571879
NM_007294.3(BRCA1):c.102del (p.Val35fs) rs886039922
NM_007294.3(BRCA1):c.1031C>A (p.Ala344Asp)
NM_007294.3(BRCA1):c.1033G>T (p.Asp345Tyr) rs80356961
NM_007294.3(BRCA1):c.1036C>G (p.Pro346Ala) rs80357015
NM_007294.3(BRCA1):c.1036C>T (p.Pro346Ser) rs80357015
NM_007294.3(BRCA1):c.1038C>T (p.Pro346=) rs1555592618
NM_007294.3(BRCA1):c.1039C>T (p.Leu347=) rs1378561919
NM_007294.3(BRCA1):c.103G>T (p.Val35Phe) rs879255284
NM_007294.3(BRCA1):c.1041G>A (p.Leu347=) rs1555592609
NM_007294.3(BRCA1):c.1054G>A (p.Glu352Lys) rs80357472
NM_007294.3(BRCA1):c.1054G>T (p.Glu352Ter) rs80357472
NM_007294.3(BRCA1):c.1058G>A (p.Trp353Ter) rs80356908
NM_007294.3(BRCA1):c.1058_1062del (p.Glu352_Trp353insTer) rs1555592576
NM_007294.3(BRCA1):c.1059G>A (p.Trp353Ter) rs80356935
NM_007294.3(BRCA1):c.105_134+1007del
NM_007294.3(BRCA1):c.1061A>G (p.Asn354Ser) rs1555592577
NM_007294.3(BRCA1):c.1061A>T (p.Asn354Ile) rs1555592577
NM_007294.3(BRCA1):c.1065G>A (p.Lys355=) rs41286292
NM_007294.3(BRCA1):c.1066C>T (p.Gln356Ter) rs80357215
NM_007294.3(BRCA1):c.1067A>G (p.Gln356Arg) rs1799950
NM_007294.3(BRCA1):c.106T>A (p.Ser36Thr) rs905812561
NM_007294.3(BRCA1):c.1072del (p.Leu358fs) rs80357836
NM_007294.3(BRCA1):c.1075C>T (p.Pro359Ser) rs767666190
NM_007294.3(BRCA1):c.107C>A (p.Ser36Tyr) rs183557525
NM_007294.3(BRCA1):c.1081T>C (p.Ser361Pro) rs80356946
NM_007294.3(BRCA1):c.1082C>T (p.Ser361Leu) rs397508833
NM_007294.3(BRCA1):c.1082_1092del (p.Cys360_Ser361insTer) rs80359880
NM_007294.3(BRCA1):c.1083dup (p.Glu362fs) rs1135401840
NM_007294.3(BRCA1):c.1084_1085GA[1] (p.Asn363fs) rs80357897
NM_007294.3(BRCA1):c.1086_1141del (p.Asn363fs) rs80359875
NM_007294.3(BRCA1):c.1088del (p.Asn363fs) rs80357954
NM_007294.3(BRCA1):c.1091_1092del (p.Pro364fs) rs1555592526
NM_007294.3(BRCA1):c.1092T>C (p.Pro364=) rs1555592521
NM_007294.3(BRCA1):c.1093A>T (p.Arg365Ter) rs398122627
NM_007294.3(BRCA1):c.1099A>G (p.Thr367Ala) rs878854929
NM_007294.3(BRCA1):c.10T>C (p.Ser4Pro) rs876658707
NM_007294.3(BRCA1):c.1102G>T (p.Glu368Ter) rs80357139
NM_007294.3(BRCA1):c.1105G>A (p.Asp369Asn) rs56056711
NM_007294.3(BRCA1):c.1106_1108del (p.Asp369del) rs80358325
NM_007294.3(BRCA1):c.1108G>A (p.Val370Ile)
NM_007294.3(BRCA1):c.1114T>A (p.Trp372Arg) rs1306111238
NM_007294.3(BRCA1):c.1114T>C (p.Trp372Arg) rs1306111238
NM_007294.3(BRCA1):c.1116G>A (p.Trp372Ter) rs80357468
NM_007294.3(BRCA1):c.1121del (p.Thr374fs) rs80357612
NM_007294.3(BRCA1):c.1125A>G (p.Leu375=) rs1060504578
NM_007294.3(BRCA1):c.112_113del (p.Lys38fs) rs80357949
NM_007294.3(BRCA1):c.1132_1135del (p.Ser378fs) rs1135401841
NM_007294.3(BRCA1):c.1134C>A (p.Ser378Arg) rs863224752
NM_007294.3(BRCA1):c.1135A>G (p.Ile379Val) rs864622723
NM_007294.3(BRCA1):c.1136T>C (p.Ile379Thr) rs1567800757
NM_007294.3(BRCA1):c.1137T>G (p.Ile379Met) rs56128296
NM_007294.3(BRCA1):c.1139A>C (p.Gln380Pro) rs876659193
NM_007294.3(BRCA1):c.1139A>G (p.Gln380Arg) rs876659193
NM_007294.3(BRCA1):c.1140dup (p.Lys381fs) rs876659327
NM_007294.3(BRCA1):c.1141A>T (p.Lys381Ter) rs80357385
NM_007294.3(BRCA1):c.1142A>G (p.Lys381Arg) rs1555592379
NM_007294.3(BRCA1):c.1148del (p.Asn383fs) rs878854930
NM_007294.3(BRCA1):c.114G>A (p.Lys38=) rs1800062
NM_007294.3(BRCA1):c.1155G>A (p.Trp385Ter) rs876660558
NM_007294.3(BRCA1):c.1155G>T (p.Trp385Cys) rs876660558
NM_007294.3(BRCA1):c.1159T>A (p.Ser387Thr) rs876659403
NM_007294.3(BRCA1):c.115T>A (p.Cys39Ser) rs80357164
NM_007294.3(BRCA1):c.115T>C (p.Cys39Arg) rs80357164
NM_007294.3(BRCA1):c.1165del (p.Ser389fs) rs80357985
NM_007294.3(BRCA1):c.116G>A (p.Cys39Tyr) rs80357498
NM_007294.3(BRCA1):c.116G>T (p.Cys39Phe) rs80357498
NM_007294.3(BRCA1):c.1175T>C (p.Leu392Pro) rs777305766
NM_007294.3(BRCA1):c.1175_1214del (p.Leu392fs) rs80359874
NM_007294.3(BRCA1):c.1179_1180dup (p.Gly394fs) rs1555592304
NM_007294.3(BRCA1):c.117T>A (p.Cys39Ter) rs886040898
NM_007294.3(BRCA1):c.117T>G (p.Cys39Trp) rs886040898
NM_007294.3(BRCA1):c.1186G>A (p.Asp396Asn) rs786203145
NM_007294.3(BRCA1):c.1187A>G (p.Asp396Gly) rs1555592280
NM_007294.3(BRCA1):c.1188del (p.Asp396fs) rs397508845
NM_007294.3(BRCA1):c.1190A>T (p.Asp397Val)
NM_007294.3(BRCA1):c.1190del (p.Asp397fs) rs748714307
NM_007294.3(BRCA1):c.1193C>T (p.Ser398Leu)
NM_007294.3(BRCA1):c.1196A>G (p.His399Arg) rs587780794
NM_007294.3(BRCA1):c.1197T>C (p.His399=) rs1555592250
NM_007294.3(BRCA1):c.1201G>A (p.Gly401Arg) rs1555592242
NM_007294.3(BRCA1):c.1202G>A (p.Gly401Glu) rs397507184
NM_007294.3(BRCA1):c.1204G>A (p.Glu402Lys)
NM_007294.3(BRCA1):c.1204del (p.Glu402fs) rs80357859
NM_007294.3(BRCA1):c.1205A>T (p.Glu402Val) rs1555592216
NM_007294.3(BRCA1):c.120C>T (p.Asp40=) rs1060504580
NM_007294.3(BRCA1):c.1214C>G (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1215A>G (p.Ser405=) rs786201517
NM_007294.3(BRCA1):c.1217dup (p.Asn406fs) rs397508846
NM_007294.3(BRCA1):c.121C>A (p.His41Asn) rs1060502353
NM_007294.3(BRCA1):c.121C>T (p.His41Tyr)
NM_007294.3(BRCA1):c.1222A>G (p.Lys408Glu) rs80357253
NM_007294.3(BRCA1):c.1222A>T (p.Lys408Ter) rs80357253
NM_007294.3(BRCA1):c.1224del (p.Lys408_Val409insTer) rs879255320
NM_007294.3(BRCA1):c.1228G>A (p.Ala410Thr) rs779974365
NM_007294.3(BRCA1):c.122A>G (p.His41Arg) rs80357276
NM_007294.3(BRCA1):c.122_134delinsT (p.His41_Lys45delinsLeu) rs1555599205
NM_007294.3(BRCA1):c.1230del (p.Asp411fs) rs1555592108
NM_007294.3(BRCA1):c.1233T>G (p.Asp411Glu) rs80357024
NM_007294.3(BRCA1):c.1237T>C (p.Leu413=) rs574008372
NM_007294.3(BRCA1):c.123C>T (p.His41=) rs786202211
NM_007294.3(BRCA1):c.1240dup (p.Asp414fs) rs786204260
NM_007294.3(BRCA1):c.1241A>C (p.Asp414Ala) rs1555592086
NM_007294.3(BRCA1):c.1241dupA (p.Asp414Glufs) rs80357514
NM_007294.3(BRCA1):c.1242C>T (p.Asp414=) rs372400428
NM_007294.3(BRCA1):c.1243G>A (p.Val415Ile) rs587782770
NM_007294.3(BRCA1):c.1243G>T (p.Val415Phe) rs587782770
NM_007294.3(BRCA1):c.1248A>G (p.Leu416=) rs1057522369
NM_007294.3(BRCA1):c.124A>G (p.Ile42Val) rs80357163
NM_007294.3(BRCA1):c.124del (p.Ile42fs) rs80357943
NM_007294.3(BRCA1):c.1250A>G (p.Asn417Ser) rs80357113
NM_007294.3(BRCA1):c.1252del (p.Glu418fs) rs876660623
NM_007294.3(BRCA1):c.1252dup (p.Glu418fs) rs886039936
NM_007294.3(BRCA1):c.1253A>C (p.Glu418Ala) rs1555592050
NM_007294.3(BRCA1):c.1255G>C (p.Val419Leu) rs876658873
NM_007294.3(BRCA1):c.1255del (p.Glu418_Val419insTer) rs80357535
NM_007294.3(BRCA1):c.1256T>G (p.Val419Gly) rs398122628
NM_007294.3(BRCA1):c.1258G>A (p.Asp420Asn)
NM_007294.3(BRCA1):c.1258G>T (p.Asp420Tyr) rs80357488
NM_007294.3(BRCA1):c.1259A>G (p.Asp420Gly) rs730881442
NM_007294.3(BRCA1):c.1264T>C (p.Tyr422His) rs764186025
NM_007294.3(BRCA1):c.1270G>C (p.Gly424Arg) rs763051683
NM_007294.3(BRCA1):c.1278A>G (p.Ser426=) rs1442003131
NM_007294.3(BRCA1):c.1285del (p.Lys428_Ile429insTer) rs1567800172
NM_007294.3(BRCA1):c.1286T>C (p.Ile429Thr) rs775869160
NM_007294.3(BRCA1):c.1287_1288insC (p.Asp430fs) rs1555592003
NM_007294.3(BRCA1):c.1287dupA (p.Asp430Argfs) rs80357576
NM_007294.3(BRCA1):c.128T>C (p.Phe43Ser) rs1298544053
NM_007294.3(BRCA1):c.1291T>A (p.Leu431Ile)
NM_007294.3(BRCA1):c.1292del (p.Leu431fs) rs80357528
NM_007294.3(BRCA1):c.1292dupT (p.Leu431Phefs) rs80357528
NM_007294.3(BRCA1):c.1293dup (p.Leu432fs)
NM_007294.3(BRCA1):c.1294C>T (p.Leu432=) rs864622454
NM_007294.3(BRCA1):c.1297del (p.Ala433fs) rs80357794
NM_007294.3(BRCA1):c.1308T>C (p.Pro436=) rs770279083
NM_007294.3(BRCA1):c.130T>A (p.Cys44Ser) rs80357327
NM_007294.3(BRCA1):c.130del (p.Cys44fs) rs80357951
NM_007294.3(BRCA1):c.1310_1313del (p.His437fs) rs1555591959
NM_007294.3(BRCA1):c.1315G>T (p.Ala439Ser) rs1064794098
NM_007294.3(BRCA1):c.1317T>C (p.Ala439=) rs1555591949
NM_007294.3(BRCA1):c.131G>T (p.Cys44Phe) rs80357446
NM_007294.3(BRCA1):c.1321dup (p.Ile441fs) rs1135401843
NM_007294.3(BRCA1):c.1325_1326dup (p.Lys443fs) rs80357543
NM_007294.3(BRCA1):c.1326T>A (p.Cys442Ter) rs397508854
NM_007294.3(BRCA1):c.1327A>T (p.Lys443Ter) rs398122630
NM_007294.3(BRCA1):c.1329A>G (p.Lys443=) rs771892131
NM_007294.3(BRCA1):c.132C>G (p.Cys44Trp)
NM_007294.3(BRCA1):c.1333G>C (p.Glu445Gln) rs80356915
NM_007294.3(BRCA1):c.1333G>T (p.Glu445Ter) rs80356915
NM_007294.3(BRCA1):c.1336A>G (p.Arg446Gly) rs587781715
NM_007294.3(BRCA1):c.1339G>A (p.Val447Ile) rs587782784
NM_007294.3(BRCA1):c.133A>C (p.Lys45Gln) rs769650474
NM_007294.3(BRCA1):c.133_134+3delAAGTAinsT rs397508856
NM_007294.3(BRCA1):c.134+13G>A rs1555599185
NM_007294.3(BRCA1):c.134+15G>A rs863224417
NM_007294.3(BRCA1):c.134+18A>T rs1555599182
NM_007294.3(BRCA1):c.134+19T>C rs1060504590
NM_007294.3(BRCA1):c.134+1G>C rs80358043
NM_007294.3(BRCA1):c.134+2T>C rs80358131
NM_007294.3(BRCA1):c.134+3A>G rs80358064
NM_007294.3(BRCA1):c.134+3A>T rs80358064
NM_007294.3(BRCA1):c.1340_1341insG (p.His448fs) rs80357597
NM_007294.3(BRCA1):c.1342C>T (p.His448Tyr) rs786203578
NM_007294.3(BRCA1):c.1343A>C (p.His448Pro)
NM_007294.3(BRCA1):c.1345T>C (p.Ser449Pro)
NM_007294.3(BRCA1):c.134A>C (p.Lys45Thr) rs80356863
NM_007294.3(BRCA1):c.135-11A>G rs769549104
NM_007294.3(BRCA1):c.135-15_135-12delCTTT rs878854931
NM_007294.3(BRCA1):c.135-16T>G rs775525479
NM_007294.3(BRCA1):c.135-18T>G rs80358085
NM_007294.3(BRCA1):c.135-1G>A rs80358158
NM_007294.3(BRCA1):c.135-1G>C rs80358158
NM_007294.3(BRCA1):c.135-1G>T rs80358158
NM_007294.3(BRCA1):c.135-2A>G rs80358065
NM_007294.3(BRCA1):c.135-3T>C rs759417413
NM_007294.3(BRCA1):c.135-5T>C rs587781916
NM_007294.3(BRCA1):c.135-7T>C rs1555597333
NM_007294.3(BRCA1):c.135-8_135-2delATTTATA rs1555597329
NM_007294.3(BRCA1):c.135-?_441+?del
NM_007294.3(BRCA1):c.135-?_441+?dup
NM_007294.3(BRCA1):c.135-?_5193+?del
NM_007294.3(BRCA1):c.1355T>C (p.Val452Ala) rs878854932
NM_007294.3(BRCA1):c.1356_1357AG[2] (p.Glu453_Ser454insTer) rs80357969
NM_007294.3(BRCA1):c.1356del (p.Glu453fs) rs80357939
NM_007294.3(BRCA1):c.1357G>C (p.Glu453Gln) rs768054411
NM_007294.3(BRCA1):c.1361G>A (p.Ser454Asn) rs80357181
NM_007294.3(BRCA1):c.1367T>C (p.Ile456Thr) rs80357360
NM_007294.3(BRCA1):c.1379T>G (p.Ile460Arg) rs398122634
NM_007294.3(BRCA1):c.1380dupA (p.Ile460_Phe461delinsIleIleTrpfs) rs80357714
NM_007294.3(BRCA1):c.1381T>C (p.Phe461Leu) rs62625300
NM_007294.3(BRCA1):c.1383dup (p.Gly462fs) rs80357879
NM_007294.3(BRCA1):c.1384G>A (p.Gly462Arg) rs80357221
NM_007294.3(BRCA1):c.1384_1393dup (p.Tyr465fs) rs397508864
NM_007294.3(BRCA1):c.1386del (p.Thr464fs) rs80357722
NM_007294.3(BRCA1):c.1387_1390delinsGAAAG (p.Lys463fs) rs80357770
NM_007294.3(BRCA1):c.1389_1390delinsG (p.Thr464fs) rs273897659
NM_007294.3(BRCA1):c.1390_1391insG (p.Thr464fs) rs397508867
NM_007294.3(BRCA1):c.1391_1392insG (p.Tyr465fs) rs1135401845
NM_007294.3(BRCA1):c.1392C>T (p.Thr464=) rs533802049
NM_007294.3(BRCA1):c.1393dup (p.Tyr465fs) rs1555591812
NM_007294.3(BRCA1):c.1394A>G (p.Tyr465Cys) rs876659885
NM_007294.3(BRCA1):c.1397G>A (p.Arg466Gln) rs199540030
NM_007294.3(BRCA1):c.1398G>A (p.Arg466=) rs1060504571
NM_007294.3(BRCA1):c.139T>C (p.Cys47Arg)
NM_007294.3(BRCA1):c.139T>G (p.Cys47Gly) rs80357370
NM_007294.3(BRCA1):c.139dup (p.Cys47fs) rs80357734
NM_007294.3(BRCA1):c.1400A>G (p.Lys467Arg) rs876659316
NM_007294.3(BRCA1):c.1405G>A (p.Ala469Thr) rs397507187
NM_007294.3(BRCA1):c.1407_1408del (p.Ser470fs) rs879255476
NM_007294.3(BRCA1):c.140G>T (p.Cys47Phe) rs80357150
NM_007294.3(BRCA1):c.1418A>C (p.Asn473Thr)
NM_007294.3(BRCA1):c.1418A>G (p.Asn473Ser) rs80357057
NM_007294.3(BRCA1):c.1419C>T (p.Asn473=) rs777228325
NM_007294.3(BRCA1):c.1419_1422del (p.Asn473fs) rs886039952
NM_007294.3(BRCA1):c.141C>A (p.Cys47Ter) rs398122635
NM_007294.3(BRCA1):c.141C>T (p.Cys47=) rs398122635
NM_007294.3(BRCA1):c.1423A>G (p.Ser475Gly)
NM_007294.3(BRCA1):c.1423A>T (p.Ser475Cys) rs1064794047
NM_007294.3(BRCA1):c.1424G>A (p.Ser475Asn)
NM_007294.3(BRCA1):c.1427A>G (p.His476Arg) rs55720177
NM_007294.3(BRCA1):c.1428T>C (p.His476=) rs1060504572
NM_007294.3(BRCA1):c.1434T>G (p.Thr478=) rs876658280
NM_007294.3(BRCA1):c.1439dupA (p.Asn480Lysfs) rs80357505
NM_007294.3(BRCA1):c.143del (p.Met48fs) rs80357637
NM_007294.3(BRCA1):c.1440_1441insA (p.Leu481fs) rs80357778
NM_007294.3(BRCA1):c.1441C>G (p.Leu481Val) rs1397842308
NM_007294.3(BRCA1):c.1444_1447del (p.Leu481_Ile482insTer) rs80357801
NM_007294.3(BRCA1):c.1446_1448del (p.Ile483del) rs80358327
NM_007294.3(BRCA1):c.1448T>C (p.Ile483Thr) rs80357489
NM_007294.3(BRCA1):c.144G>A (p.Met48Ile) rs587783040
NM_007294.3(BRCA1):c.1450G>A (p.Gly484Arg)
NM_007294.3(BRCA1):c.1450G>T (p.Gly484Ter) rs80357304
NM_007294.3(BRCA1):c.1456T>A (p.Phe486Ile) rs55906931
NM_007294.3(BRCA1):c.1456T>C (p.Phe486Leu) rs55906931
NM_007294.3(BRCA1):c.1459G>T (p.Val487Phe) rs369588942
NM_007294.3(BRCA1):c.1462dup (p.Thr488fs) rs80357599
NM_007294.3(BRCA1):c.1464T>C (p.Thr488=) rs1555591722
NM_007294.3(BRCA1):c.1470A>G (p.Pro490=) rs775032066
NM_007294.3(BRCA1):c.1471C>T (p.Gln491Ter) rs62625303
NM_007294.3(BRCA1):c.1474A>G (p.Ile492Val)
NM_007294.3(BRCA1):c.1478T>C (p.Ile493Thr) rs1555591707
NM_007294.3(BRCA1):c.1480C>T (p.Gln494Ter) rs80357010
NM_007294.3(BRCA1):c.1480dup (p.Gln494fs) rs1555591706
NM_007294.3(BRCA1):c.1483_1498del (p.Glu495fs) rs397508872
NM_007294.3(BRCA1):c.1484A>C (p.Glu495Ala) rs1567799498
NM_007294.3(BRCA1):c.1486C>T (p.Arg496Cys) rs28897676
NM_007294.3(BRCA1):c.1487G>A (p.Arg496His) rs28897677
NM_007294.3(BRCA1):c.1492del (p.Leu498fs) rs80357527
NM_007294.3(BRCA1):c.1496C>T (p.Thr499Ile) rs876658285
NM_007294.3(BRCA1):c.14C>T (p.Ala5Val) rs1335137805
NM_007294.3(BRCA1):c.1504_1508del (p.Leu502fs) rs80357888
NM_007294.3(BRCA1):c.1505_1509del (p.Leu502fs) rs876659139
NM_007294.3(BRCA1):c.1506A>G (p.Leu502=) rs786203671
NM_007294.3(BRCA1):c.1508A>G (p.Lys503Arg) rs62625304
NM_007294.3(BRCA1):c.1508del (p.Lys503fs) rs80357506
NM_007294.3(BRCA1):c.1510C>T (p.Arg504Cys) rs80357445
NM_007294.3(BRCA1):c.1510del (p.Arg504fs) rs80357908
NM_007294.3(BRCA1):c.1511G>A (p.Arg504His) rs56272539
NM_007294.3(BRCA1):c.1512dup (p.Lys505Ter) rs398122636
NM_007294.3(BRCA1):c.1514A>T (p.Lys505Ile) rs879254266
NM_007294.3(BRCA1):c.1524T>G (p.Pro508=) rs200616937
NM_007294.3(BRCA1):c.1530A>T (p.Ser510=) rs1555591599
NM_007294.3(BRCA1):c.1531G>A (p.Gly511Ser) rs1567799248
NM_007294.3(BRCA1):c.1533C>A (p.Gly511=) rs1280391272
NM_007294.3(BRCA1):c.1534C>G (p.Leu512Val) rs41286294
NM_007294.3(BRCA1):c.1534C>T (p.Leu512Phe) rs41286294
NM_007294.3(BRCA1):c.1538A>G (p.His513Arg) rs1356078500
NM_007294.3(BRCA1):c.1540C>A (p.Pro514Thr) rs1555591584
NM_007294.3(BRCA1):c.154C>A (p.Leu52Ile) rs80357084
NM_007294.3(BRCA1):c.154C>T (p.Leu52Phe) rs80357084
NM_007294.3(BRCA1):c.1551del (p.Phe517fs) rs80357630
NM_007294.3(BRCA1):c.1553T>C (p.Ile518Thr) rs1567799193
NM_007294.3(BRCA1):c.1556del (p.Lys519fs) rs80357662
NM_007294.3(BRCA1):c.1558A>C (p.Lys520Gln) rs1555591572
NM_007294.3(BRCA1):c.155T>C (p.Leu52Pro) rs1060502346
NM_007294.3(BRCA1):c.1561G>A (p.Ala521Thr) rs80357122
NM_007294.3(BRCA1):c.1561_1562delinsTA (p.Ala521Ter) rs273897663
NM_007294.3(BRCA1):c.1561_1564delinsTAAA (p.Ala521_Asp522delinsTer) rs397508883
NM_007294.3(BRCA1):c.1567T>C (p.Leu523=) rs754398271
NM_007294.3(BRCA1):c.1568T>G (p.Leu523Trp) rs397508885
NM_007294.3(BRCA1):c.1571C>T (p.Ala524Val) rs80357333
NM_007294.3(BRCA1):c.1573G>A (p.Val525Ile) rs80357273
NM_007294.3(BRCA1):c.1576_1577del (p.Gln526fs) rs1567799078
NM_007294.3(BRCA1):c.1580A>G (p.Lys527Arg) rs774959350
NM_007294.3(BRCA1):c.159C>T (p.Asn53=) rs1060504588
NM_007294.3(BRCA1):c.1600C>T (p.Gln534Ter) rs142074233
NM_007294.3(BRCA1):c.1601A>G (p.Gln534Arg) rs80357173
NM_007294.3(BRCA1):c.1601_1602del (p.Gln534fs) rs878854933
NM_007294.3(BRCA1):c.1603G>A (p.Gly535Arg) rs1555591488
NM_007294.3(BRCA1):c.1609A>G (p.Asn537Asp) rs398122639
NM_007294.3(BRCA1):c.160C>A (p.Gln54Lys) rs80356864
NM_007294.3(BRCA1):c.1612C>T (p.Gln538Ter) rs80356893
NM_007294.3(BRCA1):c.1612_1616del (p.Gln538fs) rs587776480
NM_007294.3(BRCA1):c.1616C>A (p.Thr539Lys) rs80357374
NM_007294.3(BRCA1):c.1616C>T (p.Thr539Met) rs80357374
NM_007294.3(BRCA1):c.1617G>A (p.Thr539=) rs372002119
NM_007294.3(BRCA1):c.1620G>C (p.Glu540Asp) rs1555591465
NM_007294.3(BRCA1):c.1621C>T (p.Gln541Ter) rs80356904
NM_007294.3(BRCA1):c.1624A>G (p.Asn542Asp) rs1555591461
NM_007294.3(BRCA1):c.1630C>T (p.Gln544Ter) rs80356952
NM_007294.3(BRCA1):c.1631_1632delinsGG (p.Gln544Arg) rs1555591449
NM_007294.3(BRCA1):c.1638G>A (p.Met546Ile) rs1060502340
NM_007294.3(BRCA1):c.1638_1646delinsA (p.Met546fs) rs1135401846
NM_007294.3(BRCA1):c.1639A>C (p.Asn547His) rs1060502351
NM_007294.3(BRCA1):c.1641_1642insG (p.Ile548fs)
NM_007294.3(BRCA1):c.1648A>C (p.Asn550His) rs56012641
NM_007294.3(BRCA1):c.1649A>G (p.Asn550Ser) rs1064795217
NM_007294.3(BRCA1):c.1649del (p.Asn550fs) rs80357619
NM_007294.3(BRCA1):c.1654G>A (p.Gly552Ser) rs758598971
NM_007294.3(BRCA1):c.1662G>C (p.Glu554Asp) rs876659028
NM_007294.3(BRCA1):c.1666A>G (p.Lys556Glu)
NM_007294.3(BRCA1):c.1673_1674del (p.Lys558fs) rs80357600
NM_007294.3(BRCA1):c.1674del (p.Gly559fs) rs80357600
NM_007294.3(BRCA1):c.1675G>A (p.Gly559Ser) rs1555591384
NM_007294.3(BRCA1):c.1684A>G (p.Ile562Val) rs1567798727
NM_007294.3(BRCA1):c.1685T>C (p.Ile562Thr) rs1555591375
NM_007294.3(BRCA1):c.1687C>T (p.Gln563Ter) rs80356898
NM_007294.3(BRCA1):c.1690A>T (p.Asn564Tyr) rs397507191
NM_007294.3(BRCA1):c.1696A>G (p.Lys566Glu)
NM_007294.3(BRCA1):c.16C>T (p.Leu6Phe)
NM_007294.3(BRCA1):c.1700dup (p.Asn567fs) rs80357784
NM_007294.3(BRCA1):c.1701T>G (p.Asn567Lys) rs1555591359
NM_007294.3(BRCA1):c.1702C>T (p.Pro568Ser) rs755122577
NM_007294.3(BRCA1):c.1703C>T (p.Pro568Leu) rs80356910
NM_007294.3(BRCA1):c.1704T>C (p.Pro568=) rs587780795
NM_007294.3(BRCA1):c.1704T>G (p.Pro568=) rs587780795
NM_007294.3(BRCA1):c.1705A>G (p.Asn569Asp) rs587781315
NM_007294.3(BRCA1):c.1706A>T (p.Asn569Ile) rs1060502329
NM_007294.3(BRCA1):c.1709C>A (p.Pro570Gln) rs879254020
NM_007294.3(BRCA1):c.1710A>G (p.Pro570=) rs876659901
NM_007294.3(BRCA1):c.1711A>G (p.Ile571Val) rs1310719199
NM_007294.3(BRCA1):c.1712T>C (p.Ile571Thr) rs80357159
NM_007294.3(BRCA1):c.1713A>G (p.Ile571Met) rs552505690
NM_007294.3(BRCA1):c.1713_1717del (p.Glu572fs) rs80357640
NM_007294.3(BRCA1):c.1718C>T (p.Ser573Leu) rs876660434
NM_007294.3(BRCA1):c.171del (p.Pro58fs) rs80357660
NM_007294.3(BRCA1):c.171dup (p.Pro58fs) rs80357660
NM_007294.3(BRCA1):c.1721T>C (p.Leu574Pro) rs1060502341
NM_007294.3(BRCA1):c.1723G>A (p.Glu575Lys) rs397508902
NM_007294.3(BRCA1):c.1723G>T (p.Glu575Ter) rs397508902
NM_007294.3(BRCA1):c.1724A>G (p.Glu575Gly) rs111539978
NM_007294.3(BRCA1):c.1725_1726insG (p.Lys576fs) rs1135401847
NM_007294.3(BRCA1):c.1729G>T (p.Glu577Ter) rs397508903
NM_007294.3(BRCA1):c.1731A>G (p.Glu577=) rs28897678
NM_007294.3(BRCA1):c.1745C>T (p.Thr582Met) rs786202386
NM_007294.3(BRCA1):c.1747A>G (p.Lys583Glu) rs80356928
NM_007294.3(BRCA1):c.1749A>G (p.Lys583=) rs876659580
NM_007294.3(BRCA1):c.1759A>G (p.Ile587Val)
NM_007294.3(BRCA1):c.1760T>C (p.Ile587Thr)
NM_007294.3(BRCA1):c.1762A>G (p.Ser588Gly) rs1169162396
NM_007294.3(BRCA1):c.1763_1764delinsTT (p.Ser588Ile) rs1555591274
NM_007294.3(BRCA1):c.1769G>A (p.Ser590Asn) rs1060502349
NM_007294.3(BRCA1):c.1771A>G (p.Ile591Val) rs1064795358
NM_007294.3(BRCA1):c.1773A>G (p.Ile591Met) rs1555591259
NM_007294.3(BRCA1):c.1774A>C (p.Ser592Arg)
NM_007294.3(BRCA1):c.1775G>A (p.Ser592Asn) rs786203044
NM_007294.3(BRCA1):c.1779T>C (p.Asn593=) rs1060504563
NM_007294.3(BRCA1):c.1780del (p.Met594fs) rs1135401848
NM_007294.3(BRCA1):c.1785del (p.Glu595fs) rs1567798263
NM_007294.3(BRCA1):c.1788C>T (p.Leu596=) rs779253414
NM_007294.3(BRCA1):c.1789G>A (p.Glu597Lys) rs55650082
NM_007294.3(BRCA1):c.1789G>T (p.Glu597Ter) rs55650082
NM_007294.3(BRCA1):c.178C>T (p.Gln60Ter) rs80357471
NM_007294.3(BRCA1):c.1792T>C (p.Leu598=) rs1060504554
NM_007294.3(BRCA1):c.1792T>G (p.Leu598Val)
NM_007294.3(BRCA1):c.1793T>A (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1794A>G (p.Leu598=) rs876659644
NM_007294.3(BRCA1):c.1796A>G (p.Asn599Ser)
NM_007294.3(BRCA1):c.1797T>C (p.Asn599=) rs756211343
NM_007294.3(BRCA1):c.1799T>C (p.Ile600Thr) rs398122643
NM_007294.3(BRCA1):c.1799del (p.Ile600fs) rs878854934
NM_007294.3(BRCA1):c.179A>G (p.Gln60Arg) rs373655067
NM_007294.3(BRCA1):c.179del (p.Gln60fs) rs80357591
NM_007294.3(BRCA1):c.1802A>G (p.His601Arg) rs371631805
NM_007294.3(BRCA1):c.1807T>G (p.Ser603Ala) rs1555591208
NM_007294.3(BRCA1):c.1812del (p.Ala605fs) rs80357927
NM_007294.3(BRCA1):c.1814C>A (p.Ala605Glu) rs1555591195
NM_007294.3(BRCA1):c.181T>G (p.Cys61Gly) rs28897672
NM_007294.3(BRCA1):c.1823_1826delAGAA (p.Lys608Ilefs) rs80357585
NM_007294.3(BRCA1):c.1824_1826del (p.Lys608del) rs587781614
NM_007294.3(BRCA1):c.1825_1829del (p.Asn609fs) rs1555591170
NM_007294.3(BRCA1):c.1829G>A (p.Arg610Lys) rs876660322
NM_007294.3(BRCA1):c.182G>A (p.Cys61Tyr) rs80357093
NM_007294.3(BRCA1):c.1830G>A (p.Arg610=) rs587780796
NM_007294.3(BRCA1):c.1831del (p.Arg610_Leu611insTer) rs397508913
NM_007294.3(BRCA1):c.1834A>G (p.Arg612Gly) rs80357245
NM_007294.3(BRCA1):c.1836dup (p.Arg613fs) rs876660523
NM_007294.3(BRCA1):c.1837A>G (p.Arg613Gly) rs863224753
NM_007294.3(BRCA1):c.1838G>A (p.Arg613Lys) rs786203937
NM_007294.3(BRCA1):c.1839G>A (p.Arg613=) rs759157605
NM_007294.3(BRCA1):c.1839_1841delinsAGT (p.Lys614Val)
NM_007294.3(BRCA1):c.183T>C (p.Cys61=) rs895070717
NM_007294.3(BRCA1):c.1840A>T (p.Lys614Ter) rs80357282
NM_007294.3(BRCA1):c.1842G>A (p.Lys614=) rs760109939
NM_007294.3(BRCA1):c.1842G>T (p.Lys614Asn) rs760109939
NM_007294.3(BRCA1):c.1843_1845TCT[1] (p.Ser616del) rs80358329
NM_007294.3(BRCA1):c.1849A>G (p.Thr617Ala) rs45564238
NM_007294.3(BRCA1):c.1851C>G (p.Thr617=) rs1555591097
NM_007294.3(BRCA1):c.1854G>A (p.Arg618=) rs1060504585
NM_007294.3(BRCA1):c.1856A>G (p.His619Arg) rs771890863
NM_007294.3(BRCA1):c.185_190del (p.Pro62_Cys64delinsArg) rs1555597224
NM_007294.3(BRCA1):c.1865C>G (p.Ala622Gly)
NM_007294.3(BRCA1):c.1865C>T (p.Ala622Val) rs56039126
NM_007294.3(BRCA1):c.1866G>A (p.Ala622=) rs1800064
NM_007294.3(BRCA1):c.1868T>C (p.Leu623Pro) rs397508915
NM_007294.3(BRCA1):c.1873C>T (p.Leu625=) rs769044421
NM_007294.3(BRCA1):c.1874_1877dupTAGT (p.Val627Serfs) rs80357516
NM_007294.3(BRCA1):c.1875A>G (p.Leu625=) rs786201429
NM_007294.3(BRCA1):c.1878A>G (p.Val626=) rs8176154
NM_007294.3(BRCA1):c.1879G>A (p.Val627Ile) rs80357425
NM_007294.3(BRCA1):c.1881C>T (p.Val627=) rs80356838
NM_007294.3(BRCA1):c.1881_1884del (p.Ser628fs) rs80357567
NM_007294.3(BRCA1):c.1882A>G (p.Ser628Gly) rs1555591000
NM_007294.3(BRCA1):c.1889del (p.Asn630fs)
NM_007294.3(BRCA1):c.188T>A (p.Leu63Ter) rs80357086
NM_007294.3(BRCA1):c.1892T>C (p.Leu631Pro) rs1386991114
NM_007294.3(BRCA1):c.1892dupT (p.Ser632Lysfs) rs80357932
NM_007294.3(BRCA1):c.1893A>C (p.Leu631=) rs80356834
NM_007294.3(BRCA1):c.1895G>A (p.Ser632Asn) rs80356983
NM_007294.3(BRCA1):c.1897C>T (p.Pro633Ser) rs80356902
NM_007294.3(BRCA1):c.1898C>T (p.Pro633Leu) rs398122647
NM_007294.3(BRCA1):c.189A>T (p.Leu63Phe) rs80356956
NM_007294.3(BRCA1):c.1905T>C (p.Asn635=) rs369373293
NM_007294.3(BRCA1):c.1906del (p.Cys636fs) rs397508916
NM_007294.3(BRCA1):c.1907G>A (p.Cys636Tyr) rs398122649
NM_007294.3(BRCA1):c.1907G>C (p.Cys636Ser)
NM_007294.3(BRCA1):c.190T>G (p.Cys64Gly) rs80357064
NM_007294.3(BRCA1):c.1911T>C (p.Thr637=) rs62625305
NM_007294.3(BRCA1):c.1916T>A (p.Leu639Ter) rs80357267
NM_007294.3(BRCA1):c.1918C>T (p.Gln640Ter) rs886039981
NM_007294.3(BRCA1):c.191G>A (p.Cys64Tyr) rs55851803
NM_007294.3(BRCA1):c.191G>C (p.Cys64Ser) rs55851803
NM_007294.3(BRCA1):c.1920A>G (p.Gln640=) rs587782843
NM_007294.3(BRCA1):c.1920A>T (p.Gln640His) rs587782843
NM_007294.3(BRCA1):c.1922T>C (p.Ile641Thr) rs730881474
NM_007294.3(BRCA1):c.1923dup (p.Asp642Ter) rs878854935
NM_007294.3(BRCA1):c.1924G>C (p.Asp642His) rs80357344
NM_007294.3(BRCA1):c.1925A>G (p.Asp642Gly) rs786204049
NM_007294.3(BRCA1):c.1928G>T (p.Ser643Ile) rs876660335
NM_007294.3(BRCA1):c.1929T>G (p.Ser643Arg) rs1060502361
NM_007294.3(BRCA1):c.192T>G (p.Cys64Trp) rs587781632
NM_007294.3(BRCA1):c.1930T>A (p.Cys644Ser) rs753521391
NM_007294.3(BRCA1):c.1933T>C (p.Ser645Pro)
NM_007294.3(BRCA1):c.1934C>A (p.Ser645Tyr) rs80357129
NM_007294.3(BRCA1):c.1934C>G (p.Ser645Cys) rs80357129
NM_007294.3(BRCA1):c.1938_1947del (p.Ser646fs) rs397508920
NM_007294.3(BRCA1):c.193A>G (p.Lys65Glu) rs756948486
NM_007294.3(BRCA1):c.1944A>G (p.Glu648=) rs876660781
NM_007294.3(BRCA1):c.1945G>C (p.Glu649Gln) rs80356907
NM_007294.3(BRCA1):c.1949T>C (p.Ile650Thr) rs1555590816
NM_007294.3(BRCA1):c.1949dup (p.Lys652fs) rs879255480
NM_007294.3(BRCA1):c.1950A>T (p.Ile650=) rs1060504579
NM_007294.3(BRCA1):c.1951A>G (p.Lys651Glu)
NM_007294.3(BRCA1):c.1952dupA (p.Lys652Glufs) rs80357885
NM_007294.3(BRCA1):c.1953_1956delGAAA (p.Lys653Serfs) rs80357526
NM_007294.3(BRCA1):c.1953dupG (p.Lys652Glufs) rs80357753
NM_007294.3(BRCA1):c.1959A>G (p.Lys653=) rs767530204
NM_007294.3(BRCA1):c.1960A>C (p.Lys654Gln)
NM_007294.3(BRCA1):c.1960A>T (p.Lys654Ter) rs80357355
NM_007294.3(BRCA1):c.1960_1961del (p.Lys654fs) rs80357522
NM_007294.3(BRCA1):c.1961del (p.Lys654fs) rs80357522
NM_007294.3(BRCA1):c.1961dupA (p.Lys654delinsLysValfs) rs80357522
NM_007294.3(BRCA1):c.1962_1968del (p.Lys654fs) rs1135401849
NM_007294.3(BRCA1):c.1962dup (p.Tyr655fs) rs1567797549
NM_007294.3(BRCA1):c.1969C>A (p.Gln657Lys) rs397508926
NM_007294.3(BRCA1):c.1969C>T (p.Gln657Ter) rs397508926
NM_007294.3(BRCA1):c.1971A>G (p.Gln657=) rs28897679
NM_007294.3(BRCA1):c.1974G>C (p.Met658Ile) rs55678461
NM_007294.3(BRCA1):c.1975C>G (p.Pro659Ala) rs587776481
NM_007294.3(BRCA1):c.1978del (p.Val660fs) rs886039988
NM_007294.3(BRCA1):c.1979T>C (p.Val660Ala) rs1567797385
NM_007294.3(BRCA1):c.1981A>G (p.Arg661Gly) rs1555590724
NM_007294.3(BRCA1):c.1983G>A (p.Arg661=) rs869320788
NM_007294.3(BRCA1):c.198T>C (p.Asn66=) rs878854936
NM_007294.3(BRCA1):c.1994del (p.Asn665fs) rs1555590714
NM_007294.3(BRCA1):c.1997T>C (p.Leu666Pro) rs1567797346
NM_007294.3(BRCA1):c.1998A>G (p.Leu666=) rs864622452
NM_007294.3(BRCA1):c.199G>T (p.Asp67Tyr) rs80357102
NM_007294.3(BRCA1):c.19C>A (p.Arg7Ser) rs80356994
NM_007294.3(BRCA1):c.19C>T (p.Arg7Cys) rs80356994
NM_007294.3(BRCA1):c.19_47del (p.Arg7fs) rs80359871
NM_007294.3(BRCA1):c.1A>G (p.Met1Val) rs80357287
NM_007294.3(BRCA1):c.2001A>G (p.Gln667=) rs878854937
NM_007294.3(BRCA1):c.2001dup (p.Leu668fs) rs80357521
NM_007294.3(BRCA1):c.2002C>T (p.Leu668Phe) rs80357250
NM_007294.3(BRCA1):c.2008G>A (p.Glu670Lys) rs80357029
NM_007294.3(BRCA1):c.200A>T (p.Asp67Val) rs1060502331
NM_007294.3(BRCA1):c.2017G>C (p.Glu673Gln)
NM_007294.3(BRCA1):c.2019del (p.Glu673fs) rs80357626
NM_007294.3(BRCA1):c.2021C>G (p.Pro674Arg) rs876660543
NM_007294.3(BRCA1):c.2022T>G (p.Pro674=) rs771519405
NM_007294.3(BRCA1):c.2022_2023dup (p.Ala675fs)
NM_007294.3(BRCA1):c.2023G>A (p.Ala675Thr)
NM_007294.3(BRCA1):c.2029G>A (p.Gly677Arg)
NM_007294.3(BRCA1):c.202A>G (p.Ile68Val) rs1555597195
NM_007294.3(BRCA1):c.202dup (p.Ile68fs) rs886039990
NM_007294.3(BRCA1):c.2033C>T (p.Ala678Val) rs1555590634
NM_007294.3(BRCA1):c.2035A>T (p.Lys679Ter) rs80357082
NM_007294.3(BRCA1):c.2037delinsCC (p.Lys679fs) rs397508932
NM_007294.3(BRCA1):c.2038A>T (p.Lys680Ter) rs1135401850
NM_007294.3(BRCA1):c.2042G>A (p.Ser681Asn) rs1452826319
NM_007294.3(BRCA1):c.2043T>G (p.Ser681Arg) rs143920945
NM_007294.3(BRCA1):c.2043dup (p.Asn682Ter) rs863224510
NM_007294.3(BRCA1):c.2048A>G (p.Lys683Arg) rs1060502357
NM_007294.3(BRCA1):c.2050C>T (p.Pro684Ser) rs397508934
NM_007294.3(BRCA1):c.2060A>C (p.Gln687Pro) rs28897680
NM_007294.3(BRCA1):c.2066dup (p.Ser689fs) rs1567797130
NM_007294.3(BRCA1):c.206C>T (p.Thr69Ile) rs273898675
NM_007294.3(BRCA1):c.2070_2071del (p.Arg691fs) rs80357688
NM_007294.3(BRCA1):c.2071del (p.Arg691fs) rs80357688
NM_007294.3(BRCA1):c.2072G>C (p.Arg691Thr) rs1555590574
NM_007294.3(BRCA1):c.2077G>A (p.Asp693Asn) rs4986850
NM_007294.3(BRCA1):c.2077_2078insTA (p.Asp693fs) rs80357595
NM_007294.3(BRCA1):c.2079_2080del (p.Asp693fs) rs80357773
NM_007294.3(BRCA1):c.2082C>T (p.Ser694=) rs1799949
NM_007294.3(BRCA1):c.2083G>T (p.Asp695Tyr) rs28897681
NM_007294.3(BRCA1):c.2086A>G (p.Thr696Ala) rs80357441
NM_007294.3(BRCA1):c.2090T>C (p.Phe697Ser) rs730881476
NM_007294.3(BRCA1):c.2090del (p.Phe697fs) rs886039996
NM_007294.3(BRCA1):c.2090dup (p.Glu699fs) rs886039996
NM_007294.3(BRCA1):c.2093C>T (p.Pro698Leu) rs1555590478
NM_007294.3(BRCA1):c.20G>A (p.Arg7His) rs144792613
NM_007294.3(BRCA1):c.2101A>T (p.Lys701Ter) rs876660282
NM_007294.3(BRCA1):c.2101_2102del (p.Lys701fs) rs431825389
NM_007294.3(BRCA1):c.2102A>G (p.Lys701Arg) rs876658307
NM_007294.3(BRCA1):c.2103G>A (p.Lys701=) rs273898677
NM_007294.3(BRCA1):c.2105dup (p.Leu702fs) rs80357880
NM_007294.3(BRCA1):c.2109A>G (p.Thr703=) rs4986844
NM_007294.3(BRCA1):c.2110_2111del (p.Asn704fs) rs80357814
NM_007294.3(BRCA1):c.2115A>G (p.Ala705=) rs1131692099
NM_007294.3(BRCA1):c.2116C>T (p.Pro706Ser)
NM_007294.3(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.3(BRCA1):c.212+10T>G rs80358174
NM_007294.3(BRCA1):c.212+13G>A rs752088834
NM_007294.3(BRCA1):c.212+15A>G rs587780797
NM_007294.3(BRCA1):c.212+17T>C rs369461674
NM_007294.3(BRCA1):c.212+1G>A rs80358042
NM_007294.3(BRCA1):c.212+1G>C rs80358042
NM_007294.3(BRCA1):c.212+1G>T rs80358042
NM_007294.3(BRCA1):c.212+23T>A rs8176128
NM_007294.3(BRCA1):c.212+3A>G rs80358083
NM_007294.3(BRCA1):c.212+4T>C rs398122652
NM_007294.3(BRCA1):c.212+4T>G
NM_007294.3(BRCA1):c.2123C>A (p.Ser708Tyr) rs80357182
NM_007294.3(BRCA1):c.2123C>T (p.Ser708Phe) rs80357182
NM_007294.3(BRCA1):c.2125_2126insA (p.Phe709fs) rs80357871
NM_007294.3(BRCA1):c.2126T>G (p.Phe709Cys) rs1567796937
NM_007294.3(BRCA1):c.2126_2127del (p.Phe709fs) rs397508939
NM_007294.3(BRCA1):c.2126_2127insA (p.Phe709fs) rs1135401851
NM_007294.3(BRCA1):c.2128A>G (p.Thr710Ala) rs876659959
NM_007294.3(BRCA1):c.212G>A (p.Arg71Lys) rs80356913
NM_007294.3(BRCA1):c.212G>C (p.Arg71Thr) rs80356913
NM_007294.3(BRCA1):c.213-11T>G rs80358061
NM_007294.3(BRCA1):c.213-12A>G rs80358163
NM_007294.3(BRCA1):c.213-14C>G rs1060502337
NM_007294.3(BRCA1):c.213-2A>T
NM_007294.3(BRCA1):c.2130delinsAA (p.Cys712fs) rs1060502332
NM_007294.3(BRCA1):c.2131A>C (p.Lys711Gln) rs747046197
NM_007294.3(BRCA1):c.2131_2132del (p.Lys711fs) rs398122653
NM_007294.3(BRCA1):c.2133_2134GT[1] (p.Cys712fs) rs886040001
NM_007294.3(BRCA1):c.2135G>T (p.Cys712Phe) rs1555590395
NM_007294.3(BRCA1):c.2138C>G (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2143_2155delinsTCTTT (p.Thr715fs) rs1567796807
NM_007294.3(BRCA1):c.2155A>G (p.Lys719Glu) rs80357147
NM_007294.3(BRCA1):c.2155_2163del (p.Lys719_Phe721del) rs863224841
NM_007294.3(BRCA1):c.2157dup (p.Glu720fs) rs80357715
NM_007294.3(BRCA1):c.2160del (p.Glu720fs)
NM_007294.3(BRCA1):c.2162_2163del (p.Phe721fs) rs1555590319
NM_007294.3(BRCA1):c.2165T>C (p.Val722Ala) rs1555590311
NM_007294.3(BRCA1):c.2167A>G (p.Asn723Asp) rs4986845
NM_007294.3(BRCA1):c.2171C>T (p.Pro724Leu)
NM_007294.3(BRCA1):c.2174G>C (p.Ser725Thr) rs1555590284
NM_007294.3(BRCA1):c.2176_2177del (p.Leu726fs) rs397508945
NM_007294.3(BRCA1):c.2176del (p.Leu726fs) rs80357668
NM_007294.3(BRCA1):c.217C>T (p.Leu73=) rs786201203
NM_007294.3(BRCA1):c.2185G>T (p.Glu729Ter) rs876659852
NM_007294.3(BRCA1):c.2188dup (p.Glu730fs) rs80357566
NM_007294.3(BRCA1):c.2194G>T (p.Glu732Ter) rs80357426
NM_007294.3(BRCA1):c.2197_2201del (p.Glu733fs) rs80357507
NM_007294.3(BRCA1):c.2199del (p.Lys734fs) rs80357944
NM_007294.3(BRCA1):c.219A>G (p.Leu73=) rs876659123
NM_007294.3(BRCA1):c.21C>T (p.Arg7=) rs149402012
NM_007294.3(BRCA1):c.2203C>G (p.Leu735Val) rs587781781
NM_007294.3(BRCA1):c.2203C>T (p.Leu735=) rs587781781
NM_007294.3(BRCA1):c.2207A>C (p.Glu736Ala) rs397507196
NM_007294.3(BRCA1):c.2209A>G (p.Thr737Ala) rs1567796585
NM_007294.3(BRCA1):c.2209del (p.Thr737fs) rs1060502333
NM_007294.3(BRCA1):c.220C>T (p.Gln74Ter) rs80357234
NM_007294.3(BRCA1):c.2210_2211del (p.Thr737fs) rs80357654
NM_007294.3(BRCA1):c.2211_2213del (p.Val738del) rs1555590179
NM_007294.3(BRCA1):c.2214del (p.Val740fs) rs80357574
NM_007294.3(BRCA1):c.2214dup (p.Lys739Ter) rs80357574
NM_007294.3(BRCA1):c.2215A>C (p.Lys739Gln) rs56329598
NM_007294.3(BRCA1):c.2215A>T (p.Lys739Ter) rs56329598
NM_007294.3(BRCA1):c.2217A>C (p.Lys739Asn) rs200521980
NM_007294.3(BRCA1):c.2217A>G (p.Lys739=) rs200521980
NM_007294.3(BRCA1):c.2217dup (p.Val740fs) rs80357802
NM_007294.3(BRCA1):c.2218G>C (p.Val740Leu) rs80357415
NM_007294.3(BRCA1):c.2218G>T (p.Val740Leu) rs80357415
NM_007294.3(BRCA1):c.2222C>T (p.Ser741Phe) rs80357051
NM_007294.3(BRCA1):c.2224A>G (p.Asn742Asp) rs876658733
NM_007294.3(BRCA1):c.2226_2227del (p.Asn742fs) rs878854938
NM_007294.3(BRCA1):c.2228del (p.Asn743fs) rs1555590121
NM_007294.3(BRCA1):c.222A>C (p.Gln74His) rs730881465
NM_007294.3(BRCA1):c.222A>G (p.Gln74=) rs730881465
NM_007294.3(BRCA1):c.2231C>A (p.Ala744Asp) rs786204220
NM_007294.3(BRCA1):c.2232T>A (p.Ala744=)
NM_007294.3(BRCA1):c.2232T>C (p.Ala744=) rs4986846
NM_007294.3(BRCA1):c.2232T>G (p.Ala744=) rs4986846
NM_007294.3(BRCA1):c.2235_2236inv (p.Glu745_Asp746delinsAspTyr)
NM_007294.3(BRCA1):c.2239C>T (p.Pro747Ser) rs1555590087
NM_007294.3(BRCA1):c.2241del (p.Asp749fs) rs80357650
NM_007294.3(BRCA1):c.2241dupC (p.Lys748Glnfs) rs80357650
NM_007294.3(BRCA1):c.2242A>G (p.Lys748Glu)
NM_007294.3(BRCA1):c.2245G>A (p.Asp749Asn) rs80357114
NM_007294.3(BRCA1):c.2245G>T (p.Asp749Tyr) rs80357114
NM_007294.3(BRCA1):c.2246A>T (p.Asp749Val) rs730881479
NM_007294.3(BRCA1):c.2252T>C (p.Met751Thr) rs587781684
NM_007294.3(BRCA1):c.2253G>C (p.Met751Ile) rs1555590040
NM_007294.3(BRCA1):c.2255T>A (p.Leu752Ter) rs1135401852
NM_007294.3(BRCA1):c.2258G>A (p.Ser753Asn) rs878854939
NM_007294.3(BRCA1):c.2263G>T (p.Glu755Ter) rs41286296
NM_007294.3(BRCA1):c.2263del (p.Glu755fs) rs80357960
NM_007294.3(BRCA1):c.2264A>G (p.Glu755Gly) rs922908090
NM_007294.3(BRCA1):c.2268G>C (p.Arg756Ser) rs80356884
NM_007294.3(BRCA1):c.2269del (p.Val757fs) rs80357583
NM_007294.3(BRCA1):c.2273T>A (p.Leu758Ter) rs1060502334
NM_007294.3(BRCA1):c.2279C>T (p.Thr760Ile)
NM_007294.3(BRCA1):c.2283A>C (p.Glu761Asp) rs1567796302
NM_007294.3(BRCA1):c.2286A>G (p.Arg762=) rs273898682
NM_007294.3(BRCA1):c.2286A>T (p.Arg762Ser) rs273898682
NM_007294.3(BRCA1):c.2288C>A (p.Ser763Tyr)
NM_007294.3(BRCA1):c.2292A>G (p.Val764=) rs1555589969
NM_007294.3(BRCA1):c.2292_2293AG[2] (p.Glu765_Ser766insTer) rs80357780
NM_007294.3(BRCA1):c.2295del (p.Ser766fs) rs1567796243
NM_007294.3(BRCA1):c.2296A>G (p.Ser766Gly) rs398122655
NM_007294.3(BRCA1):c.2297G>A (p.Ser766Asn) rs1567796224
NM_007294.3(BRCA1):c.2299A>G (p.Ser767Gly) rs80357194
NM_007294.3(BRCA1):c.2299A>T (p.Ser767Cys) rs80357194
NM_007294.3(BRCA1):c.2299del (p.Ser767fs) rs80357786
NM_007294.3(BRCA1):c.22G>A (p.Val8Ile) rs528902306
NM_007294.3(BRCA1):c.2302A>G (p.Ser768Gly) rs398122656
NM_007294.3(BRCA1):c.2309C>A (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2309C>G (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2311T>C (p.Leu771=) rs16940
NM_007294.3(BRCA1):c.2311_2317del (p.Pro773fs) rs1060502354
NM_007294.3(BRCA1):c.2314G>A (p.Val772Ile) rs1567796129
NM_007294.3(BRCA1):c.2315T>C (p.Val772Ala) rs80357467
NM_007294.3(BRCA1):c.2320G>T (p.Gly774Cys) rs1555589917
NM_007294.3(BRCA1):c.2324C>T (p.Thr775Ile)
NM_007294.3(BRCA1):c.2329T>G (p.Tyr777Asp) rs397507199
NM_007294.3(BRCA1):c.2333G>A (p.Gly778Asp) rs730881483
NM_007294.3(BRCA1):c.2334C>T (p.Gly778=) rs777404687
NM_007294.3(BRCA1):c.2337_2338del (p.Gln780fs) rs80357515
NM_007294.3(BRCA1):c.2338C>G (p.Gln780Glu) rs80356945
NM_007294.3(BRCA1):c.2338C>T (p.Gln780Ter) rs80356945
NM_007294.3(BRCA1):c.2339A>G (p.Gln780Arg) rs1410232200
NM_007294.3(BRCA1):c.2342A>C (p.Glu781Ala) rs587776482
NM_007294.3(BRCA1):c.2344A>G (p.Ser782Gly) rs1433746078
NM_007294.3(BRCA1):c.2345G>T (p.Ser782Ile) rs1567796012
NM_007294.3(BRCA1):c.2346T>A (p.Ser782Arg) rs1555589837
NM_007294.3(BRCA1):c.2346dup (p.Ile783fs) rs886040027
NM_007294.3(BRCA1):c.2351C>T (p.Ser784Leu) rs55914168
NM_007294.3(BRCA1):c.2351_2357del (p.Ser784fs) rs80357820
NM_007294.3(BRCA1):c.2352G>A (p.Ser784=) rs372017932
NM_007294.3(BRCA1):c.2354T>A (p.Leu785Ter) rs397508961
NM_007294.3(BRCA1):c.2356del (p.Leu786fs) rs397508962
NM_007294.3(BRCA1):c.2359dupG (p.Glu787Glyfs) rs80357739
NM_007294.3(BRCA1):c.235T>G (p.Phe79Val)
NM_007294.3(BRCA1):c.2366G>A (p.Ser789Asn)
NM_007294.3(BRCA1):c.2368A>G (p.Thr790Ala) rs41286298
NM_007294.3(BRCA1):c.2378dup (p.Ala794fs) rs864622536
NM_007294.3(BRCA1):c.2386_2387delinsT (p.Lys795_Thr796insTer) rs876660305
NM_007294.3(BRCA1):c.2386del (p.Thr796fs)
NM_007294.3(BRCA1):c.2387C>T (p.Thr796Ile) rs80357364
NM_007294.3(BRCA1):c.2389G>T (p.Glu797Ter) rs62625306
NM_007294.3(BRCA1):c.2389_2390del (p.Glu797fs) rs80357695
NM_007294.3(BRCA1):c.2392C>T (p.Pro798Ser) rs398122658
NM_007294.3(BRCA1):c.2393C>G (p.Pro798Arg)
NM_007294.3(BRCA1):c.2393C>T (p.Pro798Leu) rs876660005
NM_007294.3(BRCA1):c.2394_2397AAAT[1] (p.Lys800fs) rs786202684
NM_007294.3(BRCA1):c.2396A>G (p.Asn799Ser) rs587782027
NM_007294.3(BRCA1):c.2397T>A (p.Asn799Lys) rs80357203
NM_007294.3(BRCA1):c.2401T>C (p.Cys801Arg) rs1064793591
NM_007294.3(BRCA1):c.2401_2402TG[2] (p.Val802fs) rs80357706
NM_007294.3(BRCA1):c.2402G>A (p.Cys801Tyr) rs1567795821
NM_007294.3(BRCA1):c.2403T>A (p.Cys801Ter) rs80357381
NM_007294.3(BRCA1):c.2405T>G (p.Val802Gly) rs1555589737
NM_007294.3(BRCA1):c.2406_2409del (p.Gln804fs) rs80357674
NM_007294.3(BRCA1):c.2410C>T (p.Gln804Ter) rs80356982
NM_007294.3(BRCA1):c.2411_2412del (p.Gln804fs) rs80357664
NM_007294.3(BRCA1):c.2412G>A (p.Gln804=) rs55746541
NM_007294.3(BRCA1):c.2412G>C (p.Gln804His) rs55746541
NM_007294.3(BRCA1):c.2414G>A (p.Cys805Tyr) rs1060502352
NM_007294.3(BRCA1):c.2416G>A (p.Ala806Thr) rs80357144
NM_007294.3(BRCA1):c.2417C>T (p.Ala806Val) rs1555589705
NM_007294.3(BRCA1):c.2418del (p.Ala807fs) rs879255281
NM_007294.3(BRCA1):c.2418dup (p.Ala807fs) rs886040036
NM_007294.3(BRCA1):c.241C>G (p.Gln81Glu) rs80357350
NM_007294.3(BRCA1):c.241C>T (p.Gln81Ter) rs80357350
NM_007294.3(BRCA1):c.2424del (p.Phe808fs) rs397507200
NM_007294.3(BRCA1):c.2425G>A (p.Glu809Lys) rs786204151
NM_007294.3(BRCA1):c.2426A>G (p.Glu809Gly) rs397507201
NM_007294.3(BRCA1):c.2428A>T (p.Asn810Tyr) rs28897682
NM_007294.3(BRCA1):c.2429del (p.Asn810fs) rs397508967
NM_007294.3(BRCA1):c.2429dup (p.Asn810fs) rs397508967
NM_007294.3(BRCA1):c.2433del (p.Lys812fs) rs80357524
NM_007294.3(BRCA1):c.2436G>A (p.Lys812=) rs1060502338
NM_007294.3(BRCA1):c.2437G>A (p.Gly813Arg)
NM_007294.3(BRCA1):c.2437G>T (p.Gly813Ter) rs80357186
NM_007294.3(BRCA1):c.243A>G (p.Gln81=) rs863224418
NM_007294.3(BRCA1):c.2443del (p.Ile815fs) rs80357598
NM_007294.3(BRCA1):c.2447A>G (p.His816Arg) rs80357108
NM_007294.3(BRCA1):c.2450G>T (p.Gly817Val) rs1060502365
NM_007294.3(BRCA1):c.2456C>G (p.Ser819Cys) rs192655097
NM_007294.3(BRCA1):c.2457del (p.Asp821fs) rs80357669
NM_007294.3(BRCA1):c.2458A>G (p.Lys820Glu) rs56082113
NM_007294.3(BRCA1):c.2473G>T (p.Asp825Tyr) rs80357328
NM_007294.3(BRCA1):c.2473del (p.Asp825fs) rs886040040
NM_007294.3(BRCA1):c.2475C>T (p.Asp825=) rs1060504581
NM_007294.3(BRCA1):c.2475del (p.Asp825fs) rs80357970
NM_007294.3(BRCA1):c.2476del (p.Thr826fs) rs80357631
NM_007294.3(BRCA1):c.2477C>A (p.Thr826Lys) rs28897683
NM_007294.3(BRCA1):c.2479G>C (p.Glu827Gln)
NM_007294.3(BRCA1):c.247G>T (p.Val83Phe) rs1060502343
NM_007294.3(BRCA1):c.2481A>G (p.Glu827=) rs397508970
NM_007294.3(BRCA1):c.2483_2485del (p.Gly828_Phe829delinsVal) rs80358331
NM_007294.3(BRCA1):c.2487del (p.Phe829fs) rs80357658
NM_007294.3(BRCA1):c.2487dup (p.Lys830Ter) rs80357658
NM_007294.3(BRCA1):c.2489_2492del (p.Lys830fs) rs886040043
NM_007294.3(BRCA1):c.2491T>G (p.Tyr831Asp) rs1060502350
NM_007294.3(BRCA1):c.2496A>T (p.Pro832=) rs767666029
NM_007294.3(BRCA1):c.2497T>C (p.Leu833=) rs887578121
NM_007294.3(BRCA1):c.2500G>C (p.Gly834Arg) rs786202215
NM_007294.3(BRCA1):c.2501G>A (p.Gly834Glu) rs757383244
NM_007294.3(BRCA1):c.2503C>T (p.His835Tyr) rs751656678
NM_007294.3(BRCA1):c.2504dup (p.His835fs) rs1555589513
NM_007294.3(BRCA1):c.2506del (p.Glu836fs) rs587780798
NM_007294.3(BRCA1):c.250G>T (p.Glu84Ter) rs398122661
NM_007294.3(BRCA1):c.2515del (p.His839fs) rs80357607
NM_007294.3(BRCA1):c.2518A>C (p.Ser840Arg) rs377475866
NM_007294.3(BRCA1):c.2518A>G (p.Ser840Gly) rs377475866
NM_007294.3(BRCA1):c.2518A>T (p.Ser840Cys) rs377475866
NM_007294.3(BRCA1):c.2518del (p.Ser840fs) rs397508975
NM_007294.3(BRCA1):c.2521C>T (p.Arg841Trp) rs1800709
NM_007294.3(BRCA1):c.2522G>A (p.Arg841Gln) rs80357337
NM_007294.3(BRCA1):c.2523G>A (p.Arg841=) rs773013395
NM_007294.3(BRCA1):c.2524G>T (p.Glu842Ter) rs876658552
NM_007294.3(BRCA1):c.2525A>G (p.Glu842Gly) rs28897684
NM_007294.3(BRCA1):c.2528C>G (p.Thr843Arg) rs1555589466
NM_007294.3(BRCA1):c.2531G>A (p.Ser844Asn) rs56051266
NM_007294.3(BRCA1):c.2543A>G (p.Glu848Gly)
NM_007294.3(BRCA1):c.2548A>C (p.Ser850Arg) rs1555589429
NM_007294.3(BRCA1):c.2551G>A (p.Glu851Lys) rs398122662
NM_007294.3(BRCA1):c.2551G>T (p.Glu851Ter) rs398122662
NM_007294.3(BRCA1):c.2554C>G (p.Leu852Val) rs863224754
NM_007294.3(BRCA1):c.2555T>C (p.Leu852Pro) rs1555589415
NM_007294.3(BRCA1):c.2560G>A (p.Ala854Thr)
NM_007294.3(BRCA1):c.2560_2561dup (p.Gln855fs) rs80357968
NM_007294.3(BRCA1):c.2562_2563insGC (p.Gln855fs) rs878853290
NM_007294.3(BRCA1):c.2563C>A (p.Gln855Lys)
NM_007294.3(BRCA1):c.2563C>T (p.Gln855Ter) rs80357131
NM_007294.3(BRCA1):c.2564A>C (p.Gln855Pro) rs768001441
NM_007294.3(BRCA1):c.2564A>G (p.Gln855Arg) rs768001441
NM_007294.3(BRCA1):c.2564A>T (p.Gln855Leu) rs768001441
NM_007294.3(BRCA1):c.2566T>C (p.Tyr856His) rs80356892
NM_007294.3(BRCA1):c.2567A>G (p.Tyr856Cys) rs864622122
NM_007294.3(BRCA1):c.2577T>C (p.Asn859=) rs1555589344
NM_007294.3(BRCA1):c.2579C>T (p.Thr860Ile) rs1555589337
NM_007294.3(BRCA1):c.2580A>C (p.Thr860=) rs556684572
NM_007294.3(BRCA1):c.2583C>G (p.Phe861Leu) rs1555589334
NM_007294.3(BRCA1):c.2584A>G (p.Lys862Glu) rs80356927
NM_007294.3(BRCA1):c.2589_2594delinsATTCTTTT (p.Ser864fs) rs1567795017
NM_007294.3(BRCA1):c.258A>G (p.Leu86=) rs777491912
NM_007294.3(BRCA1):c.258A>T (p.Leu86=) rs777491912
NM_007294.3(BRCA1):c.2590T>G (p.Ser864Ala) rs80357285
NM_007294.3(BRCA1):c.2591C>G (p.Ser864Ter) rs80357003
NM_007294.3(BRCA1):c.2594del (p.Lys865fs) rs80357756
NM_007294.3(BRCA1):c.2596C>T (p.Arg866Cys) rs41286300
NM_007294.3(BRCA1):c.2597G>A (p.Arg866His) rs80356911
NM_007294.3(BRCA1):c.2599C>T (p.Gln867Ter) rs886038001
NM_007294.3(BRCA1):c.259T>G (p.Leu87Val) rs80357091
NM_007294.3(BRCA1):c.2603C>G (p.Ser868Ter) rs80356925
NM_007294.3(BRCA1):c.2604A>C (p.Ser868=) rs864622491
NM_007294.3(BRCA1):c.2608G>A (p.Ala870Thr)
NM_007294.3(BRCA1):c.2609C>T (p.Ala870Val) rs1060502324
NM_007294.3(BRCA1):c.2611_2612del (p.Pro871fs) rs80357962
NM_007294.3(BRCA1):c.2611_2612delinsGT (p.Pro871Val) rs1064793056
NM_007294.3(BRCA1):c.2612C>G (p.Pro871Arg) rs799917
NM_007294.3(BRCA1):c.2612C>T (p.Pro871Leu) rs799917
NM_007294.3(BRCA1):c.2612_2613insT (p.Phe872fs) rs80357948
NM_007294.3(BRCA1):c.2612delinsTT (p.Pro871fs) rs397508986
NM_007294.3(BRCA1):c.2613G>A (p.Pro871=) rs587782608
NM_007294.3(BRCA1):c.2617dupT (p.Ser873Phefs) rs80357912
NM_007294.3(BRCA1):c.2620A>C (p.Asn874His) rs1064795862
NM_007294.3(BRCA1):c.2620_2621del (p.Asn874fs) rs587781423
NM_007294.3(BRCA1):c.2625A>T (p.Pro875=) rs754222140
NM_007294.3(BRCA1):c.2630A>G (p.Asn877Ser) rs786203689
NM_007294.3(BRCA1):c.2630del (p.Asn877fs) rs886038002
NM_007294.3(BRCA1):c.2634A>G (p.Ala878=) rs730881451
NM_007294.3(BRCA1):c.2635G>T (p.Glu879Ter) rs80357251
NM_007294.3(BRCA1):c.2637del (p.Glu880fs) rs886040056
NM_007294.3(BRCA1):c.2641G>T (p.Glu881Ter) rs397508988
NM_007294.3(BRCA1):c.2643dup (p.Cys882fs) rs397508989
NM_007294.3(BRCA1):c.2654T>A (p.Phe885Tyr) rs1567794788
NM_007294.3(BRCA1):c.2655_2656CT[1] (p.Ser886fs) rs397508990
NM_007294.3(BRCA1):c.2657C>G (p.Ser886Cys) rs587782134
NM_007294.3(BRCA1):c.2658_2659insA (p.Ala887fs) rs80357541
NM_007294.3(BRCA1):c.2662C>T (p.His888Tyr) rs80357480
NM_007294.3(BRCA1):c.2666C>T (p.Ser889Phe) rs769712441
NM_007294.3(BRCA1):c.2668G>A (p.Gly890Arg) rs80357200
NM_007294.3(BRCA1):c.2669G>T (p.Gly890Val) rs80356874
NM_007294.3(BRCA1):c.2670G>T (p.Gly890=) rs786201677
NM_007294.3(BRCA1):c.2674T>C (p.Leu892=) rs137998759
NM_007294.3(BRCA1):c.2677A>T (p.Lys893Ter) rs80357170
NM_007294.3(BRCA1):c.2678A>G (p.Lys893Arg) rs1567794714
NM_007294.3(BRCA1):c.2679G>T (p.Lys893Asn) rs587781771
NM_007294.3(BRCA1):c.2679_2682del (p.Lys893fs) rs80357596
NM_007294.3(BRCA1):c.267C>G (p.Ile89Met) rs80356963
NM_007294.3(BRCA1):c.2680_2687del (p.Lys894fs) rs1555589143
NM_007294.3(BRCA1):c.2681_2682del (p.Lys894fs) rs80357971
NM_007294.3(BRCA1):c.2685_2686del (p.Pro897fs) rs80357636
NM_007294.3(BRCA1):c.2687_2688insA (p.Ser896fs) rs1135401853
NM_007294.3(BRCA1):c.2693_2694dup (p.Val899fs) rs80357549
NM_007294.3(BRCA1):c.269_281del (p.Ile90fs) rs80359879
NM_007294.3(BRCA1):c.2702_2703del (p.Thr900_Phe901insTer) rs80357899
NM_007294.3(BRCA1):c.2706A>C (p.Glu902Asp) rs398122665
NM_007294.3(BRCA1):c.2706_2707dup (p.Cys903fs) rs80357717
NM_007294.3(BRCA1):c.2706delA
NM_007294.3(BRCA1):c.270T>C (p.Ile90=) rs1555596670
NM_007294.3(BRCA1):c.2710G>C (p.Glu904Gln) rs80357035
NM_007294.3(BRCA1):c.2713C>T (p.Gln905Ter) rs397509002
NM_007294.3(BRCA1):c.2714A>G (p.Gln905Arg) rs397507203
NM_007294.3(BRCA1):c.2716_2730del (p.Lys906_Gln910del) rs755789142
NM_007294.3(BRCA1):c.2719_2722del (p.Glu907fs) rs80357731
NM_007294.3(BRCA1):c.271T>C (p.Cys91Arg) rs786203939
NM_007294.3(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.3(BRCA1):c.2726A>T (p.Asn909Ile) rs80357127
NM_007294.3(BRCA1):c.2726_2730del (p.Asn909fs) rs80357712
NM_007294.3(BRCA1):c.2726dupA (p.Asn909Lysfs) rs80357614
NM_007294.3(BRCA1):c.2727_2730del (p.Asn909fs) rs80357605
NM_007294.3(BRCA1):c.2728C>G (p.Gln910Glu) rs397509004
NM_007294.3(BRCA1):c.2728del (p.Gln910fs) rs397509005
NM_007294.3(BRCA1):c.2733A>G (p.Gly911=) rs1800740
NM_007294.3(BRCA1):c.2734A>C (p.Lys912Gln) rs1555589048
NM_007294.3(BRCA1):c.2735A>G (p.Lys912Arg) rs397507204
NM_007294.3(BRCA1):c.2738A>G (p.Asn913Ser) rs199954851
NM_007294.3(BRCA1):c.2739T>A (p.Asn913Lys) rs273899688
NM_007294.3(BRCA1):c.2742G>A (p.Glu914=) rs961042365
NM_007294.3(BRCA1):c.2744_2745del (p.Glu914_Ser915insTer) rs80357540
NM_007294.3(BRCA1):c.2747A>T (p.Asn916Ile) rs864622588
NM_007294.3(BRCA1):c.274G>C (p.Ala92Pro) rs863224755
NM_007294.3(BRCA1):c.2750T>C (p.Ile917Thr) rs587781492
NM_007294.3(BRCA1):c.2750T>G (p.Ile917Ser) rs587781492
NM_007294.3(BRCA1):c.2751del (p.Lys918fs) rs886040068
NM_007294.3(BRCA1):c.2758G>A (p.Val920Ile) rs80357361
NM_007294.3(BRCA1):c.2758G>T (p.Val920Leu)
NM_007294.3(BRCA1):c.2761C>T (p.Gln921Ter) rs80357377
NM_007294.3(BRCA1):c.2763G>A (p.Gln921=) rs1057522511
NM_007294.3(BRCA1):c.2766del (p.Val923fs) rs80357812
NM_007294.3(BRCA1):c.2767_2770del (p.Val923fs) rs80357661
NM_007294.3(BRCA1):c.2773A>C (p.Ile925Leu) rs4986847
NM_007294.3(BRCA1):c.2773A>G (p.Ile925Val) rs4986847
NM_007294.3(BRCA1):c.2775C>T (p.Ile925=) rs786201104
NM_007294.3(BRCA1):c.2783G>A (p.Gly928Asp) rs202004680
NM_007294.3(BRCA1):c.2791G>T (p.Val931Leu) rs763639161
NM_007294.3(BRCA1):c.2798G>A (p.Gly933Asp) rs80356941
NM_007294.3(BRCA1):c.2798G>C (p.Gly933Ala) rs80356941
NM_007294.3(BRCA1):c.279_280delinsGAA (p.Phe93fs) rs1555596663
NM_007294.3(BRCA1):c.2800C>T (p.Gln934Ter) rs80357223
NM_007294.3(BRCA1):c.2806_2809del (p.Asp936fs) rs80357832
NM_007294.3(BRCA1):c.2808T>G (p.Asp936Glu) rs730881485
NM_007294.3(BRCA1):c.280C>T (p.Gln94Ter) rs886037972
NM_007294.3(BRCA1):c.2811G>A (p.Lys937=) rs876659271
NM_007294.3(BRCA1):c.2813C>T (p.Pro938Leu) rs1064793999
NM_007294.3(BRCA1):c.2814A>G (p.Pro938=) rs80356851
NM_007294.3(BRCA1):c.2815G>A (p.Val939Ile) rs1555588896
NM_007294.3(BRCA1):c.2816T>C (p.Val939Ala) rs1555588894
NM_007294.3(BRCA1):c.2823T>G (p.Asn941Lys)
NM_007294.3(BRCA1):c.2823del (p.Asn941fs) rs886040075
NM_007294.3(BRCA1):c.2830T>A (p.Cys944Ser) rs1064795603
NM_007294.3(BRCA1):c.2834_2836delinsC (p.Ser945fs) rs386134270
NM_007294.3(BRCA1):c.2835_2836insCC (p.Ile946fs)
NM_007294.3(BRCA1):c.2835dupT (p.Ile946Tyrfs) rs80357519
NM_007294.3(BRCA1):c.2836A>T (p.Ile946Phe) rs876660901
NM_007294.3(BRCA1):c.283_286del (p.Leu95fs) rs1567811070
NM_007294.3(BRCA1):c.2840A>G (p.Lys947Arg) rs778118145
NM_007294.3(BRCA1):c.2841A>T (p.Lys947Asn) rs864622618
NM_007294.3(BRCA1):c.2845G>A (p.Gly949Ser) rs1324818767
NM_007294.3(BRCA1):c.2849C>T (p.Ser950Phe) rs1555588847
NM_007294.3(BRCA1):c.2851A>G (p.Arg951Gly)
NM_007294.3(BRCA1):c.2860C>T (p.Leu954=) rs730881452
NM_007294.3(BRCA1):c.2861dup (p.Ser955fs) rs886040079
NM_007294.3(BRCA1):c.2862A>G (p.Leu954=) rs559190752
NM_007294.3(BRCA1):c.2864C>A (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2865A>T (p.Ser955=) rs748285767
NM_007294.3(BRCA1):c.2865del (p.Ser956fs)
NM_007294.3(BRCA1):c.2866_2870del (p.Ser956fs) rs80357819
NM_007294.3(BRCA1):c.2867C>G (p.Ser956Cys) rs1060502336
NM_007294.3(BRCA1):c.2868del (p.Gln957fs) rs80357929
NM_007294.3(BRCA1):c.2869C>T (p.Gln957Ter) rs80356973
NM_007294.3(BRCA1):c.286G>C (p.Asp96His) rs80357110
NM_007294.3(BRCA1):c.2872T>C (p.Phe958Leu) rs80356878
NM_007294.3(BRCA1):c.287A>G (p.Asp96Gly) rs864622444
NM_007294.3(BRCA1):c.2881A>T (p.Asn961Tyr)
NM_007294.3(BRCA1):c.2882A>G (p.Asn961Ser) rs879254130
NM_007294.3(BRCA1):c.2882del (p.Asn961fs) rs886040082
NM_007294.3(BRCA1):c.2883C>T (p.Asn961=) rs201190540
NM_007294.3(BRCA1):c.2884G>A (p.Glu962Lys) rs80356955
NM_007294.3(BRCA1):c.2885A>G (p.Glu962Gly)
NM_007294.3(BRCA1):c.2888C>T (p.Thr963Ile) rs730881443
NM_007294.3(BRCA1):c.2889_2890del (p.Gly964fs) rs80357890
NM_007294.3(BRCA1):c.288C>T (p.Asp96=) rs146085503
NM_007294.3(BRCA1):c.288_292delinsAACCTGT (p.Asp96fs) rs483353091
NM_007294.3(BRCA1):c.2892A>G (p.Gly964=) rs1060504553
NM_007294.3(BRCA1):c.2893C>G (p.Leu965Val) rs1060502344
NM_007294.3(BRCA1):c.2897T>C (p.Ile966Thr) rs879254045
NM_007294.3(BRCA1):c.2898T>C (p.Ile966=) rs786202249
NM_007294.3(BRCA1):c.2901_2902dup (p.Pro968fs) rs398122670
NM_007294.3(BRCA1):c.2903dup (p.Asn969fs) rs1555588756
NM_007294.3(BRCA1):c.2905A>G (p.Asn969Asp) rs587781641
NM_007294.3(BRCA1):c.2906A>G (p.Asn969Ser) rs1567793695
NM_007294.3(BRCA1):c.2909A>G (p.Lys970Arg)
NM_007294.3(BRCA1):c.2909A>T (p.Lys970Ile) rs756559408
NM_007294.3(BRCA1):c.290C>G (p.Thr97Arg) rs431825393
NM_007294.3(BRCA1):c.2910A>C (p.Lys970Asn) rs431825394
NM_007294.3(BRCA1):c.2910A>G (p.Lys970=) rs431825394
NM_007294.3(BRCA1):c.2911C>G (p.His971Asp) rs80357478
NM_007294.3(BRCA1):c.2912A>G (p.His971Arg) rs1567793641
NM_007294.3(BRCA1):c.2912_2913del (p.His971fs) rs878854940
NM_007294.3(BRCA1):c.2913T>C (p.His971=) rs786203804
NM_007294.3(BRCA1):c.2913T>G (p.His971Gln)
NM_007294.3(BRCA1):c.2915G>A (p.Gly972Glu) rs587782721
NM_007294.3(BRCA1):c.2917C>A (p.Leu973Ile)
NM_007294.3(BRCA1):c.2922A>C (p.Leu974Phe) rs730881487
NM_007294.3(BRCA1):c.2930C>T (p.Pro977Leu) rs141465583
NM_007294.3(BRCA1):c.2933A>G (p.Tyr978Cys) rs863224756
NM_007294.3(BRCA1):c.2933dup (p.Tyr978Ter) rs878853292
NM_007294.3(BRCA1):c.2934T>A (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934T>G (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934del (p.Arg979fs) rs80357741
NM_007294.3(BRCA1):c.2935C>T (p.Arg979Cys) rs80356970
NM_007294.3(BRCA1):c.2936G>A (p.Arg979His) rs80356985
NM_007294.3(BRCA1):c.2940del (p.Pro981fs) rs80357876
NM_007294.3(BRCA1):c.2941C>A (p.Pro981Thr) rs1555588677
NM_007294.3(BRCA1):c.2943A>T (p.Pro981=) rs587780799
NM_007294.3(BRCA1):c.2959A>G (p.Lys987Glu) rs878854941
NM_007294.3(BRCA1):c.2959A>T (p.Lys987Ter) rs878854941
NM_007294.3(BRCA1):c.2960dup (p.Ser988fs) rs886040088
NM_007294.3(BRCA1):c.2963C>T (p.Ser988Leu) rs397507206
NM_007294.3(BRCA1):c.2967T>A (p.Phe989Leu) rs876659270
NM_007294.3(BRCA1):c.296T>C (p.Leu99Ser) rs1567811021
NM_007294.3(BRCA1):c.2973_2979del (p.Lys991fs) rs397509030
NM_007294.3(BRCA1):c.2974_2990del (p.Thr992fs) rs397509031
NM_007294.3(BRCA1):c.2980T>C (p.Cys994Arg) rs144853230
NM_007294.3(BRCA1):c.2981G>T (p.Cys994Phe)
NM_007294.3(BRCA1):c.2983A>T (p.Lys995Ter) rs879255315
NM_007294.3(BRCA1):c.2984del (p.Lys995fs)
NM_007294.3(BRCA1):c.2985G>T (p.Lys995Asn) rs1555588591
NM_007294.3(BRCA1):c.2987A>G (p.Lys996Arg) rs786202898
NM_007294.3(BRCA1):c.2989_2990dup (p.Asn997fs) rs80357829
NM_007294.3(BRCA1):c.2992C>G (p.Leu998Val) rs876659077
NM_007294.3(BRCA1):c.2993T>G (p.Leu998Arg)
NM_007294.3(BRCA1):c.2998G>A (p.Glu1000Lys) rs80357124
NM_007294.3(BRCA1):c.2998_3003del (p.Glu1000_Glu1001del) rs80358333
NM_007294.3(BRCA1):c.2999A>G (p.Glu1000Gly) rs1060502330
NM_007294.3(BRCA1):c.2999del (p.Glu1000fs) rs80357991
NM_007294.3(BRCA1):c.3004A>G (p.Asn1002Asp) rs786202665
NM_007294.3(BRCA1):c.3005A>T (p.Asn1002Ile) rs1555588553
NM_007294.3(BRCA1):c.3005delA (p.Asn1002Thrfs) rs80357601
NM_007294.3(BRCA1):c.3008_3009del (p.Asn1002_Phe1003insTer) rs80357617
NM_007294.3(BRCA1):c.301+12A>C rs863224757
NM_007294.3(BRCA1):c.301+19A>G rs864622737
NM_007294.3(BRCA1):c.301+1G>A rs587782173
NM_007294.3(BRCA1):c.301+1G>C rs587782173
NM_007294.3(BRCA1):c.301+1G>T rs587782173
NM_007294.3(BRCA1):c.301+2T>C rs1567811002
NM_007294.3(BRCA1):c.301+2dupT rs273899694
NM_007294.3(BRCA1):c.301+3A>G rs1567810999
NM_007294.3(BRCA1):c.301+6T>C rs753859240
NM_007294.3(BRCA1):c.301+7G>A rs80358113
NM_007294.3(BRCA1):c.301+8T>C rs80358101
NM_007294.3(BRCA1):c.301+9T>C rs1060504587
NM_007294.3(BRCA1):c.3010G>C (p.Glu1004Gln) rs786202534
NM_007294.3(BRCA1):c.3012G>A (p.Glu1004=) rs786201784
NM_007294.3(BRCA1):c.3016_3020del (p.His1006fs) rs1135401855
NM_007294.3(BRCA1):c.3018_3021del (p.His1006fs) rs80357749
NM_007294.3(BRCA1):c.302-10T>A rs747733248
NM_007294.3(BRCA1):c.302-10T>C rs747733248
NM_007294.3(BRCA1):c.302-11G>A rs1057521776
NM_007294.3(BRCA1):c.302-15C>G rs1057520871
NM_007294.3(BRCA1):c.302-1G>A rs80358116
NM_007294.3(BRCA1):c.302-2delA rs273899695
NM_007294.3(BRCA1):c.302-5T>A rs778668665
NM_007294.3(BRCA1):c.302-8T>C rs878854942
NM_007294.3(BRCA1):c.302-8T>G rs878854942
NM_007294.3(BRCA1):c.302-9A>G rs1389128798
NM_007294.3(BRCA1):c.3022A>G (p.Met1008Val) rs56321129
NM_007294.3(BRCA1):c.3024G>A (p.Met1008Ile) rs1800704
NM_007294.3(BRCA1):c.3027A>C (p.Ser1009=) rs1555588512
NM_007294.3(BRCA1):c.3029C>T (p.Pro1010Leu)
NM_007294.3(BRCA1):c.3029_3030del (p.Pro1010fs) rs80357510
NM_007294.3(BRCA1):c.302A>G (p.Tyr101Cys) rs587781798
NM_007294.3(BRCA1):c.3030T>G (p.Pro1010=) rs876660048
NM_007294.3(BRCA1):c.3033_3034del (p.Glu1013fs) rs1567793163
NM_007294.3(BRCA1):c.3036A>C (p.Arg1012Ser) rs1567793150
NM_007294.3(BRCA1):c.303T>G (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.3041T>A (p.Met1014Lys) rs80357020
NM_007294.3(BRCA1):c.3041T>C (p.Met1014Thr) rs80357020
NM_007294.3(BRCA1):c.3044dup (p.Asn1016fs) rs80357746
NM_007294.3(BRCA1):c.3047A>G (p.Asn1016Ser) rs1567793123
NM_007294.3(BRCA1):c.3048T>G (p.Asn1016Lys) rs879255482
NM_007294.3(BRCA1):c.3048_3052dupTGAGA (p.Asn1018Metfs) rs80357856
NM_007294.3(BRCA1):c.3053_3054insTGAGA (p.Ile1019fs) rs80357547
NM_007294.3(BRCA1):c.3055A>G (p.Ile1019Val) rs80357311
NM_007294.3(BRCA1):c.3056_3059del (p.Ile1019fs) rs1135401856
NM_007294.3(BRCA1):c.305C>G (p.Ala102Gly) rs80357190
NM_007294.3(BRCA1):c.3060A>G (p.Pro1020=) rs781435355
NM_007294.3(BRCA1):c.3062del (p.Ser1021fs) rs1135401857
NM_007294.3(BRCA1):c.3064dup (p.Thr1022fs) rs1135401858
NM_007294.3(BRCA1):c.3065C>T (p.Thr1022Ile) rs786202070
NM_007294.3(BRCA1):c.3066del (p.Thr1022_Val1023insTer) rs786202906
NM_007294.3(BRCA1):c.3068del (p.Val1023fs) rs1567793053
NM_007294.3(BRCA1):c.3071G>A (p.Ser1024Asn) rs757579891
NM_007294.3(BRCA1):c.3075A>C (p.Thr1025=) rs786201258
NM_007294.3(BRCA1):c.3078T>G (p.Ile1026Met) rs1555588422
NM_007294.3(BRCA1):c.3082C>T (p.Arg1028Cys) rs80357049
NM_007294.3(BRCA1):c.3083G>A (p.Arg1028His) rs80357459
NM_007294.3(BRCA1):c.3083G>T (p.Arg1028Leu) rs80357459
NM_007294.3(BRCA1):c.3084_3094del (p.Asn1029fs) rs80357647
NM_007294.3(BRCA1):c.3091A>G (p.Ile1031Val) rs786203979
NM_007294.3(BRCA1):c.3092T>G (p.Ile1031Ser) rs863224758
NM_007294.3(BRCA1):c.3093T>A (p.Ile1031=) rs786204265
NM_007294.3(BRCA1):c.3093T>C (p.Ile1031=)
NM_007294.3(BRCA1):c.3097G>A (p.Glu1033Lys) rs273899698
NM_007294.3(BRCA1):c.3103_3104del (p.Val1035fs) rs1555588392
NM_007294.3(BRCA1):c.3104T>C (p.Val1035Ala) rs1555588389
NM_007294.3(BRCA1):c.3106T>C (p.Phe1036Leu) rs766381694
NM_007294.3(BRCA1):c.3108_3109insSVA (p.Lys1037_Glu1038insXaa)
NM_007294.3(BRCA1):c.3108dup (p.Lys1037Ter) rs80357841
NM_007294.3(BRCA1):c.3112G>T (p.Glu1038Ter) rs80357161
NM_007294.3(BRCA1):c.3113A>C (p.Glu1038Ala) rs16941
NM_007294.3(BRCA1):c.3113A>G (p.Glu1038Gly) rs16941
NM_007294.3(BRCA1):c.3115del (p.Ala1039fs) rs886040098
NM_007294.3(BRCA1):c.3117del (p.Ser1040fs) rs1555588361
NM_007294.3(BRCA1):c.3119G>A (p.Ser1040Asn) rs4986852
NM_007294.3(BRCA1):c.3119G>C (p.Ser1040Thr) rs4986852
NM_007294.3(BRCA1):c.3124A>C (p.Ser1042Arg)
NM_007294.3(BRCA1):c.3126C>G (p.Ser1042Arg) rs878854943
NM_007294.3(BRCA1):c.3129T>C (p.Asn1043=) rs1555588339
NM_007294.3(BRCA1):c.3130A>G (p.Ile1044Val) rs80357271
NM_007294.3(BRCA1):c.3135_3138del (p.Asn1045fs) rs1567792767
NM_007294.3(BRCA1):c.3139G>A (p.Val1047Ile)
NM_007294.3(BRCA1):c.3139_3180del (p.Val1047_Glu1060del) rs876660145
NM_007294.3(BRCA1):c.3143G>A (p.Gly1048Asp) rs80356899
NM_007294.3(BRCA1):c.314A>G (p.Tyr105Cys) rs28897673
NM_007294.3(BRCA1):c.3150T>G (p.Ser1050Arg) rs1555588305
NM_007294.3(BRCA1):c.3151A>G (p.Thr1051Ala) rs398122671
NM_007294.3(BRCA1):c.3153T>C (p.Thr1051=) rs1057521053
NM_007294.3(BRCA1):c.3155A>G (p.Asn1052Ser) rs398122672
NM_007294.3(BRCA1):c.3157dup (p.Glu1053fs) rs397509042
NM_007294.3(BRCA1):c.3159A>G (p.Glu1053=)
NM_007294.3(BRCA1):c.3160G>A (p.Val1054Met) rs876658479
NM_007294.3(BRCA1):c.3161_3164dup (p.Ser1056fs) rs1567792675
NM_007294.3(BRCA1):c.3170G>A (p.Ser1057Asn) rs587776487
NM_007294.3(BRCA1):c.3172_3192dup (p.Ile1058_Ser1064dup) rs1555588237
NM_007294.3(BRCA1):c.3173T>G (p.Ile1058Ser) rs1555588264
NM_007294.3(BRCA1):c.3178G>T (p.Glu1060Ter) rs80357424
NM_007294.3(BRCA1):c.3181A>G (p.Ile1061Val) rs876658975
NM_007294.3(BRCA1):c.3184G>A (p.Gly1062Ser) rs1567792594
NM_007294.3(BRCA1):c.3193dup (p.Asp1065fs) rs80357511
NM_007294.3(BRCA1):c.3194A>T (p.Asp1065Val) rs1555588228
NM_007294.3(BRCA1):c.3199A>T (p.Asn1067Tyr)
NM_007294.3(BRCA1):c.319T>A (p.Phe107Ile) rs878854944
NM_007294.3(BRCA1):c.31G>C (p.Val11Leu) rs1555601019
NM_007294.3(BRCA1):c.3200A>G (p.Asn1067Ser) rs1555588214
NM_007294.3(BRCA1):c.3205del (p.Gln1069fs) rs886040103
NM_007294.3(BRCA1):c.3206A>C (p.Gln1069Pro) rs879254151
NM_007294.3(BRCA1):c.3206A>T (p.Gln1069Leu) rs879254151
NM_007294.3(BRCA1):c.3211G>A (p.Glu1071Lys) rs41293445
NM_007294.3(BRCA1):c.3213A>G (p.Glu1071=) rs528254652
NM_007294.3(BRCA1):c.3214del (p.Glu1071_Leu1072insTer) rs80357923
NM_007294.3(BRCA1):c.3217G>A (p.Gly1073Ser) rs878854945
NM_007294.3(BRCA1):c.3221G>C (p.Arg1074Thr) rs786202155
NM_007294.3(BRCA1):c.3223A>G (p.Asn1075Asp) rs1567792459
NM_007294.3(BRCA1):c.3224dup (p.Asn1075fs)
NM_007294.3(BRCA1):c.3226_3227AG[1] (p.Gly1077fs) rs80357635
NM_007294.3(BRCA1):c.3227G>T (p.Arg1076Ile) rs80357313
NM_007294.3(BRCA1):c.3230G>A (p.Gly1077Glu) rs1567792424
NM_007294.3(BRCA1):c.3238T>C (p.Leu1080=) rs754597283
NM_007294.3(BRCA1):c.3238T>G (p.Leu1080Val) rs754597283
NM_007294.3(BRCA1):c.3239T>A (p.Leu1080Ter) rs80357145
NM_007294.3(BRCA1):c.3242A>G (p.Asn1081Ser)
NM_007294.3(BRCA1):c.3242_3246ATGCT[1] (p.Ala1082_Met1083insTer) rs1135401859
NM_007294.3(BRCA1):c.3244G>A (p.Ala1082Thr)
NM_007294.3(BRCA1):c.3247A>C (p.Met1083Leu) rs397507213
NM_007294.3(BRCA1):c.3247A>G (p.Met1083Val) rs397507213
NM_007294.3(BRCA1):c.3250C>A (p.Leu1084Ile) rs879254009
NM_007294.3(BRCA1):c.3253dupA (p.Arg1085Lysfs) rs80357517
NM_007294.3(BRCA1):c.3254_3255dup (p.Leu1086fs) rs80357624
NM_007294.3(BRCA1):c.3254_3255insGA (p.Leu1086fs) rs80357625
NM_007294.3(BRCA1):c.3255dupA (p.Leu1086Ilefs) rs1555588090
NM_007294.3(BRCA1):c.3256_3257insGA (p.Leu1086Ter) rs80357764
NM_007294.3(BRCA1):c.3257T>G (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3260G>C (p.Gly1087Ala) rs80357172
NM_007294.3(BRCA1):c.3267G>T (p.Leu1089Phe) rs767544239
NM_007294.3(BRCA1):c.3268C>T (p.Gln1090Ter) rs80357402
NM_007294.3(BRCA1):c.3269A>G (p.Gln1090Arg) rs1555588045
NM_007294.3(BRCA1):c.3270A>G (p.Gln1090=) rs369925993
NM_007294.3(BRCA1):c.3270A>T (p.Gln1090His) rs369925993
NM_007294.3(BRCA1):c.3279del (p.Tyr1094fs) rs397509050
NM_007294.3(BRCA1):c.3281A>G (p.Tyr1094Cys)
NM_007294.3(BRCA1):c.3288A>G (p.Gln1096=)
NM_007294.3(BRCA1):c.3288_3289del (p.Leu1098fs) rs80357686
NM_007294.3(BRCA1):c.3289dup (p.Ser1097fs) rs80357686
NM_007294.3(BRCA1):c.328A>G (p.Lys110Glu) rs878854946
NM_007294.3(BRCA1):c.3294del (p.Pro1099fs) rs876658626
NM_007294.3(BRCA1):c.3296C>T (p.Pro1099Leu) rs80357201
NM_007294.3(BRCA1):c.3296del (p.Pro1099fs) rs80357815
NM_007294.3(BRCA1):c.329_330del (p.Lys110fs) rs80357754
NM_007294.3(BRCA1):c.329del (p.Lys110fs) rs80357604
NM_007294.3(BRCA1):c.329dup (p.Glu111fs) rs80357604
NM_007294.3(BRCA1):c.32T>G (p.Val11Gly) rs80357017
NM_007294.3(BRCA1):c.3301A>G (p.Ser1101Gly)
NM_007294.3(BRCA1):c.3302G>A (p.Ser1101Asn) rs41293447
NM_007294.3(BRCA1):c.3306T>C (p.Asn1102=) rs876658664
NM_007294.3(BRCA1):c.3308G>T (p.Cys1103Phe) rs80357135
NM_007294.3(BRCA1):c.3309T>A (p.Cys1103Ter) rs80357317
NM_007294.3(BRCA1):c.330G>A (p.Lys110=) rs878854947
NM_007294.3(BRCA1):c.3319G>T (p.Glu1107Ter) rs80357106
NM_007294.3(BRCA1):c.3327A>C (p.Lys1109Asn) rs41293449
NM_007294.3(BRCA1):c.3327_3329del (p.Lys1110del) rs80357575
NM_007294.3(BRCA1):c.3328_3330del (p.Lys1110del) rs80358335
NM_007294.3(BRCA1):c.3329_3330del (p.Lys1110fs) rs80357525
NM_007294.3(BRCA1):c.3329del (p.Lys1110fs) rs80357575
NM_007294.3(BRCA1):c.3331C>T (p.Gln1111Ter) rs80357089
NM_007294.3(BRCA1):c.3331_3334del (p.Gln1111fs) rs80357701
NM_007294.3(BRCA1):c.3333_3336del (p.Gln1111fs) rs397509057
NM_007294.3(BRCA1):c.3333del (p.Glu1112fs) rs80357966
NM_007294.3(BRCA1):c.3334del (p.Glu1112fs) rs1555587944
NM_007294.3(BRCA1):c.3338A>G (p.Tyr1113Cys)
NM_007294.3(BRCA1):c.333A>C (p.Glu111Asp) rs1567810451
NM_007294.3(BRCA1):c.3340G>T (p.Glu1114Ter) rs80357278
NM_007294.3(BRCA1):c.3341_3343AAG[1] (p.Glu1115del) rs80358336
NM_007294.3(BRCA1):c.3342_3345del (p.Glu1114_Glu1115insTer) rs397509058
NM_007294.3(BRCA1):c.3344A>T (p.Glu1115Val) rs1555587933
NM_007294.3(BRCA1):c.3345A>C (p.Glu1115Asp) rs876658243
NM_007294.3(BRCA1):c.3351dup (p.Gln1118fs) rs80357785
NM_007294.3(BRCA1):c.3354G>T (p.Gln1118His) rs80357334
NM_007294.3(BRCA1):c.3355A>T (p.Thr1119Ser) rs80356949
NM_007294.3(BRCA1):c.3356C>G (p.Thr1119Ser) rs863224759
NM_007294.3(BRCA1):c.3357T>A (p.Thr1119=) rs772383323
NM_007294.3(BRCA1):c.3358G>A (p.Val1120Ile) rs748894760
NM_007294.3(BRCA1):c.3358_3359del (p.Thr1119_Val1120insTer) rs80357945
NM_007294.3(BRCA1):c.3361A>G (p.Asn1121Asp) rs876660526
NM_007294.3(BRCA1):c.3362A>G (p.Asn1121Ser) rs80356919
NM_007294.3(BRCA1):c.3362del (p.Asn1121fs) rs80357865
NM_007294.3(BRCA1):c.3365_3366del (p.Thr1122fs) rs80357892
NM_007294.3(BRCA1):c.3367G>T (p.Asp1123Tyr) rs80356867
NM_007294.3(BRCA1):c.3368A>T (p.Asp1123Val) rs1555587851
NM_007294.3(BRCA1):c.3371_3372TC[2] (p.Pro1126fs) rs80357828
NM_007294.3(BRCA1):c.3379T>C (p.Tyr1127His) rs1451089848
NM_007294.3(BRCA1):c.3383T>C (p.Leu1128Pro) rs1555587827
NM_007294.3(BRCA1):c.3385A>G (p.Ile1129Val)
NM_007294.3(BRCA1):c.3389C>G (p.Ser1130Ter) rs80357405
NM_007294.3(BRCA1):c.338A>G (p.Asn113Ser) rs587780800
NM_007294.3(BRCA1):c.3390A>G (p.Ser1130=) rs757237039
NM_007294.3(BRCA1):c.3392A>G (p.Asp1131Gly) rs1555587813
NM_007294.3(BRCA1):c.3394A>G (p.Asn1132Asp) rs530464947
NM_007294.3(BRCA1):c.3400G>A (p.Glu1134Lys) rs80357018
NM_007294.3(BRCA1):c.3400G>T (p.Glu1134Ter) rs80357018
NM_007294.3(BRCA1):c.3401A>T (p.Glu1134Val) rs762744684
NM_007294.3(BRCA1):c.3401_3405del (p.Glu1134fs) rs1555587781
NM_007294.3(BRCA1):c.3403C>G (p.Gln1135Glu) rs80357136
NM_007294.3(BRCA1):c.3403C>T (p.Gln1135Ter) rs80357136
NM_007294.3(BRCA1):c.3406C>A (p.Pro1136Thr) rs431825395
NM_007294.3(BRCA1):c.3409A>G (p.Met1137Val) rs771479616
NM_007294.3(BRCA1):c.3410T>C (p.Met1137Thr) rs80357297
NM_007294.3(BRCA1):c.3411G>A (p.Met1137Ile) rs786202900
NM_007294.3(BRCA1):c.3414_3415insG (p.Ser1139fs) rs1135401860
NM_007294.3(BRCA1):c.3415_3417AGT[1] (p.Ser1140del) rs80358337
NM_007294.3(BRCA1):c.3416G>T (p.Ser1139Ile) rs80357228
NM_007294.3(BRCA1):c.3418A>G (p.Ser1140Gly) rs2227945
NM_007294.3(BRCA1):c.341C>G (p.Ser114Cys) rs786202620
NM_007294.3(BRCA1):c.3423T>C (p.His1141=) rs863224419
NM_007294.3(BRCA1):c.3424G>T (p.Ala1142Ser)
NM_007294.3(BRCA1):c.3425C>T (p.Ala1142Val) rs1555587711
NM_007294.3(BRCA1):c.3428C>G (p.Ser1143Cys) rs80357434
NM_007294.3(BRCA1):c.3432G>A (p.Gln1144=) rs80356922
NM_007294.3(BRCA1):c.3433G>T (p.Val1145Phe) rs431825396
NM_007294.3(BRCA1):c.3433del (p.Val1145fs)
NM_007294.3(BRCA1):c.3435T>C (p.Val1145=) rs786201222
NM_007294.3(BRCA1):c.3436_3439del (p.Cys1146fs) rs397509067
NM_007294.3(BRCA1):c.3437G>A (p.Cys1146Tyr) rs80357247
NM_007294.3(BRCA1):c.343C>A (p.Pro115Thr) rs1468589409
NM_007294.3(BRCA1):c.3440C>A (p.Ser1147Tyr) rs876660757
NM_007294.3(BRCA1):c.3448C>T (p.Pro1150Ser) rs80357272
NM_007294.3(BRCA1):c.3454G>A (p.Asp1152Asn) rs80357175
NM_007294.3(BRCA1):c.3454G>C (p.Asp1152His) rs80357175
NM_007294.3(BRCA1):c.3460T>A (p.Leu1154Ile) rs1567791553
NM_007294.3(BRCA1):c.3466G>A (p.Asp1156Asn) rs1064793302
NM_007294.3(BRCA1):c.3468T>C (p.Asp1156=) rs864622146
NM_007294.3(BRCA1):c.346del (p.Glu116fs) rs762635795
NM_007294.3(BRCA1):c.3472G>A (p.Glu1158Lys)
NM_007294.3(BRCA1):c.3475dup (p.Ile1159fs) rs1555587638
NM_007294.3(BRCA1):c.3476T>A (p.Ile1159Lys) rs1567791496
NM_007294.3(BRCA1):c.3477_3480del (p.Ile1159fs) rs80357781
NM_007294.3(BRCA1):c.3479A>C (p.Lys1160Thr)
NM_007294.3(BRCA1):c.3479del (p.Lys1160fs) rs273899707
NM_007294.3(BRCA1):c.3481G>T (p.Glu1161Ter) rs786203438
NM_007294.3(BRCA1):c.3481_3491del (p.Glu1161fs) rs80357877
NM_007294.3(BRCA1):c.3481_3493del (p.Glu1161fs) rs1555587588
NM_007294.3(BRCA1):c.3485del (p.Asp1162fs) rs80357509
NM_007294.3(BRCA1):c.3495T>C (p.Phe1165=) rs1555587585
NM_007294.3(BRCA1):c.3496G>C (p.Ala1166Pro) rs745418679
NM_007294.3(BRCA1):c.34C>G (p.Gln12Glu)
NM_007294.3(BRCA1):c.34C>T (p.Gln12Ter) rs80357134
NM_007294.3(BRCA1):c.3506A>G (p.Asp1169Gly) rs1323940169
NM_007294.3(BRCA1):c.3510T>G (p.Ile1170Met)
NM_007294.3(BRCA1):c.3511A>T (p.Lys1171Ter) rs730882164
NM_007294.3(BRCA1):c.3512del (p.Lys1171fs) rs886040139
NM_007294.3(BRCA1):c.3518G>A (p.Ser1173Asn) rs746949187
NM_007294.3(BRCA1):c.3521C>G (p.Ser1174Cys)
NM_007294.3(BRCA1):c.3521_3523CTG[1] (p.Ala1175del) rs1555587557
NM_007294.3(BRCA1):c.3526G>A (p.Val1176Ile)
NM_007294.3(BRCA1):c.3532A>G (p.Ser1178Gly) rs1567791298
NM_007294.3(BRCA1):c.3533G>A (p.Ser1178Asn) rs1294360179
NM_007294.3(BRCA1):c.3535A>C (p.Lys1179Gln) rs587782188
NM_007294.3(BRCA1):c.3540C>T (p.Ser1180=) rs928545955
NM_007294.3(BRCA1):c.3541G>A (p.Val1181Ile) rs56336919
NM_007294.3(BRCA1):c.3543_3544insGA (p.Gln1182fs) rs1555587537
NM_007294.3(BRCA1):c.3544C>T (p.Gln1182Ter) rs80357296
NM_007294.3(BRCA1):c.3548A>G (p.Lys1183Arg) rs16942
NM_007294.3(BRCA1):c.3548A>T (p.Lys1183Ile) rs16942
NM_007294.3(BRCA1):c.354A>G (p.Leu118=) rs1320340280
NM_007294.3(BRCA1):c.3555G>T (p.Glu1185Asp) rs587779368
NM_007294.3(BRCA1):c.3556C>T (p.Leu1186Phe) rs1555587505
NM_007294.3(BRCA1):c.3557T>A (p.Leu1186His) rs1567791164
NM_007294.3(BRCA1):c.3560G>A (p.Ser1187Asn) rs80356975
NM_007294.3(BRCA1):c.3564G>C (p.Arg1188Ser) rs879255484
NM_007294.3(BRCA1):c.3565A>T (p.Ser1189Cys) rs1567791142
NM_007294.3(BRCA1):c.3569C>T (p.Pro1190Leu) rs755209182
NM_007294.3(BRCA1):c.3571del (p.Ser1191fs) rs886040145
NM_007294.3(BRCA1):c.3572G>A (p.Ser1191Asn) rs878854948
NM_007294.3(BRCA1):c.3573C>T (p.Ser1191=) rs864622080
NM_007294.3(BRCA1):c.3576T>C (p.Pro1192=) rs766447664
NM_007294.3(BRCA1):c.3580A>G (p.Thr1194Ala) rs369982706
NM_007294.3(BRCA1):c.3583C>G (p.His1195Asp) rs876659903
NM_007294.3(BRCA1):c.3584A>G (p.His1195Arg) rs28897685
NM_007294.3(BRCA1):c.3586A>T (p.Thr1196Ser) rs1340335862
NM_007294.3(BRCA1):c.3587C>T (p.Thr1196Ile) rs80356944
NM_007294.3(BRCA1):c.3588A>G (p.Thr1196=) rs876658595
NM_007294.3(BRCA1):c.3595G>T (p.Ala1199Ser) rs1555587437
NM_007294.3(BRCA1):c.3596C>T (p.Ala1199Val) rs587782458
NM_007294.3(BRCA1):c.3597T>A (p.Ala1199=) rs1555587434
NM_007294.3(BRCA1):c.3598C>T (p.Gln1200Ter) rs62625307
NM_007294.3(BRCA1):c.3600G>C (p.Gln1200His) rs56214134
NM_007294.3(BRCA1):c.3600G>T (p.Gln1200His) rs56214134
NM_007294.3(BRCA1):c.3601G>A (p.Gly1201Ser) rs55725337
NM_007294.3(BRCA1):c.3603T>C (p.Gly1201=) rs80356830
NM_007294.3(BRCA1):c.3607C>T (p.Arg1203Ter) rs62625308
NM_007294.3(BRCA1):c.3608G>A (p.Arg1203Gln) rs55930959
NM_007294.3(BRCA1):c.3614G>T (p.Gly1205Val)
NM_007294.3(BRCA1):c.3616G>T (p.Ala1206Ser) rs1555587407
NM_007294.3(BRCA1):c.3619A>G (p.Lys1207Glu) rs80357455
NM_007294.3(BRCA1):c.3620A>T (p.Lys1207Met) rs1555587402
NM_007294.3(BRCA1):c.3624dup (p.Leu1209fs) rs80357512
NM_007294.3(BRCA1):c.3625T>G (p.Leu1209Val) rs273900711
NM_007294.3(BRCA1):c.3626T>G (p.Leu1209Ter) rs786203884
NM_007294.3(BRCA1):c.3627dupA (p.Glu1210Argfs) rs80357729
NM_007294.3(BRCA1):c.3629A>G (p.Glu1210Gly) rs1060502347
NM_007294.3(BRCA1):c.3629dup (p.Ser1211fs) rs886040154
NM_007294.3(BRCA1):c.362A>G (p.Glu121Gly) rs1555596419
NM_007294.3(BRCA1):c.3632C>G (p.Ser1211Cys) rs1555587377
NM_007294.3(BRCA1):c.3635C>G (p.Ser1212Ter) rs886038021
NM_007294.3(BRCA1):c.3636A>G (p.Ser1212=) rs148038877
NM_007294.3(BRCA1):c.3637G>T (p.Glu1213Ter) rs1135401864
NM_007294.3(BRCA1):c.363A>G (p.Glu121=) rs1060504552
NM_007294.3(BRCA1):c.3640G>A (p.Glu1214Lys) rs80356923
NM_007294.3(BRCA1):c.3640G>T (p.Glu1214Ter) rs80356923
NM_007294.3(BRCA1):c.3640_3641GA[1] (p.Asn1215fs) rs80357805
NM_007294.3(BRCA1):c.3641del (p.Glu1214fs) rs1567790791
NM_007294.3(BRCA1):c.3642G>C (p.Glu1214Asp) rs398122675
NM_007294.3(BRCA1):c.3647T>A (p.Leu1216Ter) rs397509091
NM_007294.3(BRCA1):c.3648_3652del (p.Leu1216_Ser1217insTer) rs1555587333
NM_007294.3(BRCA1):c.3648dupA (p.Ser1217Ilefs) rs80357902
NM_007294.3(BRCA1):c.3649T>C (p.Ser1217Pro) rs273900712
NM_007294.3(BRCA1):c.3649_3650insA (p.Ser1217fs) rs80357831
NM_007294.3(BRCA1):c.3650C>G (p.Ser1217Cys) rs398122676
NM_007294.3(BRCA1):c.3652A>G (p.Ser1218Gly) rs80356894
NM_007294.3(BRCA1):c.3655G>A (p.Glu1219Lys) rs80356921
NM_007294.3(BRCA1):c.3657G>C (p.Glu1219Asp) rs80356876
NM_007294.3(BRCA1):c.3661G>T (p.Glu1221Ter) rs80357310
NM_007294.3(BRCA1):c.3664G>T (p.Glu1222Ter) rs80357356
NM_007294.3(BRCA1):c.3666G>C (p.Glu1222Asp) rs1555587312
NM_007294.3(BRCA1):c.3667C>T (p.Leu1223Phe) rs1555587309
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.366T>G (p.Val122=) rs190900046
NM_007294.3(BRCA1):c.3672C>G (p.Pro1224=) rs1555587298
NM_007294.3(BRCA1):c.3672del (p.Cys1225fs) rs398122677
NM_007294.3(BRCA1):c.3673T>G (p.Cys1225Gly) rs1382025345
NM_007294.3(BRCA1):c.3674G>C (p.Cys1225Ser) rs1567790638
NM_007294.3(BRCA1):c.3682C>T (p.His1228Tyr) rs1567790599
NM_007294.3(BRCA1):c.3684C>T (p.His1228=) rs786201623
NM_007294.3(BRCA1):c.3685T>C (p.Leu1229=) rs767958299
NM_007294.3(BRCA1):c.3691T>C (p.Phe1231Leu) rs41293451
NM_007294.3(BRCA1):c.3695_3698del (p.Gly1232fs) rs397509093
NM_007294.3(BRCA1):c.3695_3699GTAAA[1] (p.Val1234fs) rs80357609
NM_007294.3(BRCA1):c.3699A>G (p.Lys1233=) rs368690455
NM_007294.3(BRCA1):c.36A>G (p.Gln12=) rs763230080
NM_007294.3(BRCA1):c.3700G>C (p.Val1234Leu) rs763354142
NM_007294.3(BRCA1):c.3705_3747dup (p.Glu1250delinsGlnTyrThrPheSerValTyrTer) rs797044631
NM_007294.3(BRCA1):c.3706_3713del (p.Asn1236fs) rs80357552
NM_007294.3(BRCA1):c.3707A>G (p.Asn1236Ser) rs863224760
NM_007294.3(BRCA1):c.3708T>G (p.Asn1236Lys) rs28897687
NM_007294.3(BRCA1):c.370A>C (p.Ile124Leu) rs80357448
NM_007294.3(BRCA1):c.3710T>C (p.Ile1237Thr) rs876660883
NM_007294.3(BRCA1):c.3710del (p.Ile1237fs) rs80357564
NM_007294.3(BRCA1):c.3711A>G (p.Ile1237Met) rs80357388
NM_007294.3(BRCA1):c.3711_3715del (p.Pro1238fs) rs1135401865
NM_007294.3(BRCA1):c.3713C>T (p.Pro1238Leu) rs28897688
NM_007294.3(BRCA1):c.3717T>A (p.Ser1239=) rs730881453
NM_007294.3(BRCA1):c.3718C>T (p.Gln1240Ter) rs80356903
NM_007294.3(BRCA1):c.3720G>C (p.Gln1240His) rs876658341
NM_007294.3(BRCA1):c.3722C>A (p.Ser1241Tyr) rs80357143
NM_007294.3(BRCA1):c.3724A>G (p.Thr1242Ala) rs80357037
NM_007294.3(BRCA1):c.3726T>C (p.Thr1242=) rs1060504567
NM_007294.3(BRCA1):c.3726dup (p.Arg1243Ter) rs1567790420
NM_007294.3(BRCA1):c.372C>G (p.Ile124Met)
NM_007294.3(BRCA1):c.3734G>A (p.Ser1245Asn) rs1060502348
NM_007294.3(BRCA1):c.3737C>A (p.Thr1246Asn) rs878854949
NM_007294.3(BRCA1):c.3737C>T (p.Thr1246Ile)
NM_007294.3(BRCA1):c.3738C>T (p.Thr1246=) rs778655093
NM_007294.3(BRCA1):c.3739G>A (p.Val1247Ile) rs80357191
NM_007294.3(BRCA1):c.373A>G (p.Ile125Val) rs587776489
NM_007294.3(BRCA1):c.3745A>G (p.Thr1249Ala) rs1555587189
NM_007294.3(BRCA1):c.3747C>T (p.Thr1249=) rs587780801
NM_007294.3(BRCA1):c.3747dup (p.Glu1250fs) rs1555587185
NM_007294.3(BRCA1):c.3748G>A (p.Glu1250Lys) rs28897686
NM_007294.3(BRCA1):c.3748G>T (p.Glu1250Ter) rs28897686
NM_007294.3(BRCA1):c.374dup (p.Gln126fs) rs1555596392
NM_007294.3(BRCA1):c.3750G>A (p.Glu1250=) rs145903082
NM_007294.3(BRCA1):c.3750G>C (p.Glu1250Asp) rs145903082
NM_007294.3(BRCA1):c.3750G>T (p.Glu1250Asp) rs145903082
NM_007294.3(BRCA1):c.3752_3755GTCT[1] (p.Ser1253fs) rs80357868
NM_007294.3(BRCA1):c.3754_3755del (p.Leu1252fs) rs1135401866
NM_007294.3(BRCA1):c.3756G>A (p.Leu1252=) rs752122039
NM_007294.3(BRCA1):c.3758C>G (p.Ser1253Cys) rs397509100
NM_007294.3(BRCA1):c.3759T>G (p.Ser1253=) rs80356852
NM_007294.3(BRCA1):c.3759_3760del (p.Lys1254fs) rs80357520
NM_007294.3(BRCA1):c.3759dupT (p.Lys1254Terfs) rs80357687
NM_007294.3(BRCA1):c.3760A>G (p.Lys1254Glu) rs80357362
NM_007294.3(BRCA1):c.3760_3761insT (p.Lys1254fs) rs80357986
NM_007294.3(BRCA1):c.3761_3762insTT (p.Lys1254fs) rs80357928
NM_007294.3(BRCA1):c.3764dupA (p.Asn1255Lysfs) rs80357848
NM_007294.3(BRCA1):c.3765_3766CA[1] (p.Thr1256fs) rs730881440
NM_007294.3(BRCA1):c.3768A>G (p.Thr1256=) rs786202803
NM_007294.3(BRCA1):c.3768_3769AG[1] (p.Glu1257fs) rs80357579
NM_007294.3(BRCA1):c.3769G>A (p.Glu1257Lys) rs1567790183
NM_007294.3(BRCA1):c.3772G>A (p.Glu1258Lys)
NM_007294.3(BRCA1):c.3772_3776del (p.Glu1258fs) rs1135401867
NM_007294.3(BRCA1):c.3776A>C (p.Asn1259Thr) rs483353090
NM_007294.3(BRCA1):c.3782T>C (p.Leu1261Ser) rs397507219
NM_007294.3(BRCA1):c.3783A>G (p.Leu1261=) rs80356831
NM_007294.3(BRCA1):c.3784T>C (p.Ser1262Pro) rs1011096937
NM_007294.3(BRCA1):c.3787T>C (p.Leu1263=) rs1057523961
NM_007294.3(BRCA1):c.378A>G (p.Gln126=) rs786201256
NM_007294.3(BRCA1):c.3791A>G (p.Lys1264Arg) rs1555587039
NM_007294.3(BRCA1):c.3793A>C (p.Asn1265His) rs1060502364
NM_007294.3(BRCA1):c.3794del (p.Asn1265fs) rs80357767
NM_007294.3(BRCA1):c.3797G>C (p.Ser1266Thr) rs80357160
NM_007294.3(BRCA1):c.379del (p.Ser127fs) rs1555596373
NM_007294.3(BRCA1):c.37A>G (p.Asn13Asp)
NM_007294.3(BRCA1):c.37_40del (p.Asn13fs) rs80357530
NM_007294.3(BRCA1):c.3800T>C (p.Leu1267Ser) rs587782190
NM_007294.3(BRCA1):c.3800T>G (p.Leu1267Ter) rs587782190
NM_007294.3(BRCA1):c.3804T>C (p.Asn1268=) rs140588714
NM_007294.3(BRCA1):c.380G>A (p.Ser127Asn) rs80357189
NM_007294.3(BRCA1):c.380G>T (p.Ser127Ile) rs80357189
NM_007294.3(BRCA1):c.3810C>T (p.Cys1270=) rs886040166
NM_007294.3(BRCA1):c.3812G>C (p.Ser1271Thr) rs1567789989
NM_007294.3(BRCA1):c.3815A>G (p.Asn1272Ser) rs772703445
NM_007294.3(BRCA1):c.3817C>T (p.Gln1273Ter) rs80357208
NM_007294.3(BRCA1):c.3818A>G (p.Gln1273Arg) rs431825400
NM_007294.3(BRCA1):c.3820del (p.Gln1273_Val1274insTer) rs80357616
NM_007294.3(BRCA1):c.3822A>C (p.Val1274=) rs372396487
NM_007294.3(BRCA1):c.3823A>G (p.Ile1275Val) rs80357280
NM_007294.3(BRCA1):c.3825del (p.Leu1276fs) rs1555586983
NM_007294.3(BRCA1):c.3826T>C (p.Leu1276=) rs876659178
NM_007294.3(BRCA1):c.382A>G (p.Met128Val) rs864622124
NM_007294.3(BRCA1):c.3833del (p.Lys1278fs) rs1135401868
NM_007294.3(BRCA1):c.3834G>A (p.Lys1278=) rs876660942
NM_007294.3(BRCA1):c.3835G>A (p.Ala1279Thr) rs80357036
NM_007294.3(BRCA1):c.3836C>T (p.Ala1279Val) rs1555586967
NM_007294.3(BRCA1):c.3841C>T (p.Gln1281Ter) rs80356866
NM_007294.3(BRCA1):c.3843G>T (p.Gln1281His)
NM_007294.3(BRCA1):c.3845A>T (p.Glu1282Val) rs80357217
NM_007294.3(BRCA1):c.3858_3861del (p.Ser1286fs) rs80357842
NM_007294.3(BRCA1):c.385G>A (p.Gly129Ser) rs1555596362
NM_007294.3(BRCA1):c.385G>T (p.Gly129Cys) rs1555596362
NM_007294.3(BRCA1):c.3868A>G (p.Lys1290Glu) rs80357254
NM_007294.3(BRCA1):c.3868A>T (p.Lys1290Ter) rs80357254
NM_007294.3(BRCA1):c.3869A>C (p.Lys1290Thr) rs431825401
NM_007294.3(BRCA1):c.3869_3870del (p.Lys1290fs) rs80357918
NM_007294.3(BRCA1):c.386G>T (p.Gly129Val) rs764231119
NM_007294.3(BRCA1):c.386del (p.Gly129fs) rs1135401836
NM_007294.3(BRCA1):c.3870_3871insC (p.Cys1291fs) rs1135401869
NM_007294.3(BRCA1):c.3874del (p.Ser1292fs) rs587780802
NM_007294.3(BRCA1):c.3875C>G (p.Ser1292Cys)
NM_007294.3(BRCA1):c.3876_3877del (p.Ser1292_Ala1293insTer)
NM_007294.3(BRCA1):c.3877G>C (p.Ala1293Pro) rs397507223
NM_007294.3(BRCA1):c.3878C>A (p.Ala1293Asp) rs80357213
NM_007294.3(BRCA1):c.3886T>C (p.Phe1296Leu)
NM_007294.3(BRCA1):c.3889T>A (p.Ser1297Thr) rs1450793674
NM_007294.3(BRCA1):c.3891T>C (p.Ser1297=) rs1555586847
NM_007294.3(BRCA1):c.3893C>A (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3893C>G (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3895C>T (p.Gln1299Ter) rs80357038
NM_007294.3(BRCA1):c.3896A>G (p.Gln1299Arg) rs876660866
NM_007294.3(BRCA1):c.3897G>A (p.Gln1299=) rs398122678
NM_007294.3(BRCA1):c.389_391delinsTCT (p.Tyr130_Arg131delinsPheTer) rs1064793054
NM_007294.3(BRCA1):c.3900C>T (p.Cys1300=) rs730881454
NM_007294.3(BRCA1):c.3901A>G (p.Ser1301Gly) rs786203580
NM_007294.3(BRCA1):c.3901A>T (p.Ser1301Cys) rs786203580
NM_007294.3(BRCA1):c.3901_3902del (p.Cys1300_Ser1301insTer) rs80357646
NM_007294.3(BRCA1):c.3902G>A (p.Ser1301Asn) rs1057519496
NM_007294.3(BRCA1):c.3903T>A (p.Ser1301Arg) rs273900719
NM_007294.3(BRCA1):c.3904G>T (p.Glu1302Ter) rs80357461
NM_007294.3(BRCA1):c.390C>A (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.3910G>T (p.Glu1304Ter) rs886038028
NM_007294.3(BRCA1):c.3914A>T (p.Asp1305Val) rs431825402
NM_007294.3(BRCA1):c.3916_3917del (p.Leu1306fs) rs80357678
NM_007294.3(BRCA1):c.391A>G (p.Arg131Gly)
NM_007294.3(BRCA1):c.391A>T (p.Arg131Ter) rs80357207
NM_007294.3(BRCA1):c.3928dup (p.Thr1310fs) rs886040176
NM_007294.3(BRCA1):c.3929C>A (p.Thr1310Lys) rs80357257
NM_007294.3(BRCA1):c.3929C>G (p.Thr1310Arg) rs80357257
NM_007294.3(BRCA1):c.3929C>T (p.Thr1310Ile) rs80357257
NM_007294.3(BRCA1):c.3931A>G (p.Asn1311Asp) rs864622233
NM_007294.3(BRCA1):c.3931_3934del (p.Asn1311fs) rs80357864
NM_007294.3(BRCA1):c.3937C>T (p.Gln1313Ter) rs80357318
NM_007294.3(BRCA1):c.3938A>G (p.Gln1313Arg) rs765729710
NM_007294.3(BRCA1):c.3944C>G (p.Pro1315Arg) rs80357500
NM_007294.3(BRCA1):c.3949_3976dup (p.His1326fs)
NM_007294.3(BRCA1):c.3951G>A (p.Leu1317=) rs1060504566
NM_007294.3(BRCA1):c.3954del (p.Ile1318fs) rs1135401870
NM_007294.3(BRCA1):c.3954dup (p.Gly1319fs) rs1135401870
NM_007294.3(BRCA1):c.3955G>A (p.Gly1319Ser) rs431825403
NM_007294.3(BRCA1):c.3956G>A (p.Gly1319Asp) rs587782634
NM_007294.3(BRCA1):c.3956_3957del (p.Gly1319fs) rs1135401871
NM_007294.3(BRCA1):c.3963_3966CAAA[1] (p.Lys1322_Gln1323insTer)
NM_007294.3(BRCA1):c.3964A>T (p.Lys1322Ter) rs80357343
NM_007294.3(BRCA1):c.3965A>C (p.Lys1322Thr) rs80357042
NM_007294.3(BRCA1):c.3965A>G (p.Lys1322Arg) rs80357042
NM_007294.3(BRCA1):c.3966del (p.Lys1322fs) rs80357979
NM_007294.3(BRCA1):c.3967C>T (p.Gln1323Ter) rs80357262
NM_007294.3(BRCA1):c.396C>A (p.Asn132Lys) rs80357413
NM_007294.3(BRCA1):c.3970A>T (p.Met1324Leu) rs587782241
NM_007294.3(BRCA1):c.3974G>A (p.Arg1325Lys) rs921253348
NM_007294.3(BRCA1):c.3975G>A (p.Arg1325=) rs761424661
NM_007294.3(BRCA1):c.3976C>T (p.His1326Tyr) rs1567789376
NM_007294.3(BRCA1):c.3980A>G (p.Gln1327Arg) rs730881444
NM_007294.3(BRCA1):c.3988A>T (p.Ser1330Cys) rs1555586688
NM_007294.3(BRCA1):c.398G>T (p.Arg133Leu)
NM_007294.3(BRCA1):c.3990C>T (p.Ser1330=) rs876660808
NM_007294.3(BRCA1):c.3992A>G (p.Gln1331Arg) rs1060502363
NM_007294.3(BRCA1):c.3993G>A (p.Gln1331=) rs70953658
NM_007294.3(BRCA1):c.3995G>T (p.Gly1332Val) rs730881490
NM_007294.3(BRCA1):c.3998T>C (p.Val1333Ala) rs1135401872
NM_007294.3(BRCA1):c.3G>A (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.3G>T (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.4006A>T (p.Ser1336Cys) rs976725810
NM_007294.3(BRCA1):c.4009G>C (p.Asp1337His) rs886041144
NM_007294.3(BRCA1):c.400G>A (p.Ala134Thr)
NM_007294.3(BRCA1):c.4014G>A (p.Lys1338=) rs1555586655
NM_007294.3(BRCA1):c.4015G>T (p.Glu1339Ter) rs80357021
NM_007294.3(BRCA1):c.4017A>G (p.Glu1339=) rs1555586645
NM_007294.3(BRCA1):c.4018T>C (p.Leu1340=) rs786201646
NM_007294.3(BRCA1):c.401C>A (p.Ala134Asp)
NM_007294.3(BRCA1):c.4021G>A (p.Val1341Ile) rs762908108
NM_007294.3(BRCA1):c.4027G>T (p.Asp1343Tyr) rs1160287128
NM_007294.3(BRCA1):c.4028A>T (p.Asp1343Val) rs775339017
NM_007294.3(BRCA1):c.4031A>G (p.Asp1344Gly) rs55639854
NM_007294.3(BRCA1):c.4035del (p.Glu1346fs) rs80357711
NM_007294.3(BRCA1):c.4036G>A (p.Glu1346Lys) rs80357407
NM_007294.3(BRCA1):c.4036del (p.Glu1346fs) rs886040189
NM_007294.3(BRCA1):c.4039A>G (p.Arg1347Gly) rs28897689
NM_007294.3(BRCA1):c.4039A>T (p.Arg1347Ter) rs28897689
NM_007294.3(BRCA1):c.4039_4040AG[1] (p.Gly1348fs) rs80357727
NM_007294.3(BRCA1):c.403A>T (p.Lys135Ter) rs879255485
NM_007294.3(BRCA1):c.4045A>G (p.Thr1349Ala) rs80357231
NM_007294.3(BRCA1):c.4045_4046insTA (p.Thr1349fs)
NM_007294.3(BRCA1):c.4046C>G (p.Thr1349Arg) rs80357345
NM_007294.3(BRCA1):c.4046C>T (p.Thr1349Met) rs80357345
NM_007294.3(BRCA1):c.4047G>A (p.Thr1349=) rs758515222
NM_007294.3(BRCA1):c.4047G>T (p.Thr1349=) rs758515222
NM_007294.3(BRCA1):c.4048G>C (p.Gly1350Arg) rs748674194
NM_007294.3(BRCA1):c.4048G>T (p.Gly1350Cys) rs748674194
NM_007294.3(BRCA1):c.4049G>T (p.Gly1350Val) rs1433564897
NM_007294.3(BRCA1):c.4049dup (p.Glu1352fs) rs397509131
NM_007294.3(BRCA1):c.4055A>T (p.Glu1352Val) rs879254228
NM_007294.3(BRCA1):c.4057G>A (p.Glu1353Lys)
NM_007294.3(BRCA1):c.4062_4068del (p.Asn1354fs) rs397509134
NM_007294.3(BRCA1):c.4063A>G (p.Asn1355Asp) rs876660530
NM_007294.3(BRCA1):c.4064_4066delinsT (p.Asn1355fs) rs1060502345
NM_007294.3(BRCA1):c.4065_4068del (p.Asn1355fs) rs80357508
NM_007294.3(BRCA1):c.4066_4069del (p.Gln1356fs) rs397509135
NM_007294.3(BRCA1):c.406dupA (p.Arg136Lysfs) rs80357709
NM_007294.3(BRCA1):c.4072G>T (p.Glu1358Ter) rs397509136
NM_007294.3(BRCA1):c.4073A>G (p.Glu1358Gly) rs397507225
NM_007294.3(BRCA1):c.4075C>G (p.Gln1359Glu) rs80357456
NM_007294.3(BRCA1):c.407del (p.Arg136fs) rs886040200
NM_007294.3(BRCA1):c.4081A>C (p.Met1361Leu) rs80357218
NM_007294.3(BRCA1):c.4082T>C (p.Met1361Thr)
NM_007294.3(BRCA1):c.4083G>A (p.Met1361Ile) rs374192364
NM_007294.3(BRCA1):c.4084G>A (p.Asp1362Asn)
NM_007294.3(BRCA1):c.4088C>T (p.Ser1363Leu) rs398122680
NM_007294.3(BRCA1):c.4092C>T (p.Asn1364=) rs786201566
NM_007294.3(BRCA1):c.4096+11C>T rs1060504551
NM_007294.3(BRCA1):c.4096+18T>C rs1057523237
NM_007294.3(BRCA1):c.4096+1G>A rs80358178
NM_007294.3(BRCA1):c.4096+3A>G rs80358015
NM_007294.3(BRCA1):c.4096+4T>C
NM_007294.3(BRCA1):c.4096+5T>A rs1555586462
NM_007294.3(BRCA1):c.4096+6G>A rs776270258
NM_007294.3(BRCA1):c.4096+7G>A rs1060504565
NM_007294.3(BRCA1):c.4096G>C (p.Gly1366Arg) rs431825405
NM_007294.3(BRCA1):c.4097-10G>A rs80358057
NM_007294.3(BRCA1):c.4097-11T>C rs80358072
NM_007294.3(BRCA1):c.4097-15T>C rs1060504586
NM_007294.3(BRCA1):c.4097-16G>A rs1555586303
NM_007294.3(BRCA1):c.4097-20C>T rs80358169
NM_007294.3(BRCA1):c.4097-6T>C rs1555586284
NM_007294.3(BRCA1):c.4097G>A (p.Gly1366Asp) rs876660948
NM_007294.3(BRCA1):c.4105G>C (p.Ala1369Pro)
NM_007294.3(BRCA1):c.410T>C (p.Leu137Pro) rs751078452
NM_007294.3(BRCA1):c.4110_4111del (p.Gly1371fs) rs80357529
NM_007294.3(BRCA1):c.4111G>C (p.Gly1371Arg) rs774593602
NM_007294.3(BRCA1):c.4113G>A (p.Gly1371=) rs147448807
NM_007294.3(BRCA1):c.4113G>T (p.Gly1371=) rs147448807
NM_007294.3(BRCA1):c.4113del (p.Cys1372fs) rs80357861
NM_007294.3(BRCA1):c.4115G>A (p.Cys1372Tyr) rs55848034
NM_007294.3(BRCA1):c.4117G>T (p.Glu1373Ter) rs80357259
NM_007294.3(BRCA1):c.4118_4119AG[1] (p.Glu1373_Ser1374insTer) rs80357787
NM_007294.3(BRCA1):c.411dup (p.Leu138fs) rs886040205
NM_007294.3(BRCA1):c.4121G>A (p.Ser1374Asn) rs1382449149
NM_007294.3(BRCA1):c.4122_4123del (p.Ser1374fs) rs80357691
NM_007294.3(BRCA1):c.4123G>A (p.Glu1375Lys) rs80357397
NM_007294.3(BRCA1):c.4127C>G (p.Thr1376Arg) rs80356986
NM_007294.3(BRCA1):c.4128_4129del (p.Ser1377fs) rs80357921
NM_007294.3(BRCA1):c.4129A>G (p.Ser1377Gly) rs730881491
NM_007294.3(BRCA1):c.4131C>T (p.Ser1377=) rs80356871
NM_007294.3(BRCA1):c.4132G>A (p.Val1378Ile) rs28897690
NM_007294.3(BRCA1):c.413T>C (p.Leu138Pro) rs200449040
NM_007294.3(BRCA1):c.4144T>A (p.Cys1382Ser) rs786202106
NM_007294.3(BRCA1):c.4146C>T (p.Cys1382=) rs1057517574
NM_007294.3(BRCA1):c.4150G>A (p.Gly1384Arg) rs1555586146
NM_007294.3(BRCA1):c.4152_4153del (p.Leu1385fs) rs1567788338
NM_007294.3(BRCA1):c.4159_4160TC[1] (p.Gln1388fs) rs80357565
NM_007294.3(BRCA1):c.415C>T (p.Gln139Ter) rs80357372
NM_007294.3(BRCA1):c.4161_4164del (p.Gln1388fs)
NM_007294.3(BRCA1):c.4162C>T (p.Gln1388Ter) rs876660601
NM_007294.3(BRCA1):c.4163_4164AG[1] (p.Gln1388_Ser1389insTer) rs80357572
NM_007294.3(BRCA1):c.4163dup (p.Ser1389fs) rs80357788
NM_007294.3(BRCA1):c.4167_4168del (p.Ser1389fs) rs397509144
NM_007294.3(BRCA1):c.4168G>A (p.Asp1390Asn) rs752300203
NM_007294.3(BRCA1):c.4169A>G (p.Asp1390Gly) rs1165149350
NM_007294.3(BRCA1):c.416A>G (p.Gln139Arg) rs786202213
NM_007294.3(BRCA1):c.4171A>G (p.Ile1391Val)
NM_007294.3(BRCA1):c.4172T>G (p.Ile1391Ser) rs397509146
NM_007294.3(BRCA1):c.4175T>C (p.Leu1392Ser)
NM_007294.3(BRCA1):c.4178C>G (p.Thr1393Ser) rs1555586071
NM_007294.3(BRCA1):c.4179C>T (p.Thr1393=) rs753735698
NM_007294.3(BRCA1):c.4180A>C (p.Thr1394Pro) rs1555586062
NM_007294.3(BRCA1):c.4181C>T (p.Thr1394Ile) rs397507226
NM_007294.3(BRCA1):c.4182T>C (p.Thr1394=) rs864622540
NM_007294.3(BRCA1):c.4183C>T (p.Gln1395Ter) rs80357260
NM_007294.3(BRCA1):c.4184A>G (p.Gln1395Arg) rs80356972
NM_007294.3(BRCA1):c.4185+10G>A rs80358104
NM_007294.3(BRCA1):c.4185+10G>C rs80358104
NM_007294.3(BRCA1):c.4185+12G>A rs1453378073
NM_007294.3(BRCA1):c.4185+14G>C rs762153716
NM_007294.3(BRCA1):c.4185+16G>C rs774646943
NM_007294.3(BRCA1):c.4185+2_4185+22del21insA rs273900724
NM_007294.3(BRCA1):c.4185+4105C>T
NM_007294.3(BRCA1):c.4185+5A>G rs766330646
NM_007294.3(BRCA1):c.4185+9C>T rs80358034
NM_007294.3(BRCA1):c.4185G>A (p.Gln1395=) rs80356857
NM_007294.3(BRCA1):c.4186-19C>T rs80358016
NM_007294.3(BRCA1):c.4186-2A>G rs878854950
NM_007294.3(BRCA1):c.4186-?_4357+?dup172
NM_007294.3(BRCA1):c.4186-?_4675+?del
NM_007294.3(BRCA1):c.4186-?_5193+?del
NM_007294.3(BRCA1):c.4186C>A (p.Gln1396Lys) rs80357011
NM_007294.3(BRCA1):c.4186C>T (p.Gln1396Ter) rs80357011
NM_007294.3(BRCA1):c.4192G>A (p.Asp1398Asn)
NM_007294.3(BRCA1):c.4193A>G (p.Asp1398Gly) rs761640584
NM_007294.3(BRCA1):c.4194_4267del (p.Asp1398fs)
NM_007294.3(BRCA1):c.4195del (p.Thr1399fs) rs1567783654
NM_007294.3(BRCA1):c.4196_4197delinsT (p.Thr1399fs) rs886040213
NM_007294.3(BRCA1):c.4197C>G (p.Thr1399=) rs876659552
NM_007294.3(BRCA1):c.4199T>A (p.Met1400Lys)
NM_007294.3(BRCA1):c.4204C>T (p.His1402Tyr) rs80357365
NM_007294.3(BRCA1):c.4205A>C (p.His1402Pro) rs80356882
NM_007294.3(BRCA1):c.4209C>T (p.Asn1403=) rs786201224
NM_007294.3(BRCA1):c.420T>C (p.Ser140=) rs730881448
NM_007294.3(BRCA1):c.4211del (p.Leu1404fs) rs1555584251
NM_007294.3(BRCA1):c.4213A>G (p.Ile1405Val) rs80357353
NM_007294.3(BRCA1):c.4214dup (p.Leu1407fs)
NM_007294.3(BRCA1):c.4219C>G (p.Leu1407Val) rs397507227
NM_007294.3(BRCA1):c.4222C>T (p.Gln1408Ter) rs80356989
NM_007294.3(BRCA1):c.4223A>C (p.Gln1408Pro) rs1555584227
NM_007294.3(BRCA1):c.4225C>T (p.Gln1409Ter) rs886040218
NM_007294.3(BRCA1):c.4231A>G (p.Met1411Val) rs587781768
NM_007294.3(BRCA1):c.4234G>C (p.Ala1412Pro)
NM_007294.3(BRCA1):c.423A>G (p.Glu141=) rs777102216
NM_007294.3(BRCA1):c.4241T>C (p.Leu1414Pro) rs878854951
NM_007294.3(BRCA1):c.4241T>G (p.Leu1414Arg) rs878854951
NM_007294.3(BRCA1):c.4242A>G (p.Leu1414=) rs1057521982
NM_007294.3(BRCA1):c.4243G>A (p.Glu1415Lys) rs1057519558
NM_007294.3(BRCA1):c.4243G>C (p.Glu1415Gln) rs1057519558
NM_007294.3(BRCA1):c.4243G>T (p.Glu1415Ter) rs1057519558
NM_007294.3(BRCA1):c.4243del (p.Glu1415fs) rs80357981
NM_007294.3(BRCA1):c.4245A>G (p.Glu1415=) rs41293453
NM_007294.3(BRCA1):c.4249G>A (p.Val1417Met) rs1029805420
NM_007294.3(BRCA1):c.4251G>A (p.Val1417=) rs777057839
NM_007294.3(BRCA1):c.4255G>C (p.Glu1419Gln) rs80357309
NM_007294.3(BRCA1):c.4258C>T (p.Gln1420Ter) rs80357305
NM_007294.3(BRCA1):c.425C>A (p.Pro142His) rs55971303
NM_007294.3(BRCA1):c.4261C>T (p.His1421Tyr) rs80357013
NM_007294.3(BRCA1):c.4262A>G (p.His1421Arg) rs80357079
NM_007294.3(BRCA1):c.4265G>A (p.Gly1422Glu) rs747364414
NM_007294.3(BRCA1):c.4266G>A (p.Gly1422=) rs1555584142
NM_007294.3(BRCA1):c.4269C>T (p.Ser1423=) rs786202278
NM_007294.3(BRCA1):c.426C>T (p.Pro142=) rs542687218
NM_007294.3(BRCA1):c.4272G>C (p.Gln1424His) rs398122684
NM_007294.3(BRCA1):c.427G>A (p.Glu143Lys) rs80356991
NM_007294.3(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.3(BRCA1):c.4283dup (p.Ser1428fs) rs1135401873
NM_007294.3(BRCA1):c.4288C>G (p.Pro1430Ala) rs80357466
NM_007294.3(BRCA1):c.4289dup (p.Ser1431fs) rs80357556
NM_007294.3(BRCA1):c.4292C>T (p.Ser1431Phe) rs748839289
NM_007294.3(BRCA1):c.4297A>G (p.Ile1433Val) rs541512953
NM_007294.3(BRCA1):c.429A>C (p.Glu143Asp) rs397507228
NM_007294.3(BRCA1):c.42C>T (p.Val14=) rs80356827
NM_007294.3(BRCA1):c.4300dupA (p.Ser1434Lysfs) rs80357790
NM_007294.3(BRCA1):c.4304A>G (p.Asp1435Gly) rs876660809
NM_007294.3(BRCA1):c.4304A>T (p.Asp1435Val)
NM_007294.3(BRCA1):c.4308T>C (p.Ser1436=) rs1060915
NM_007294.3(BRCA1):c.4310C>T (p.Ser1437Phe) rs1555584083
NM_007294.3(BRCA1):c.4310del (p.Ser1437fs) rs1135401874
NM_007294.3(BRCA1):c.4315C>T (p.Leu1439Phe) rs781260818
NM_007294.3(BRCA1):c.431del (p.Asn144fs) rs397509162
NM_007294.3(BRCA1):c.4321dupG (p.Asp1441Glyfs) rs80357748
NM_007294.3(BRCA1):c.4327C>G (p.Arg1443Gly) rs41293455
NM_007294.3(BRCA1):c.4327C>T (p.Arg1443Ter) rs41293455
NM_007294.3(BRCA1):c.4331A>T (p.Asn1444Ile)
NM_007294.3(BRCA1):c.4332T>C (p.Asn1444=) rs752824502
NM_007294.3(BRCA1):c.4335_4338dup (p.Gln1447fs) rs397509164
NM_007294.3(BRCA1):c.4337A>C (p.Glu1446Ala) rs1273755215
NM_007294.3(BRCA1):c.4338A>T (p.Glu1446Asp) rs1555584018
NM_007294.3(BRCA1):c.4339C>A (p.Gln1447Lys) rs80357067
NM_007294.3(BRCA1):c.4342A>G (p.Ser1448Gly) rs80357486
NM_007294.3(BRCA1):c.4344C>T (p.Ser1448=) rs1250691798
NM_007294.3(BRCA1):c.4347A>G (p.Thr1449=) rs80356840
NM_007294.3(BRCA1):c.4348del (p.Ser1450fs) rs1135401932
NM_007294.3(BRCA1):c.4352A>G (p.Glu1451Gly) rs949793708
NM_007294.3(BRCA1):c.4353A>G (p.Glu1451=) rs786202387
NM_007294.3(BRCA1):c.4354A>T (p.Lys1452Ter) rs398122685
NM_007294.3(BRCA1):c.4357+14G>T rs760989937
NM_007294.3(BRCA1):c.4357+16C>A rs1060504577
NM_007294.3(BRCA1):c.4357+16C>T rs1060504577
NM_007294.3(BRCA1):c.4357+17A>G rs80358180
NM_007294.3(BRCA1):c.4357+19A>C rs772281432
NM_007294.3(BRCA1):c.4357+1G>A rs80358027
NM_007294.3(BRCA1):c.4357+1G>T rs80358027
NM_007294.3(BRCA1):c.4357+2T>G rs80358152
NM_007294.3(BRCA1):c.4357+5G>A rs1555583976
NM_007294.3(BRCA1):c.4357+5_4357+6delGT rs864622119
NM_007294.3(BRCA1):c.4357+6T>C rs80358143
NM_007294.3(BRCA1):c.4357+7A>G rs431825407
NM_007294.3(BRCA1):c.4357G>T (p.Ala1453Ser) rs1555583984
NM_007294.3(BRCA1):c.4358-10C>T rs80358111
NM_007294.3(BRCA1):c.4358-2725T>C rs374519494
NM_007294.3(BRCA1):c.4358-2786G>A rs374435098
NM_007294.3(BRCA1):c.4358-7T>C rs1555582733
NM_007294.3(BRCA1):c.4358-9C>T rs1057521549
NM_007294.3(BRCA1):c.4358-?_4484+?del
NM_007294.3(BRCA1):c.4358-?_5074+?del
NM_007294.3(BRCA1):c.4358-?_5277+?del
NM_007294.3(BRCA1):c.4361T>C (p.Val1454Ala) rs587782606
NM_007294.3(BRCA1):c.4368T>G (p.Thr1456=) rs1171220106
NM_007294.3(BRCA1):c.4370C>A (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4372C>T (p.Gln1458Ter) rs80356932
NM_007294.3(BRCA1):c.4379del (p.Ser1460fs) rs786203149
NM_007294.3(BRCA1):c.437C>T (p.Ser146Phe) rs1060502358
NM_007294.3(BRCA1):c.4380T>C (p.Ser1460=) rs786203100
NM_007294.3(BRCA1):c.4382G>C (p.Ser1461Thr) rs1555582692
NM_007294.3(BRCA1):c.4382_4388dup (p.Tyr1463Ter) rs1567779838
NM_007294.3(BRCA1):c.4384G>A (p.Glu1462Lys) rs141255461
NM_007294.3(BRCA1):c.4386dup (p.Tyr1463fs) rs786204267
NM_007294.3(BRCA1):c.4389C>A (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4389C>G (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4390C>A (p.Pro1464Thr) rs1259139517
NM_007294.3(BRCA1):c.4390C>G (p.Pro1464Ala)
NM_007294.3(BRCA1):c.4391_4393delinsTT (p.Pro1464fs) rs273900730
NM_007294.3(BRCA1):c.4392T>A (p.Pro1464=) rs794727102
NM_007294.3(BRCA1):c.4392del (p.Pro1464_Ile1465insTer) rs1064793577
NM_007294.3(BRCA1):c.4394dup (p.Ser1466fs) rs1555582670
NM_007294.3(BRCA1):c.4396A>T (p.Ser1466Cys) rs1064794830
NM_007294.3(BRCA1):c.4396dup (p.Ser1466fs) rs397509170
NM_007294.3(BRCA1):c.4399C>T (p.Gln1467Ter) rs397509171
NM_007294.3(BRCA1):c.439T>C (p.Leu147=) rs794727800
NM_007294.3(BRCA1):c.4401del (p.Asn1468fs) rs587781611
NM_007294.3(BRCA1):c.4402A>C (p.Asn1468His) rs80357022
NM_007294.3(BRCA1):c.4405C>A (p.Pro1469Thr)
NM_007294.3(BRCA1):c.441+13G>A rs1057520408
NM_007294.3(BRCA1):c.441+17T>C rs368415464
NM_007294.3(BRCA1):c.441+17delT rs730881449
NM_007294.3(BRCA1):c.441+18C>T rs371973519
NM_007294.3(BRCA1):c.441+19_441+20delTT rs764884677
NM_007294.3(BRCA1):c.441+2T>A rs397509173
NM_007294.3(BRCA1):c.441+2_441+6dupTAAAA rs1555596276
NM_007294.3(BRCA1):c.441+3dup rs1060504561
NM_007294.3(BRCA1):c.4410A>T (p.Glu1470Asp) rs80357075
NM_007294.3(BRCA1):c.4412G>T (p.Gly1471Val) rs587782708
NM_007294.3(BRCA1):c.4416_4417delinsG (p.Ser1473fs) rs397509174
NM_007294.3(BRCA1):c.4417T>C (p.Ser1473Pro) rs398122686
NM_007294.3(BRCA1):c.4419T>A (p.Ser1473=) rs730881455
NM_007294.3(BRCA1):c.441G>C (p.Leu147Phe) rs748876625
NM_007294.3(BRCA1):c.442-10T>A
NM_007294.3(BRCA1):c.442-10T>C rs200991398
NM_007294.3(BRCA1):c.442-1G>T rs1351019392
NM_007294.3(BRCA1):c.442-22_442-13delTGTTCTTTAC rs879254224
NM_007294.3(BRCA1):c.442-3T>C rs8176139
NM_007294.3(BRCA1):c.442-3T>G rs8176139
NM_007294.3(BRCA1):c.442-?_4357+?del
NM_007294.3(BRCA1):c.442-?_547+?(2)
NM_007294.3(BRCA1):c.442-?_547+?del
NM_007294.3(BRCA1):c.442-?_593+?del
NM_007294.3(BRCA1):c.4422T>C (p.Ala1474=) rs756281673
NM_007294.3(BRCA1):c.4423G>T (p.Asp1475Tyr) rs876660940
NM_007294.3(BRCA1):c.4427A>C (p.Lys1476Thr) rs750437234
NM_007294.3(BRCA1):c.442C>A (p.Gln148Lys) rs876659614
NM_007294.3(BRCA1):c.442C>T (p.Gln148Ter) rs876659614
NM_007294.3(BRCA1):c.4441G>A (p.Ala1481Thr) rs1135401828
NM_007294.3(BRCA1):c.4445A>T (p.Asp1482Val) rs757726297
NM_007294.3(BRCA1):c.4447A>C (p.Ser1483Arg) rs1555582583
NM_007294.3(BRCA1):c.4450T>G (p.Ser1484Ala) rs80357404
NM_007294.3(BRCA1):c.4453_4474del (p.Thr1485fs) rs886040232
NM_007294.3(BRCA1):c.4454C>T (p.Thr1485Ile) rs80356870
NM_007294.3(BRCA1):c.4456A>T (p.Ser1486Cys) rs397507232
NM_007294.3(BRCA1):c.4456del (p.Ser1486fs) rs397509179
NM_007294.3(BRCA1):c.445del (p.Glu149fs) rs1060502327
NM_007294.3(BRCA1):c.4468G>T (p.Glu1490Ter) rs138608489
NM_007294.3(BRCA1):c.446A>C (p.Glu149Ala) rs397507233
NM_007294.3(BRCA1):c.4471C>A (p.Pro1491Thr) rs111034213
NM_007294.3(BRCA1):c.4474G>A (p.Gly1492Arg)
NM_007294.3(BRCA1):c.4474G>T (p.Gly1492Ter) rs863224511
NM_007294.3(BRCA1):c.4477G>A (p.Val1493Met) rs949577051
NM_007294.3(BRCA1):c.4480G>A (p.Glu1494Lys) rs80357148
NM_007294.3(BRCA1):c.4481A>G (p.Glu1494Gly) rs758779691
NM_007294.3(BRCA1):c.4484+14A>G rs80358022
NM_007294.3(BRCA1):c.4484+15T>C rs760275914
NM_007294.3(BRCA1):c.4484+16G>A rs1369751677
NM_007294.3(BRCA1):c.4484+1G>A rs80358063
NM_007294.3(BRCA1):c.4484+1delG rs397509181
NM_007294.3(BRCA1):c.4484+4A>G rs1567779433
NM_007294.3(BRCA1):c.4484+5G>A
NM_007294.3(BRCA1):c.4484+5G>C rs886040910
NM_007294.3(BRCA1):c.4484G>T (p.Arg1495Met) rs80357389
NM_007294.3(BRCA1):c.4485-10A>G rs863224420
NM_007294.3(BRCA1):c.4485-18T>A rs80358000
NM_007294.3(BRCA1):c.4485-1G>A rs80358189
NM_007294.3(BRCA1):c.4485-1G>T rs80358189
NM_007294.3(BRCA1):c.4485-2A>C
NM_007294.3(BRCA1):c.4485-2A>G rs80358054
NM_007294.3(BRCA1):c.4485-2A>T rs80358054
NM_007294.3(BRCA1):c.4485-8C>T rs397507234
NM_007294.3(BRCA1):c.4485-?_4675+?del
NM_007294.3(BRCA1):c.4485-?_4986+?del
NM_007294.3(BRCA1):c.4485_4675del191 (p.Ser1496Glyfs) rs1555581778
NM_007294.3(BRCA1):c.4487C>G (p.Ser1496Ter) rs80356953
NM_007294.3(BRCA1):c.4493del (p.Pro1498fs) rs398122687
NM_007294.3(BRCA1):c.4503C>A (p.Cys1501Ter) rs747539984
NM_007294.3(BRCA1):c.4503C>T (p.Cys1501=) rs747539984
NM_007294.3(BRCA1):c.4505C>A (p.Pro1502Gln) rs56335406
NM_007294.3(BRCA1):c.4505C>T (p.Pro1502Leu)
NM_007294.3(BRCA1):c.4507_4511del (p.Ser1503fs) rs1135401877
NM_007294.3(BRCA1):c.4508C>A (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4508C>G (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4512A>G (p.Leu1504=) rs1555582056
NM_007294.3(BRCA1):c.4514A>G (p.Asp1505Gly)
NM_007294.3(BRCA1):c.4514A>T (p.Asp1505Val) rs1567778319
NM_007294.3(BRCA1):c.4516del (p.Asp1506fs) rs273900736
NM_007294.3(BRCA1):c.4520G>C (p.Arg1507Thr) rs80357470
NM_007294.3(BRCA1):c.4521G>A (p.Arg1507=) rs1435385135
NM_007294.3(BRCA1):c.4523G>A (p.Trp1508Ter) rs786202631
NM_007294.3(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.3(BRCA1):c.4531_4532CA[1] (p.His1511fs) rs80357534
NM_007294.3(BRCA1):c.4533C>A (p.His1511Gln) rs1567778195
NM_007294.3(BRCA1):c.4534A>T (p.Ser1512Cys) rs80357137
NM_007294.3(BRCA1):c.4534del (p.Ser1512fs) rs1567778176
NM_007294.3(BRCA1):c.4535G>T (p.Ser1512Ile) rs1800744
NM_007294.3(BRCA1):c.4541C>T (p.Ser1514Phe) rs863224761
NM_007294.3(BRCA1):c.4544G>A (p.Gly1515Glu) rs398122688
NM_007294.3(BRCA1):c.4545G>T (p.Gly1515=) rs755731300
NM_007294.3(BRCA1):c.4549C>T (p.Leu1517Phe)
NM_007294.3(BRCA1):c.4550T>C (p.Leu1517Pro) rs1555581980
NM_007294.3(BRCA1):c.4552C>A (p.Gln1518Lys) rs80356881
NM_007294.3(BRCA1):c.4552C>G (p.Gln1518Glu) rs80356881
NM_007294.3(BRCA1):c.4555A>G (p.Asn1519Asp) rs1567778111
NM_007294.3(BRCA1):c.4557T>C (p.Asn1519=) rs876659243
NM_007294.3(BRCA1):c.4566C>A (p.Tyr1522Ter) rs886040234
NM_007294.3(BRCA1):c.4567C>G (p.Pro1523Ala)
NM_007294.3(BRCA1):c.4568del (p.Pro1523fs) rs1567778075
NM_007294.3(BRCA1):c.456_457del (p.Ser153fs) rs80357882
NM_007294.3(BRCA1):c.4573C>T (p.Gln1525Ter) rs886040237
NM_007294.3(BRCA1):c.4574_4575del (p.Gln1525fs) rs80357813
NM_007294.3(BRCA1):c.4575_4585del (p.Gln1525fs) rs397509184
NM_007294.3(BRCA1):c.4576G>A (p.Glu1526Lys) rs878853294
NM_007294.3(BRCA1):c.457A>C (p.Ser153Arg) rs28897674
NM_007294.3(BRCA1):c.457A>G (p.Ser153Gly) rs28897674
NM_007294.3(BRCA1):c.4581G>A (p.Glu1527=) rs1060504560
NM_007294.3(BRCA1):c.4595_4596insCT (p.Asp1533fs) rs80357699
NM_007294.3(BRCA1):c.45dup (p.Asn16Ter) rs730881457
NM_007294.3(BRCA1):c.4600G>A (p.Val1534Met) rs55815649
NM_007294.3(BRCA1):c.4603G>T (p.Glu1535Ter) rs80357366
NM_007294.3(BRCA1):c.4609C>T (p.Gln1537Ter) rs80357229
NM_007294.3(BRCA1):c.4609_4610insCC (p.Gln1537fs) rs886038035
NM_007294.3(BRCA1):c.460G>A (p.Val154Ile) rs1064793318
NM_007294.3(BRCA1):c.460_467del (p.Val154fs) rs1060502362
NM_007294.3(BRCA1):c.4610A>G (p.Gln1537Arg) rs70953659
NM_007294.3(BRCA1):c.4611_4612insG (p.Gln1538fs) rs80357915
NM_007294.3(BRCA1):c.4612C>T (p.Gln1538Ter) rs80356992
NM_007294.3(BRCA1):c.4616T>C (p.Leu1539Pro) rs377629427
NM_007294.3(BRCA1):c.4616dup (p.Glu1540fs) rs1555581874
NM_007294.3(BRCA1):c.4618_4621delinsAAA (p.Glu1540fs) rs886040240
NM_007294.3(BRCA1):c.4623_4632del (p.Glu1541fs) rs1567777811
NM_007294.3(BRCA1):c.4625C>G (p.Ser1542Cys) rs41293457
NM_007294.3(BRCA1):c.4625_4626del (p.Ser1542fs) rs80357542
NM_007294.3(BRCA1):c.4629G>A (p.Gly1543=) rs1555581858
NM_007294.3(BRCA1):c.4635C>G (p.His1545Gln) rs373686790
NM_007294.3(BRCA1):c.4635C>T (p.His1545=) rs373686790
NM_007294.3(BRCA1):c.4636G>A (p.Asp1546Asn) rs28897691
NM_007294.3(BRCA1):c.4639T>A (p.Leu1547Met) rs730881492
NM_007294.3(BRCA1):c.463C>G (p.Gln155Glu) rs80357180
NM_007294.3(BRCA1):c.4641G>C (p.Leu1547Phe)
NM_007294.3(BRCA1):c.4641G>T (p.Leu1547Phe) rs864622265
NM_007294.3(BRCA1):c.4643C>T (p.Thr1548Met) rs273900737
NM_007294.3(BRCA1):c.4644G>A (p.Thr1548=) rs28897692
NM_007294.3(BRCA1):c.4647A>C (p.Glu1549Asp) rs1371814796
NM_007294.3(BRCA1):c.4649C>T (p.Thr1550Ile) rs80357076
NM_007294.3(BRCA1):c.4653T>C (p.Ser1551=) rs587780863
NM_007294.3(BRCA1):c.4654T>C (p.Tyr1552His) rs1265352633
NM_007294.3(BRCA1):c.4654_4655insC (p.Tyr1552fs) rs1555581824
NM_007294.3(BRCA1):c.4655_4658del (p.Tyr1552fs) rs80357561
NM_007294.3(BRCA1):c.4656C>G (p.Tyr1552Ter) rs80357151
NM_007294.3(BRCA1):c.465A>C (p.Gln155His) rs864622260
NM_007294.3(BRCA1):c.465A>T (p.Gln155His) rs864622260
NM_007294.3(BRCA1):c.4664G>A (p.Arg1555Lys) rs786202165
NM_007294.3(BRCA1):c.4665G>A (p.Arg1555=) rs878854952
NM_007294.3(BRCA1):c.4666C>T (p.Gln1556Ter) rs1555581812
NM_007294.3(BRCA1):c.4669G>C (p.Asp1557His) rs80356906
NM_007294.3(BRCA1):c.4669G>T (p.Asp1557Tyr) rs80356906
NM_007294.3(BRCA1):c.466C>A (p.Leu156Ile) rs587778115
NM_007294.3(BRCA1):c.466C>T (p.Leu156Phe) rs587778115
NM_007294.3(BRCA1):c.466_467CT[2] (p.Leu156_Ser157insTer) rs80357887
NM_007294.3(BRCA1):c.4671T>G (p.Asp1557Glu)
NM_007294.3(BRCA1):c.4672C>G (p.Leu1558Val) rs1555581794
NM_007294.3(BRCA1):c.4672del (p.Asp1557_Leu1558insTer)
NM_007294.3(BRCA1):c.4673T>G (p.Leu1558Arg)
NM_007294.3(BRCA1):c.4675+11A>G rs750095985
NM_007294.3(BRCA1):c.4675+17_4675+18delTGinsCT rs1555581770
NM_007294.3(BRCA1):c.4675+1G>A rs80358044
NM_007294.3(BRCA1):c.4675+1G>C rs80358044
NM_007294.3(BRCA1):c.4675+1G>T rs80358044
NM_007294.3(BRCA1):c.4675+20A>G rs780870669
NM_007294.3(BRCA1):c.4675+2T>A rs879255293
NM_007294.3(BRCA1):c.4675+3A>G rs80358082
NM_007294.3(BRCA1):c.4675+3A>T rs80358082
NM_007294.3(BRCA1):c.4675+7T>C rs273900739
NM_007294.3(BRCA1):c.4675G>A (p.Glu1559Lys) rs80356988
NM_007294.3(BRCA1):c.4676-11A>G rs80358088
NM_007294.3(BRCA1):c.4676-16C>G rs80358067
NM_007294.3(BRCA1):c.4676-1G>A rs80358008
NM_007294.3(BRCA1):c.4676-1G>C rs80358008
NM_007294.3(BRCA1):c.4676-2A>C rs80358096
NM_007294.3(BRCA1):c.4676-2A>G rs80358096
NM_007294.3(BRCA1):c.4676-7C>T rs80358005
NM_007294.3(BRCA1):c.4676-8C>G rs80358021
NM_007294.3(BRCA1):c.4676-?_4986+?del
NM_007294.3(BRCA1):c.4676-?_5074+?del
NM_007294.3(BRCA1):c.4676_4678delAGG rs1555581108
NM_007294.3(BRCA1):c.4676dup (p.Thr1561fs) rs1135401878
NM_007294.3(BRCA1):c.4678G>T (p.Gly1560Ter) rs80357349
NM_007294.3(BRCA1):c.4679G>T (p.Gly1560Val) rs564757581
NM_007294.3(BRCA1):c.4682C>A (p.Thr1561Asn) rs56158747
NM_007294.3(BRCA1):c.4682C>T (p.Thr1561Ile) rs56158747
NM_007294.3(BRCA1):c.4683C>G (p.Thr1561=) rs878853265
NM_007294.3(BRCA1):c.4683C>T (p.Thr1561=) rs878853265
NM_007294.3(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.3(BRCA1):c.468C>G (p.Leu156=) rs748923729
NM_007294.3(BRCA1):c.4691T>C (p.Leu1564Pro) rs56119278
NM_007294.3(BRCA1):c.4693G>A (p.Glu1565Lys) rs863224762
NM_007294.3(BRCA1):c.4695dup (p.Ser1566fs) rs397509189
NM_007294.3(BRCA1):c.4697C>A (p.Ser1566Tyr) rs1060502325
NM_007294.3(BRCA1):c.4697C>G (p.Ser1566Cys)
NM_007294.3(BRCA1):c.4699_4700dup (p.Ile1568fs)
NM_007294.3(BRCA1):c.469_470insAT (p.Ser157fs) rs1555594935
NM_007294.3(BRCA1):c.4709dup (p.Phe1571fs) rs864622132
NM_007294.3(BRCA1):c.4712_4716del (p.Leu1570_Phe1571insTer) rs80357718
NM_007294.3(BRCA1):c.4717G>C (p.Asp1573His) rs1188628175
NM_007294.3(BRCA1):c.4725T>G (p.Pro1575=) rs878854953
NM_007294.3(BRCA1):c.4726G>A (p.Glu1576Lys) rs1060502355
NM_007294.3(BRCA1):c.4729T>C (p.Ser1577Pro) rs80356909
NM_007294.3(BRCA1):c.4730C>A (p.Ser1577Tyr) rs273901741
NM_007294.3(BRCA1):c.4733A>G (p.Asp1578Gly) rs80356930
NM_007294.3(BRCA1):c.4735C>G (p.Pro1579Ala) rs145466894
NM_007294.3(BRCA1):c.4737T>C (p.Pro1579=) rs878854954
NM_007294.3(BRCA1):c.4741G>T (p.Glu1581Ter) rs397509193
NM_007294.3(BRCA1):c.4745del (p.Asp1582fs) rs80357907
NM_007294.3(BRCA1):c.4748G>A (p.Arg1583Lys) rs752624544
NM_007294.3(BRCA1):c.4750G>T (p.Ala1584Ser) rs80357070
NM_007294.3(BRCA1):c.4751C>T (p.Ala1584Val) rs1060502323
NM_007294.3(BRCA1):c.4754_4755del (p.Pro1585fs) rs80357837
NM_007294.3(BRCA1):c.4754dup (p.Glu1586fs)
NM_007294.3(BRCA1):c.4764T>C (p.Ala1588=) rs753651115
NM_007294.3(BRCA1):c.4765C>T (p.Arg1589Cys) rs80357002
NM_007294.3(BRCA1):c.4766G>A (p.Arg1589His) rs80357341
NM_007294.3(BRCA1):c.4771G>A (p.Gly1591Ser) rs587782825
NM_007294.3(BRCA1):c.4772G>A (p.Gly1591Asp) rs1555580956
NM_007294.3(BRCA1):c.4775A>G (p.Asn1592Ser) rs786203699
NM_007294.3(BRCA1):c.4776C>G (p.Asn1592Lys) rs761925468
NM_007294.3(BRCA1):c.4782del (p.Ser1595fs)
NM_007294.3(BRCA1):c.4783T>C (p.Ser1595Pro) rs1325644035
NM_007294.3(BRCA1):c.478G>A (p.Gly160Arg) rs62625285
NM_007294.3(BRCA1):c.4790C>A (p.Thr1597Asn) rs587781623
NM_007294.3(BRCA1):c.4795G>A (p.Ala1599Thr)
NM_007294.3(BRCA1):c.4799dup (p.Leu1600fs) rs587782392
NM_007294.3(BRCA1):c.4801A>C (p.Lys1601Gln) rs80357303
NM_007294.3(BRCA1):c.4801A>T (p.Lys1601Ter) rs80357303
NM_007294.3(BRCA1):c.4803A>G (p.Lys1601=) rs886037794
NM_007294.3(BRCA1):c.4806del (p.Gln1604fs) rs886038036
NM_007294.3(BRCA1):c.4807_4821del (p.Pro1603_Val1607del) rs397507238
NM_007294.3(BRCA1):c.4808C>T (p.Pro1603Leu) rs1064794054
NM_007294.3(BRCA1):c.4810C>G (p.Gln1604Glu)
NM_007294.3(BRCA1):c.4810del (p.Gln1604fs) rs1555580900
NM_007294.3(BRCA1):c.4812A>G (p.Gln1604=) rs28897693
NM_007294.3(BRCA1):c.4813T>C (p.Leu1605=) rs80356833
NM_007294.3(BRCA1):c.4815G>A (p.Leu1605=) rs1060504589
NM_007294.3(BRCA1):c.4816A>G (p.Lys1606Glu) rs80356943
NM_007294.3(BRCA1):c.4822G>A (p.Ala1608Thr) rs1567775064
NM_007294.3(BRCA1):c.4822dup (p.Ala1608fs) rs1135401933
NM_007294.3(BRCA1):c.4828dup (p.Ser1610fs) rs1555580854
NM_007294.3(BRCA1):c.482C>T (p.Thr161Ile) rs876660138
NM_007294.3(BRCA1):c.4834C>T (p.Gln1612Ter) rs786202064
NM_007294.3(BRCA1):c.4834_4835del (p.Gln1612fs) rs1555580840
NM_007294.3(BRCA1):c.4837A>G (p.Ser1613Gly) rs1799966
NM_007294.3(BRCA1):c.4837A>T (p.Ser1613Cys) rs1799966
NM_007294.3(BRCA1):c.483T>C (p.Thr161=) rs1060504575
NM_007294.3(BRCA1):c.483_484TG[1] (p.Val162fs) rs80357708
NM_007294.3(BRCA1):c.4840C>T (p.Pro1614Ser) rs70953660
NM_007294.3(BRCA1):c.4841C>T (p.Pro1614Leu) rs766305255
NM_007294.3(BRCA1):c.4843G>A (p.Ala1615Thr) rs80356987
NM_007294.3(BRCA1):c.4845T>C (p.Ala1615=) rs144588397
NM_007294.3(BRCA1):c.4851T>C (p.Ala1617=) rs786202627
NM_007294.3(BRCA1):c.4858A>G (p.Thr1620Ala) rs8176219
NM_007294.3(BRCA1):c.485T>G (p.Val162Gly)
NM_007294.3(BRCA1):c.4860T>C (p.Thr1620=) rs750938749
NM_007294.3(BRCA1):c.4862A>C (p.Asp1621Ala) rs1555580777
NM_007294.3(BRCA1):c.4868C>G (p.Ala1623Gly) rs80356862
NM_007294.3(BRCA1):c.4871G>A (p.Gly1624Glu) rs1555580767
NM_007294.3(BRCA1):c.4873_4885del (p.Tyr1625fs) rs397509201
NM_007294.3(BRCA1):c.4881A>G (p.Ala1627=) rs1425743425
NM_007294.3(BRCA1):c.4883T>C (p.Met1628Thr) rs4986854
NM_007294.3(BRCA1):c.488G>C (p.Arg163Thr) rs1369043501
NM_007294.3(BRCA1):c.4891dup (p.Ser1631fs) rs80357656
NM_007294.3(BRCA1):c.4894G>A (p.Val1632Met) rs770193975
NM_007294.3(BRCA1):c.4897A>C (p.Ser1633Arg) rs1555580711
NM_007294.3(BRCA1):c.4900A>G (p.Arg1634Gly)
NM_007294.3(BRCA1):c.4901_4919del (p.Arg1634fs) rs1555580678
NM_007294.3(BRCA1):c.4902G>A (p.Arg1634=) rs746199881
NM_007294.3(BRCA1):c.4903G>C (p.Glu1635Gln)
NM_007294.3(BRCA1):c.4903G>T (p.Glu1635Ter) rs200432771
NM_007294.3(BRCA1):c.4903del (p.Glu1635fs) rs1555580697
NM_007294.3(BRCA1):c.490del (p.Thr164fs) rs863224512
NM_007294.3(BRCA1):c.4910C>T (p.Pro1637Leu) rs80357048
NM_007294.3(BRCA1):c.4914A>G (p.Glu1638=) rs786201216
NM_007294.3(BRCA1):c.4917G>A (p.Leu1639=) rs1060504558
NM_007294.3(BRCA1):c.4934G>C (p.Arg1645Thr) rs70953661
NM_007294.3(BRCA1):c.4934_4935insAA (p.Val1646fs) rs1135401879
NM_007294.3(BRCA1):c.4935G>C (p.Arg1645Ser) rs80357373
NM_007294.3(BRCA1):c.4936del (p.Val1646fs) rs80357653
NM_007294.3(BRCA1):c.4941del (p.Asn1647fs) rs80357905
NM_007294.3(BRCA1):c.4942A>G (p.Lys1648Glu)
NM_007294.3(BRCA1):c.4942A>T (p.Lys1648Ter)
NM_007294.3(BRCA1):c.4945_4947delinsTTTT (p.Arg1649fs) rs397509207
NM_007294.3(BRCA1):c.4945del (p.Arg1649fs) rs80357655
NM_007294.3(BRCA1):c.4954A>T (p.Met1652Leu) rs1348949389
NM_007294.3(BRCA1):c.4955T>C (p.Met1652Thr) rs80356968
NM_007294.3(BRCA1):c.4955_4956delinsAA (p.Met1652Lys)
NM_007294.3(BRCA1):c.4956G>A (p.Met1652Ile) rs1799967
NM_007294.3(BRCA1):c.4959G>A (p.Val1653=) rs878854955
NM_007294.3(BRCA1):c.495G>A (p.Leu165=) rs745321499
NM_007294.3(BRCA1):c.4963T>C (p.Ser1655Pro) rs1057518639
NM_007294.3(BRCA1):c.4964C>T (p.Ser1655Phe) rs80357390
NM_007294.3(BRCA1):c.4964_4982del (p.Ser1655fs) rs80359876
NM_007294.3(BRCA1):c.4970T>C (p.Leu1657Pro)
NM_007294.3(BRCA1):c.4971G>C (p.Leu1657=) rs786202058
NM_007294.3(BRCA1):c.4976del (p.Pro1659fs) rs879255295
NM_007294.3(BRCA1):c.4981G>A (p.Glu1661Lys) rs80357401
NM_007294.3(BRCA1):c.4986+13A>C rs5031012
NM_007294.3(BRCA1):c.4986+13A>G
NM_007294.3(BRCA1):c.4986+17G>A rs1555580584
NM_007294.3(BRCA1):c.4986+1G>A rs80358162
NM_007294.3(BRCA1):c.4986+2_4986+3delTG rs1135401880
NM_007294.3(BRCA1):c.4986+3G>C rs80358023
NM_007294.3(BRCA1):c.4986+4A>C rs80358087
NM_007294.3(BRCA1):c.4986+4A>T rs80358087
NM_007294.3(BRCA1):c.4986+5G>A rs397509211
NM_007294.3(BRCA1):c.4986+6T>C rs80358086
NM_007294.3(BRCA1):c.4986+6T>G rs80358086
NM_007294.3(BRCA1):c.4987-11T>C rs80358170
NM_007294.3(BRCA1):c.4987-14T>A rs1555579832
NM_007294.3(BRCA1):c.4987-1G>A rs730881495
NM_007294.3(BRCA1):c.4987-20A>G rs80358035
NM_007294.3(BRCA1):c.4987-2A>C rs397509212
NM_007294.3(BRCA1):c.4987-2A>G rs397509212
NM_007294.3(BRCA1):c.4987-3C>G rs397509213
NM_007294.3(BRCA1):c.4987-4delT rs1567772535
NM_007294.3(BRCA1):c.4987-5T>C rs397509214
NM_007294.3(BRCA1):c.4987-?_5074+?del
NM_007294.3(BRCA1):c.4987-?_5193+?del
NM_007294.3(BRCA1):c.4988T>A (p.Met1663Lys) rs80357205
NM_007294.3(BRCA1):c.4991T>C (p.Leu1664Pro) rs80357314
NM_007294.3(BRCA1):c.4992C>T (p.Leu1664=) rs142459158
NM_007294.3(BRCA1):c.4993G>A (p.Val1665Met) rs80357169
NM_007294.3(BRCA1):c.4996_4997dup (p.Lys1667fs) rs1555579782
NM_007294.3(BRCA1):c.4997dup (p.Tyr1666Ter) rs876658947
NM_007294.3(BRCA1):c.5000A>G (p.Lys1667Arg) rs1057519495
NM_007294.3(BRCA1):c.5005G>T (p.Ala1669Ser) rs80357087
NM_007294.3(BRCA1):c.5006C>T (p.Ala1669Val) rs1057518640
NM_007294.3(BRCA1):c.5007dup (p.Arg1670fs) rs1555579748
NM_007294.3(BRCA1):c.500_503del (p.Thr167fs)
NM_007294.3(BRCA1):c.5014C>T (p.His1672Tyr) rs587781477
NM_007294.3(BRCA1):c.5014_5016CAC[1] (p.His1673del) rs80358343
NM_007294.3(BRCA1):c.5022C>T (p.Ile1674=) rs786203868
NM_007294.3(BRCA1):c.5024C>T (p.Thr1675Ile) rs150729791
NM_007294.3(BRCA1):c.5030_5033del (p.Thr1677fs) rs80357580
NM_007294.3(BRCA1):c.5030_5033dup (p.Leu1679_Ile1680insTer) rs80357580
NM_007294.3(BRCA1):c.5030_5034CTAAT[1] (p.Leu1679fs) rs80357623
NM_007294.3(BRCA1):c.5035C>G (p.Leu1679Val)
NM_007294.3(BRCA1):c.5035del (p.Asn1678_Leu1679insTer) rs80357896
NM_007294.3(BRCA1):c.5036T>C (p.Leu1679Pro) rs760038328
NM_007294.3(BRCA1):c.5039_5040del (p.Ile1680fs) rs1135401935
NM_007294.3(BRCA1):c.5041A>C (p.Thr1681Pro) rs876659314
NM_007294.3(BRCA1):c.5042del (p.Thr1681fs) rs886040265
NM_007294.3(BRCA1):c.5047G>T (p.Glu1683Ter) rs80356879
NM_007294.3(BRCA1):c.5050A>T (p.Thr1684Ser)
NM_007294.3(BRCA1):c.5050_5051del (p.Thr1684fs) rs879255283
NM_007294.3(BRCA1):c.5051del (p.Thr1684fs) rs1135401881
NM_007294.3(BRCA1):c.5052T>C (p.Thr1684=) rs760922019
NM_007294.3(BRCA1):c.5053A>G (p.Thr1685Ala) rs80356890
NM_007294.3(BRCA1):c.5055T>G (p.Thr1685=) rs1060504555
NM_007294.3(BRCA1):c.5056C>T (p.His1686Tyr) rs1555579648
NM_007294.3(BRCA1):c.5057A>G (p.His1686Arg) rs730882166
NM_007294.3(BRCA1):c.5058T>C (p.His1686=) rs397509218
NM_007294.3(BRCA1):c.5059_5061GTT[1] (p.Val1688del) rs80358344
NM_007294.3(BRCA1):c.5059del (p.Val1687fs) rs1555579633
NM_007294.3(BRCA1):c.505C>T (p.Gln169Ter) rs80357133
NM_007294.3(BRCA1):c.5063T>C (p.Val1688Ala)
NM_007294.3(BRCA1):c.5064T>C (p.Val1688=) rs1567771967
NM_007294.3(BRCA1):c.5065A>G (p.Met1689Val) rs1555579619
NM_007294.3(BRCA1):c.5066T>C (p.Met1689Thr) rs80357061
NM_007294.3(BRCA1):c.5066T>G (p.Met1689Arg) rs80357061
NM_007294.3(BRCA1):c.5067G>A (p.Met1689Ile)
NM_007294.3(BRCA1):c.5068A>C (p.Lys1690Gln) rs397507239
NM_007294.3(BRCA1):c.506A>C (p.Gln169Pro) rs587780803
NM_007294.3(BRCA1):c.5072C>A (p.Thr1691Lys) rs80357034
NM_007294.3(BRCA1):c.5072C>T (p.Thr1691Ile) rs80357034
NM_007294.3(BRCA1):c.5073A>C (p.Thr1691=) rs80356853
NM_007294.3(BRCA1):c.5073A>G (p.Thr1691=) rs80356853
NM_007294.3(BRCA1):c.5073A>T (p.Thr1691=) rs80356853
NM_007294.3(BRCA1):c.5074+12A>T rs1555579565
NM_007294.3(BRCA1):c.5074+14C>T rs370299792
NM_007294.3(BRCA1):c.5074+16T>C rs746775027
NM_007294.3(BRCA1):c.5074+1G>A rs80358053
NM_007294.3(BRCA1):c.5074+1G>T rs80358053
NM_007294.3(BRCA1):c.5074+2T>A
NM_007294.3(BRCA1):c.5074+2T>C rs80358089
NM_007294.3(BRCA1):c.5074+4T>C rs1567771887
NM_007294.3(BRCA1):c.5074+5A>T rs431825411
NM_007294.3(BRCA1):c.5074+6C>G rs80358032
NM_007294.3(BRCA1):c.5074G>A (p.Asp1692Asn) rs80187739
NM_007294.3(BRCA1):c.5074G>C (p.Asp1692His) rs80187739
NM_007294.3(BRCA1):c.5075-11T>C rs1060504582
NM_007294.3(BRCA1):c.5075-18G>A rs1060504564
NM_007294.3(BRCA1):c.5075-19A>G rs1555578694
NM_007294.3(BRCA1):c.5075-1G>A rs1800747
NM_007294.3(BRCA1):c.5075-2A>C rs80358066
NM_007294.3(BRCA1):c.5075-6C>A rs397507240
NM_007294.3(BRCA1):c.5075-9A>C rs80358059
NM_007294.3(BRCA1):c.5075-9A>G rs80358059
NM_007294.3(BRCA1):c.5075-9A>T rs80358059
NM_007294.3(BRCA1):c.5075-?_5193+?del
NM_007294.3(BRCA1):c.5075-?_5193+?dup119
NM_007294.3(BRCA1):c.5075-?_5277+?dup203
NM_007294.3(BRCA1):c.5075A>T (p.Asp1692Val) rs397509222
NM_007294.3(BRCA1):c.5075_5152del (p.Asp1692_Trp1718delinsGly) rs1555578539
NM_007294.3(BRCA1):c.5080G>A (p.Glu1694Lys)
NM_007294.3(BRCA1):c.5080G>T (p.Glu1694Ter) rs80356896
NM_007294.3(BRCA1):c.5081A>G (p.Glu1694Gly) rs1567769562
NM_007294.3(BRCA1):c.5086G>A (p.Val1696Met) rs80357125
NM_007294.3(BRCA1):c.5086G>T (p.Val1696Leu) rs80357125
NM_007294.3(BRCA1):c.5088G>A (p.Val1696=) rs878854956
NM_007294.3(BRCA1):c.508C>T (p.Arg170Trp) rs80357325
NM_007294.3(BRCA1):c.5090G>A (p.Cys1697Tyr) rs397507241
NM_007294.3(BRCA1):c.5091del (p.Cys1697fs) rs1135401882
NM_007294.3(BRCA1):c.5095C>A (p.Arg1699=) rs55770810
NM_007294.3(BRCA1):c.5095C>T (p.Arg1699Trp) rs55770810
NM_007294.3(BRCA1):c.5096G>A (p.Arg1699Gln) rs41293459
NM_007294.3(BRCA1):c.5098A>C (p.Thr1700Pro) rs397509227
NM_007294.3(BRCA1):c.509G>A (p.Arg170Gln) rs80357264
NM_007294.3(BRCA1):c.5100A>G (p.Thr1700=) rs45519437
NM_007294.3(BRCA1):c.5101C>A (p.Leu1701Met) rs910555398
NM_007294.3(BRCA1):c.5102T>C (p.Leu1701Pro)
NM_007294.3(BRCA1):c.5102_5103del (p.Leu1701fs) rs80357608
NM_007294.3(BRCA1):c.5103G>A (p.Leu1701=) rs1060504591
NM_007294.3(BRCA1):c.5106A>G (p.Lys1702=) rs1060504574
NM_007294.3(BRCA1):c.5106del (p.Lys1702fs) rs80357553
NM_007294.3(BRCA1):c.5107T>C (p.Tyr1703His) rs863224763
NM_007294.3(BRCA1):c.5108A>G (p.Tyr1703Cys) rs876660071
NM_007294.3(BRCA1):c.5109T>C (p.Tyr1703=) rs80356974
NM_007294.3(BRCA1):c.5109T>G (p.Tyr1703Ter) rs80356974
NM_007294.3(BRCA1):c.5110T>C (p.Phe1704Leu) rs1555578599
NM_007294.3(BRCA1):c.5113C>G (p.Leu1705Val) rs80356858
NM_007294.3(BRCA1):c.5114T>G (p.Leu1705Arg) rs397507242
NM_007294.3(BRCA1):c.5116G>A (p.Gly1706Arg) rs886040864
NM_007294.3(BRCA1):c.5117G>A (p.Gly1706Glu) rs80356860
NM_007294.3(BRCA1):c.5117G>C (p.Gly1706Ala) rs80356860
NM_007294.3(BRCA1):c.5120T>C (p.Ile1707Thr) rs1064796143
NM_007294.3(BRCA1):c.5122G>A (p.Ala1708Thr) rs397507243
NM_007294.3(BRCA1):c.5123C>A (p.Ala1708Glu) rs28897696
NM_007294.3(BRCA1):c.5123C>T (p.Ala1708Val) rs28897696
NM_007294.3(BRCA1):c.5124G>A (p.Ala1708=) rs1057520432
NM_007294.3(BRCA1):c.5125G>A (p.Gly1709Arg) rs886038197
NM_007294.3(BRCA1):c.5129G>A (p.Gly1710Glu) rs398122691
NM_007294.3(BRCA1):c.5129del (p.Gly1710fs) rs1135401829
NM_007294.3(BRCA1):c.512dup (p.Gln172fs) rs587781487
NM_007294.3(BRCA1):c.5131A>C (p.Lys1711Gln) rs886040272
NM_007294.3(BRCA1):c.5136G>A (p.Trp1712Ter) rs80357418
NM_007294.3(BRCA1):c.5137del (p.Trp1712_Val1713insTer) rs80357997
NM_007294.3(BRCA1):c.5137dup (p.Val1713fs) rs80357997
NM_007294.3(BRCA1):c.5138T>C (p.Val1713Ala) rs80357132
NM_007294.3(BRCA1):c.513dup (p.Gln172fs)
NM_007294.3(BRCA1):c.5142T>G (p.Val1714=) rs749319480
NM_007294.3(BRCA1):c.5147A>G (p.Tyr1716Cys) rs587782456
NM_007294.3(BRCA1):c.5147_5148insC (p.Trp1718fs) rs1135401883
NM_007294.3(BRCA1):c.514C>T (p.Gln172Ter) rs80356947
NM_007294.3(BRCA1):c.514del (p.Gln172fs) rs80357872
NM_007294.3(BRCA1):c.5152+10A>G rs80358114
NM_007294.3(BRCA1):c.5152+11T>C rs1060504584
NM_007294.3(BRCA1):c.5152+15A>G rs750905289
NM_007294.3(BRCA1):c.5152+1G>A rs80358094
NM_007294.3(BRCA1):c.5152+1G>C rs80358094
NM_007294.3(BRCA1):c.5152+1G>T rs80358094
NM_007294.3(BRCA1):c.5152+20T>A rs376836050
NM_007294.3(BRCA1):c.5152+2dupT rs397509231
NM_007294.3(BRCA1):c.5152+5G>A rs80358165
NM_007294.3(BRCA1):c.5152+5G>C rs80358165
NM_007294.3(BRCA1):c.5152+6T>C rs80358074
NM_007294.3(BRCA1):c.5152+7A>G rs80358046
NM_007294.3(BRCA1):c.5152+9A>T rs1060504576
NM_007294.3(BRCA1):c.5153-13A>G rs45471406
NM_007294.3(BRCA1):c.5153-1G>A rs80358137
NM_007294.3(BRCA1):c.5153-1G>C rs80358137
NM_007294.3(BRCA1):c.5153-2A>G rs786202545
NM_007294.3(BRCA1):c.5153-2delA rs273901746
NM_007294.3(BRCA1):c.5153-3T>C rs375639469
NM_007294.3(BRCA1):c.5153-6C>A rs80358129
NM_007294.3(BRCA1):c.5153-8C>A rs1060504570
NM_007294.3(BRCA1):c.5153G>T (p.Trp1718Leu)
NM_007294.3(BRCA1):c.5154G>A (p.Trp1718Ter) rs80357239
NM_007294.3(BRCA1):c.5155_5158dup (p.Thr1720fs) rs1555578402
NM_007294.3(BRCA1):c.5155_5159delinsAAA (p.Val1719fs) rs1555578398
NM_007294.3(BRCA1):c.5156T>C (p.Val1719Ala)
NM_007294.3(BRCA1):c.5157G>A (p.Val1719=) rs28897697
NM_007294.3(BRCA1):c.5157G>T (p.Val1719=) rs28897697
NM_007294.3(BRCA1):c.5158A>G (p.Thr1720Ala) rs56195342
NM_007294.3(BRCA1):c.515A>G (p.Gln172Arg) rs1555594863
NM_007294.3(BRCA1):c.5161C>G (p.Gln1721Glu) rs878854957
NM_007294.3(BRCA1):c.5161C>T (p.Gln1721Ter) rs878854957
NM_007294.3(BRCA1):c.5165C>A (p.Ser1722Tyr) rs80357104
NM_007294.3(BRCA1):c.5165C>T (p.Ser1722Phe) rs80357104
NM_007294.3(BRCA1):c.5167A>G (p.Ile1723Val) rs1426821558
NM_007294.3(BRCA1):c.5168T>C (p.Ile1723Thr) rs1064793533
NM_007294.3(BRCA1):c.516del (p.Gln172fs) rs879254223
NM_007294.3(BRCA1):c.5173_5176GAAA[1] (p.Arg1726fs) rs80357867
NM_007294.3(BRCA1):c.5175A>C (p.Glu1725Asp) rs191373374
NM_007294.3(BRCA1):c.5175A>G (p.Glu1725=) rs191373374
NM_007294.3(BRCA1):c.5176A>T (p.Arg1726Ter)
NM_007294.3(BRCA1):c.5176del (p.Arg1726fs) rs876658478
NM_007294.3(BRCA1):c.5177G>C (p.Arg1726Thr) rs786203547
NM_007294.3(BRCA1):c.5177G>T (p.Arg1726Ile) rs786203547
NM_007294.3(BRCA1):c.5179A>T (p.Lys1727Ter) rs80357347
NM_007294.3(BRCA1):c.5182del (p.Met1728fs) rs34570933
NM_007294.3(BRCA1):c.5182dup (p.Met1728fs) rs34570933
NM_007294.3(BRCA1):c.5185C>T (p.Leu1729=) rs1207677103
NM_007294.3(BRCA1):c.5186del (p.Leu1729fs) rs398122692
NM_007294.3(BRCA1):c.5191G>A (p.Glu1731Lys) rs397507244
NM_007294.3(BRCA1):c.5191G>T (p.Glu1731Ter) rs397507244
NM_007294.3(BRCA1):c.5193+1G>T rs80358004
NM_007294.3(BRCA1):c.5193+20A>G rs1567768516
NM_007294.3(BRCA1):c.5193+2delT rs273901751
NM_007294.3(BRCA1):c.5193+3A>G rs1060502326
NM_007294.3(BRCA1):c.5193+3_5193+15del rs273901752
NM_007294.3(BRCA1):c.5193+6T>C rs1555578283
NM_007294.3(BRCA1):c.5193G>A (p.Glu1731=) rs876660702
NM_007294.3(BRCA1):c.5194-12G>A rs80358079
NM_007294.3(BRCA1):c.5194-14T>A rs1567764689
NM_007294.3(BRCA1):c.5194-17T>C rs768462633
NM_007294.3(BRCA1):c.5194-18G>T rs80358090
NM_007294.3(BRCA1):c.5194-1G>A rs80358173
NM_007294.3(BRCA1):c.5194-1_5197delinsTATT rs1555576990
NM_007294.3(BRCA1):c.5194-2A>G rs80358069
NM_007294.3(BRCA1):c.5195A>G (p.His1732Arg)
NM_007294.3(BRCA1):c.5198A>G (p.Asp1733Gly) rs80357270
NM_007294.3(BRCA1):c.5200T>A (p.Phe1734Ile) rs80356957
NM_007294.3(BRCA1):c.5200_5201insC (p.Phe1734fs) rs1135401936
NM_007294.3(BRCA1):c.5201T>G (p.Phe1734Cys)
NM_007294.3(BRCA1):c.5202del (p.Phe1734fs) rs876659867
NM_007294.3(BRCA1):c.5205A>T (p.Glu1735Asp) rs431825412
NM_007294.3(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.3(BRCA1):c.5209A>T (p.Arg1737Ter) rs80357496
NM_007294.3(BRCA1):c.5209_5210AG[1] (p.Gly1738fs) rs1555576959
NM_007294.3(BRCA1):c.5209_5210insC (p.Arg1737fs) rs1555576968
NM_007294.3(BRCA1):c.520C>T (p.Gln174Ter) rs1567806048
NM_007294.3(BRCA1):c.520del (p.Gln174fs) rs80357639
NM_007294.3(BRCA1):c.5211A>G (p.Arg1737=) rs1555576963
NM_007294.3(BRCA1):c.5212G>A (p.Gly1738Arg) rs80356937
NM_007294.3(BRCA1):c.5213G>A (p.Gly1738Glu) rs80357450
NM_007294.3(BRCA1):c.5216A>G (p.Asp1739Gly) rs80357227
NM_007294.3(BRCA1):c.521A>C (p.Gln174Pro) rs1567806035
NM_007294.3(BRCA1):c.5225A>G (p.Asn1742Ser) rs864622104
NM_007294.3(BRCA1):c.5228G>C (p.Gly1743Ala) rs1346819781
NM_007294.3(BRCA1):c.522A>G (p.Gln174=) rs765432756
NM_007294.3(BRCA1):c.5231G>A (p.Arg1744Lys) rs1567764460
NM_007294.3(BRCA1):c.5232_5238delinsGTCCAAAGCGAG (p.Asn1745fs) rs483353071
NM_007294.3(BRCA1):c.5236C>G (p.His1746Asp) rs80357146
NM_007294.3(BRCA1):c.5239C>T (p.Gln1747Ter) rs80357367
NM_007294.3(BRCA1):c.523A>G (p.Lys175Glu) rs1567806027
NM_007294.3(BRCA1):c.5242G>C (p.Gly1748Arg) rs397507245
NM_007294.3(BRCA1):c.5242G>T (p.Gly1748Cys) rs397507245
NM_007294.3(BRCA1):c.5246C>T (p.Pro1749Leu) rs80357462
NM_007294.3(BRCA1):c.5249dup (p.Arg1751fs) rs879253993
NM_007294.3(BRCA1):c.5251C>G (p.Arg1751Gly) rs80357123
NM_007294.3(BRCA1):c.5251C>T (p.Arg1751Ter) rs80357123
NM_007294.3(BRCA1):c.5252G>A (p.Arg1751Gln) rs80357442
NM_007294.3(BRCA1):c.5252G>T (p.Arg1751Leu) rs80357442
NM_007294.3(BRCA1):c.5259A>T (p.Arg1753Ser) rs771577266
NM_007294.3(BRCA1):c.5259del (p.Glu1754fs) rs80357925
NM_007294.3(BRCA1):c.5260G>C (p.Glu1754Gln) rs80357432
NM_007294.3(BRCA1):c.5260G>T (p.Glu1754Ter) rs80357432
NM_007294.3(BRCA1):c.5264C>T (p.Ser1755Phe) rs1555576858
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs80357906
NM_007294.3(BRCA1):c.5267A>G (p.Gln1756Arg) rs1567764257
NM_007294.3(BRCA1):c.5269G>A (p.Asp1757Asn) rs863224764
NM_007294.3(BRCA1):c.5269G>C (p.Asp1757His) rs863224764
NM_007294.3(BRCA1):c.5272A>G (p.Arg1758Gly)
NM_007294.3(BRCA1):c.5274A>G (p.Arg1758=) rs758739620
NM_007294.3(BRCA1):c.5275_5276delinsTG (p.Lys1759Trp) rs786204116
NM_007294.3(BRCA1):c.5277+15C>A rs535279193
NM_007294.3(BRCA1):c.5277+15C>T rs535279193
NM_007294.3(BRCA1):c.5277+17C>G rs749918224
NM_007294.3(BRCA1):c.5277+17C>T rs749918224
NM_007294.3(BRCA1):c.5277+1G>A rs80358150
NM_007294.3(BRCA1):c.5277+1G>T rs80358150
NM_007294.3(BRCA1):c.5277+1_5277+6del rs1060502356
NM_007294.3(BRCA1):c.5277+1delG rs273901754
NM_007294.3(BRCA1):c.5277+20G>A rs766950602
NM_007294.3(BRCA1):c.5277+9C>G rs1356169081
NM_007294.3(BRCA1):c.5278-14C>G rs80358105
NM_007294.3(BRCA1):c.5278-16T>C rs1555575747
NM_007294.3(BRCA1):c.5278-1G>A rs80358099
NM_007294.3(BRCA1):c.5278-1G>C rs80358099
NM_007294.3(BRCA1):c.5278-20C>T rs193149108
NM_007294.3(BRCA1):c.5278-2A>G rs397509253
NM_007294.3(BRCA1):c.5278-?_5406+?del
NM_007294.3(BRCA1):c.5278-?_5406+?dup129
NM_007294.3(BRCA1):c.5278-?_5467+?del
NM_007294.3(BRCA1):c.5279_5332del (p.Ile1760_Asp1778delinsAsn) rs1555575677
NM_007294.3(BRCA1):c.527C>T (p.Thr176Met) rs587782747
NM_007294.3(BRCA1):c.5280C>A (p.Ile1760=) rs750040616
NM_007294.3(BRCA1):c.5285G>C (p.Arg1762Thr)
NM_007294.3(BRCA1):c.5288G>T (p.Gly1763Val) rs80357007
NM_007294.3(BRCA1):c.5289G>A (p.Gly1763=) rs1022076404
NM_007294.3(BRCA1):c.528G>A (p.Thr176=) rs34545365
NM_007294.3(BRCA1):c.5291T>C (p.Leu1764Pro) rs80357281
NM_007294.3(BRCA1):c.5296A>G (p.Ile1766Val) rs886039314
NM_007294.3(BRCA1):c.5297T>G (p.Ile1766Ser) rs80357463
NM_007294.3(BRCA1):c.5304C>T (p.Cys1768=) rs138493864
NM_007294.3(BRCA1):c.5306A>G (p.Tyr1769Cys) rs397509257
NM_007294.3(BRCA1):c.5309G>C (p.Gly1770Ala) rs863224765
NM_007294.3(BRCA1):c.5309G>T (p.Gly1770Val) rs863224765
NM_007294.3(BRCA1):c.5310G>A (p.Gly1770=) rs273901761
NM_007294.3(BRCA1):c.5310G>C (p.Gly1770=) rs273901761
NM_007294.3(BRCA1):c.5310dup (p.Pro1771fs) rs80357581
NM_007294.3(BRCA1):c.5315T>G (p.Phe1772Cys) rs1555575700
NM_007294.3(BRCA1):c.5318C>T (p.Thr1773Ile) rs80357428
NM_007294.3(BRCA1):c.5319dup (p.Asn1774fs) rs80357823
NM_007294.3(BRCA1):c.531dup (p.Val178fs) rs864622350
NM_007294.3(BRCA1):c.5320_5321del (p.Asn1774fs) rs80357818
NM_007294.3(BRCA1):c.5324T>A (p.Met1775Lys) rs41293463
NM_007294.3(BRCA1):c.5324T>G (p.Met1775Arg) rs41293463
NM_007294.3(BRCA1):c.5326C>T (p.Pro1776Ser) rs1800757
NM_007294.3(BRCA1):c.5327C>A (p.Pro1776His) rs398122695
NM_007294.3(BRCA1):c.5327C>T (p.Pro1776Leu) rs398122695
NM_007294.3(BRCA1):c.5328C>T (p.Pro1776=) rs759867616
NM_007294.3(BRCA1):c.5330C>T (p.Thr1777Ile) rs398122696
NM_007294.3(BRCA1):c.5332+13G>T rs372391060
NM_007294.3(BRCA1):c.5332+15G>C rs80358148
NM_007294.3(BRCA1):c.5332+19C>G rs774813458
NM_007294.3(BRCA1):c.5332+1G>A rs80358041
NM_007294.3(BRCA1):c.5332+20C>A rs1057521961
NM_007294.3(BRCA1):c.5332+20C>G rs1057521961
NM_007294.3(BRCA1):c.5332+2T>C rs80358182
NM_007294.3(BRCA1):c.5332+3A>G rs766614917
NM_007294.3(BRCA1):c.5332+4A>G rs80358166
NM_007294.3(BRCA1):c.5332G>A (p.Asp1778Asn) rs80357112
NM_007294.3(BRCA1):c.5333-1G>T rs80358126
NM_007294.3(BRCA1):c.5333-36_5333-22del rs1555575231
NM_007294.3(BRCA1):c.5333-3T>G rs397509265
NM_007294.3(BRCA1):c.5333-8C>T rs80358084
NM_007294.3(BRCA1):c.5333-?_5406+?del
NM_007294.3(BRCA1):c.5333A>G (p.Asp1778Gly) rs80357041
NM_007294.3(BRCA1):c.5334T>C (p.Asp1778=) rs754152768
NM_007294.3(BRCA1):c.5335del (p.Gln1779fs) rs80357590
NM_007294.3(BRCA1):c.5339T>A (p.Leu1780Gln) rs80357474
NM_007294.3(BRCA1):c.5339T>C (p.Leu1780Pro) rs80357474
NM_007294.3(BRCA1):c.5341del (p.Glu1781fs) rs80357694
NM_007294.3(BRCA1):c.5343A>C (p.Glu1781Asp) rs1555575182
NM_007294.3(BRCA1):c.5345G>A (p.Trp1782Ter) rs80357219
NM_007294.3(BRCA1):c.5346G>A (p.Trp1782Ter) rs80357284
NM_007294.3(BRCA1):c.5347A>C (p.Met1783Leu) rs80357012
NM_007294.3(BRCA1):c.5347A>G (p.Met1783Val) rs80357012
NM_007294.3(BRCA1):c.5348T>C (p.Met1783Thr) rs55808233
NM_007294.3(BRCA1):c.5350G>A (p.Val1784Ile) rs1060502328
NM_007294.3(BRCA1):c.5352dup (p.Gln1785fs) rs80357744
NM_007294.3(BRCA1):c.5353C>T (p.Gln1785Ter) rs80356969
NM_007294.3(BRCA1):c.5356C>T (p.Leu1786=) rs1555575167
NM_007294.3(BRCA1):c.5357T>C (p.Leu1786Pro) rs398122697
NM_007294.3(BRCA1):c.5359_5363delinsAGTGA (p.Cys1787_Gly1788delinsSerAsp) rs786203663
NM_007294.3(BRCA1):c.535T>C (p.Tyr179His) rs587781761
NM_007294.3(BRCA1):c.5360G>A (p.Cys1787Tyr)
NM_007294.3(BRCA1):c.5363G>C (p.Gly1788Ala) rs80357069
NM_007294.3(BRCA1):c.5363G>T (p.Gly1788Val) rs80357069
NM_007294.3(BRCA1):c.5365G>A (p.Ala1789Thr) rs80357078
NM_007294.3(BRCA1):c.5365_5366delinsA (p.Ala1789fs) rs1555575142
NM_007294.3(BRCA1):c.536A>G (p.Tyr179Cys) rs56187033
NM_007294.3(BRCA1):c.536_547+165del rs1555594718
NM_007294.3(BRCA1):c.5371G>T (p.Val1791Leu) rs145758886
NM_007294.3(BRCA1):c.5372T>C (p.Val1791Ala) rs864622244
NM_007294.3(BRCA1):c.5374G>A (p.Val1792Met) rs1555575131
NM_007294.3(BRCA1):c.5376G>A (p.Val1792=) rs1060504569
NM_007294.3(BRCA1):c.5380G>T (p.Glu1794Ter) rs776323117
NM_007294.3(BRCA1):c.5382G>C (p.Glu1794Asp) rs397509275
NM_007294.3(BRCA1):c.5383C>T (p.Leu1795Phe) rs878854958
NM_007294.3(BRCA1):c.5387C>A (p.Ser1796Ter) rs80357055
NM_007294.3(BRCA1):c.5388A>G (p.Ser1796=) rs373810778
NM_007294.3(BRCA1):c.539T>C (p.Ile180Thr) rs1567805965
NM_007294.3(BRCA1):c.53T>G (p.Met18Arg) rs80356929
NM_007294.3(BRCA1):c.5402G>A (p.Gly1801Asp) rs531210457
NM_007294.3(BRCA1):c.5406+17C>T rs1057522773
NM_007294.3(BRCA1):c.5406+33A>T rs80358092
NM_007294.3(BRCA1):c.5406+4_5406+7delAGTA rs1555575073
NM_007294.3(BRCA1):c.5406+5G>T rs80358073
NM_007294.3(BRCA1):c.5406+6T>A rs1555575074
NM_007294.3(BRCA1):c.5406+7A>G rs397509280
NM_007294.3(BRCA1):c.5406+8T>C rs55946644
NM_007294.3(BRCA1):c.5406+9T>C rs80358040
NM_007294.3(BRCA1):c.5406A>C (p.Thr1802=) rs879255493
NM_007294.3(BRCA1):c.5407-1G>A rs80358029
NM_007294.3(BRCA1):c.5407-25T>A rs758780152
NM_007294.3(BRCA1):c.5407-4C>G rs876660347
NM_007294.3(BRCA1):c.5407-7G>A
NM_007294.3(BRCA1):c.5407-8G>T
NM_007294.3(BRCA1):c.5407-9G>A rs551078372
NM_007294.3(BRCA1):c.5407-9G>C rs551078372
NM_007294.3(BRCA1):c.5407-?_*(1_?)del
NM_007294.3(BRCA1):c.5407G>A (p.Gly1803Ser) rs876659510
NM_007294.3(BRCA1):c.5407G>T (p.Gly1803Cys)
NM_007294.3(BRCA1):c.5411T>A (p.Val1804Asp) rs80356920
NM_007294.3(BRCA1):c.5412C>T (p.Val1804=) rs730881456
NM_007294.3(BRCA1):c.5415C>T (p.His1805=) rs1060504559
NM_007294.3(BRCA1):c.5419del (p.Ile1807fs) rs80357934
NM_007294.3(BRCA1):c.5422G>T (p.Val1808Leu) rs1555574756
NM_007294.3(BRCA1):c.5423T>A (p.Val1808Glu) rs80357358
NM_007294.3(BRCA1):c.5425G>A (p.Val1809Ile) rs28897698
NM_007294.3(BRCA1):c.5425_5430del (p.Val1809_Val1810del) rs80358348
NM_007294.3(BRCA1):c.5427dup (p.Val1810fs) rs1555574739
NM_007294.3(BRCA1):c.5429T>C (p.Val1810Ala) rs80357451
NM_007294.3(BRCA1):c.5430G>A (p.Val1810=) rs786201582
NM_007294.3(BRCA1):c.5430_5431insAG (p.Gln1811fs) rs1135401887
NM_007294.3(BRCA1):c.5431C>T (p.Gln1811Ter) rs397509283
NM_007294.3(BRCA1):c.5432A>G (p.Gln1811Arg) rs80357040
NM_007294.3(BRCA1):c.543A>G (p.Glu181=) rs397507250
NM_007294.3(BRCA1):c.5444G>A (p.Trp1815Ter) rs80356962
NM_007294.3(BRCA1):c.5444G>C (p.Trp1815Ser)
NM_007294.3(BRCA1):c.5445G>A (p.Trp1815Ter) rs397509284
NM_007294.3(BRCA1):c.5448_5449AG[1] (p.Glu1817fs) rs397509286
NM_007294.3(BRCA1):c.544T>A (p.Leu182Met) rs1060502339
NM_007294.3(BRCA1):c.5453A>G (p.Asp1818Gly) rs80357477
NM_007294.3(BRCA1):c.5456A>G (p.Asn1819Ser) rs80357286
NM_007294.3(BRCA1):c.5458G>A (p.Gly1820Ser) rs398122698
NM_007294.3(BRCA1):c.5466T>C (p.His1822=) rs886052975
NM_007294.3(BRCA1):c.5467+14A>G rs886052974
NM_007294.3(BRCA1):c.5467+1G>A rs80358145
NM_007294.3(BRCA1):c.5467+2T>C rs80358009
NM_007294.3(BRCA1):c.5467+5G>T
NM_007294.3(BRCA1):c.5467+8G>A rs80358062
NM_007294.3(BRCA1):c.5468-10C>A rs8176316
NM_007294.3(BRCA1):c.5468-10_5468-9delCT rs273902770
NM_007294.3(BRCA1):c.5468-18T>A rs80358157
NM_007294.3(BRCA1):c.5468-1G>A rs80358048
NM_007294.3(BRCA1):c.5468-1_5468delinsTT
NM_007294.3(BRCA1):c.5468-2A>G rs398122699
NM_007294.3(BRCA1):c.5468-5T>G
NM_007294.3(BRCA1):c.5468_*1383del
NM_007294.3(BRCA1):c.547+14G>A rs932782447
NM_007294.3(BRCA1):c.547+14delG rs273902771
NM_007294.3(BRCA1):c.547+1G>A rs80358030
NM_007294.3(BRCA1):c.547+1G>C rs80358030
NM_007294.3(BRCA1):c.547+1G>T rs80358030
NM_007294.3(BRCA1):c.547+2T>A rs80358047
NM_007294.3(BRCA1):c.547+7G>A rs772583635
NM_007294.3(BRCA1):c.547+7G>C rs772583635
NM_007294.3(BRCA1):c.5470A>G (p.Ile1824Val) rs587782026
NM_007294.3(BRCA1):c.5470_5477delATTGGGCA (p.Ile1824Aspfs) rs80357973
NM_007294.3(BRCA1):c.5473G>A (p.Gly1825Arg) rs398122700
NM_007294.3(BRCA1):c.5474_5481del (p.Gly1825fs) rs730881441
NM_007294.3(BRCA1):c.548-10A>T rs878854959
NM_007294.3(BRCA1):c.548-13G>T rs80358115
NM_007294.3(BRCA1):c.548-16G>A rs80358171
NM_007294.3(BRCA1):c.548-16G>T rs80358171
NM_007294.3(BRCA1):c.548-17G>T rs80358014
NM_007294.3(BRCA1):c.548-18T>G rs397507251
NM_007294.3(BRCA1):c.548-18delT rs398122701
NM_007294.3(BRCA1):c.548-18dup rs398122701
NM_007294.3(BRCA1):c.548-3T>C rs397507252
NM_007294.3(BRCA1):c.548-3delT rs398122353
NM_007294.3(BRCA1):c.548-9delA rs273902774
NM_007294.3(BRCA1):c.548-?_4185+?del
NM_007294.3(BRCA1):c.548-?_5074+?dup
NM_007294.3(BRCA1):c.548-?_593+?dup
NM_007294.3(BRCA1):c.5481G>A (p.Met1827Ile) rs587782432
NM_007294.3(BRCA1):c.5482T>G (p.Cys1828Gly) rs1060502342
NM_007294.3(BRCA1):c.5485G>A (p.Glu1829Lys) rs869320789
NM_007294.3(BRCA1):c.5485dup (p.Glu1829fs) rs768401297
NM_007294.3(BRCA1):c.5492C>G (p.Pro1831Arg) rs587782778
NM_007294.3(BRCA1):c.5492del (p.Pro1831fs) rs80357582
NM_007294.3(BRCA1):c.5493_5494insTT (p.Val1832fs) rs886040298
NM_007294.3(BRCA1):c.5497G>A (p.Val1833Met) rs80357268
NM_007294.3(BRCA1):c.549A>C (p.Gly183=) rs1555594077
NM_007294.3(BRCA1):c.5501C>T (p.Thr1834Ile) rs730881500
NM_007294.3(BRCA1):c.5503C>T (p.Arg1835Ter) rs41293465
NM_007294.3(BRCA1):c.5503dup (p.Arg1835fs) rs397509291
NM_007294.3(BRCA1):c.5504G>A (p.Arg1835Gln) rs273902776
NM_007294.3(BRCA1):c.5504G>C (p.Arg1835Pro) rs273902776
NM_007294.3(BRCA1):c.5506G>A (p.Glu1836Lys) rs80356942
NM_007294.3(BRCA1):c.5509T>C (p.Trp1837Arg) rs80356959
NM_007294.3(BRCA1):c.5509T>G (p.Trp1837Gly) rs80356959
NM_007294.3(BRCA1):c.5509_5510del (p.Trp1837fs) rs1135401888
NM_007294.3(BRCA1):c.5510G>A (p.Trp1837Ter) rs80357307
NM_007294.3(BRCA1):c.5511G>A (p.Trp1837Ter) rs80356914
NM_007294.3(BRCA1):c.5511G>T (p.Trp1837Cys) rs80356914
NM_007294.3(BRCA1):c.5512G>A (p.Val1838Met) rs730881501
NM_007294.3(BRCA1):c.5512G>T (p.Val1838Leu) rs730881501
NM_007294.3(BRCA1):c.5514G>T (p.Val1838=) rs786201248
NM_007294.3(BRCA1):c.5517_5518insC (p.Asp1840fs)
NM_007294.3(BRCA1):c.5518G>A (p.Asp1840Asn) rs1567756588
NM_007294.3(BRCA1):c.5518G>T (p.Asp1840Tyr)
NM_007294.3(BRCA1):c.551C>T (p.Ser184Phe) rs878854961
NM_007294.3(BRCA1):c.5521A>C (p.Ser1841Arg) rs80357299
NM_007294.3(BRCA1):c.5521del (p.Ser1841fs) rs80357721
NM_007294.3(BRCA1):c.5522G>C (p.Ser1841Thr) rs80357368
NM_007294.3(BRCA1):c.5523T>C (p.Ser1841=) rs878854960
NM_007294.3(BRCA1):c.5525del (p.Val1842fs) rs864622220
NM_007294.3(BRCA1):c.5527G>C (p.Ala1843Pro) rs80357019
NM_007294.3(BRCA1):c.5528C>A (p.Ala1843Glu) rs730881447
NM_007294.3(BRCA1):c.5528C>T (p.Ala1843Val) rs730881447
NM_007294.3(BRCA1):c.5531T>G (p.Leu1844Arg) rs80357323
NM_007294.3(BRCA1):c.5534del (p.Tyr1845fs) rs1060505048
NM_007294.3(BRCA1):c.5538G>A (p.Gln1846=) rs80356849
NM_007294.3(BRCA1):c.5540G>T (p.Cys1847Phe) rs1182000313
NM_007294.3(BRCA1):c.5541C>A (p.Cys1847Ter) rs397509295
NM_007294.3(BRCA1):c.5541C>T (p.Cys1847=) rs397509295
NM_007294.3(BRCA1):c.5550G>A (p.Leu1850=) rs786201502
NM_007294.3(BRCA1):c.5550G>C (p.Leu1850=) rs786201502
NM_007294.3(BRCA1):c.5558A>G (p.Tyr1853Cys) rs80357258
NM_007294.3(BRCA1):c.5558dup (p.Tyr1853Ter) rs80357629
NM_007294.3(BRCA1):c.5562G>A (p.Leu1854=) rs786201648
NM_007294.3(BRCA1):c.5565_5573del (p.Gln1857_Pro1859del) rs397507253
NM_007294.3(BRCA1):c.5566C>A (p.Pro1856Thr) rs80357274
NM_007294.3(BRCA1):c.5566C>T (p.Pro1856Ser) rs80357274
NM_007294.3(BRCA1):c.5568C>G (p.Pro1856=) rs876659994
NM_007294.3(BRCA1):c.5569del (p.Gln1857fs) rs886039675
NM_007294.3(BRCA1):c.556T>G (p.Ser186Ala) rs397509298
NM_007294.3(BRCA1):c.5571_5579del (p.Gln1857_Pro1859del) rs775417240
NM_007294.3(BRCA1):c.5572A>C (p.Ile1858Leu) rs765656957
NM_007294.3(BRCA1):c.5572A>T (p.Ile1858Phe) rs765656957
NM_007294.3(BRCA1):c.5573T>C (p.Ile1858Thr) rs755427809
NM_007294.3(BRCA1):c.5574C>G (p.Ile1858Met) rs876659941
NM_007294.3(BRCA1):c.5575C>A (p.Pro1859Thr) rs1555574342
NM_007294.3(BRCA1):c.5575C>T (p.Pro1859Ser) rs1555574342
NM_007294.3(BRCA1):c.5576C>G (p.Pro1859Arg) rs80357322
NM_007294.3(BRCA1):c.5578dup (p.His1860fs) rs397507254
NM_007294.3(BRCA1):c.557C>A (p.Ser186Tyr) rs55688530
NM_007294.3(BRCA1):c.5585A>G (p.His1862Arg) rs80357183
NM_007294.3(BRCA1):c.5585A>T (p.His1862Leu) rs80357183
NM_007294.3(BRCA1):c.5586C>T (p.His1862=) rs774127304
NM_007294.3(BRCA1):c.5587T>G (p.Tyr1863Asp) rs763740623
NM_007294.3(BRCA1):c.564A>G (p.Glu188=) rs768065826
NM_007294.3(BRCA1):c.566A>G (p.Asp189Gly) rs1555594067
NM_007294.3(BRCA1):c.570C>T (p.Thr190=) rs201536070
NM_007294.3(BRCA1):c.571G>A (p.Val191Ile) rs80357090
NM_007294.3(BRCA1):c.576T>C (p.Asn192=) rs1555594046
NM_007294.3(BRCA1):c.577A>G (p.Lys193Glu) rs878854962
NM_007294.3(BRCA1):c.586T>C (p.Tyr196His)
NM_007294.3(BRCA1):c.587A>T (p.Tyr196Phe) rs1555594039
NM_007294.3(BRCA1):c.591C>T (p.Cys197=) rs1799965
NM_007294.3(BRCA1):c.593+15A>G rs587780804
NM_007294.3(BRCA1):c.593+16C>A rs773139281
NM_007294.3(BRCA1):c.593+16C>G rs773139281
NM_007294.3(BRCA1):c.593+16C>T rs773139281
NM_007294.3(BRCA1):c.593+3G>A rs80358013
NM_007294.3(BRCA1):c.593+4delA rs1555594036
NM_007294.3(BRCA1):c.593+8A>G rs863224421
NM_007294.3(BRCA1):c.593+9A>G rs80358133
NM_007294.3(BRCA1):c.593+9_593+10delAA rs1555594025
NM_007294.3(BRCA1):c.593+9_593+12delAAGA rs753624573
NM_007294.3(BRCA1):c.594-12T>G rs1555593633
NM_007294.3(BRCA1):c.594-15G>C rs80358102
NM_007294.3(BRCA1):c.594-16dupT rs1555593635
NM_007294.3(BRCA1):c.594-18T>C rs864622306
NM_007294.3(BRCA1):c.594-20A>G rs80358017
NM_007294.3(BRCA1):c.594-2A>C rs80358033
NM_007294.3(BRCA1):c.594-4A>G rs80358081
NM_007294.3(BRCA1):c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC rs1555593640
NM_007294.3(BRCA1):c.605A>C (p.Gln202Pro) rs1060502366
NM_007294.3(BRCA1):c.607G>A (p.Glu203Lys) rs398122703
NM_007294.3(BRCA1):c.60A>C (p.Lys20Asn) rs202168814
NM_007294.3(BRCA1):c.611T>G (p.Leu204Trp)
NM_007294.3(BRCA1):c.612G>C (p.Leu204Phe) rs80357394
NM_007294.3(BRCA1):c.614T>G (p.Leu205Ter) rs1555593598
NM_007294.3(BRCA1):c.615dup (p.Gln206fs) rs1567803215
NM_007294.3(BRCA1):c.626C>T (p.Pro209Leu) rs201596327
NM_007294.3(BRCA1):c.628C>T (p.Gln210Ter) rs879255495
NM_007294.3(BRCA1):c.630A>G (p.Gln210=) rs1555593567
NM_007294.3(BRCA1):c.638G>A (p.Arg213Lys) rs1567803140
NM_007294.3(BRCA1):c.640G>A (p.Asp214Asn) rs786203797
NM_007294.3(BRCA1):c.640G>T (p.Asp214Tyr) rs786203797
NM_007294.3(BRCA1):c.641A>G (p.Asp214Gly) rs55680408
NM_007294.3(BRCA1):c.646A>G (p.Ile216Val) rs398122704
NM_007294.3(BRCA1):c.649del (p.Ser217fs) rs878854963
NM_007294.3(BRCA1):c.650G>C (p.Ser217Thr) rs774284145
NM_007294.3(BRCA1):c.652T>C (p.Leu218=) rs765950064
NM_007294.3(BRCA1):c.654G>A (p.Leu218=) rs1555593548
NM_007294.3(BRCA1):c.655G>C (p.Asp219His) rs273902779
NM_007294.3(BRCA1):c.659C>G (p.Ser220Cys) rs431825418
NM_007294.3(BRCA1):c.65T>C (p.Leu22Ser) rs80357438
NM_007294.3(BRCA1):c.65_66insTA (p.Leu22fs) rs1567823254
NM_007294.3(BRCA1):c.665A>C (p.Lys222Thr)
NM_007294.3(BRCA1):c.668del (p.Lys223fs) rs80357537
NM_007294.3(BRCA1):c.66_67AG[1] (p.Glu23fs) rs80357914
NM_007294.3(BRCA1):c.66_67AG[3] (p.Cys24fs) rs80357914
NM_007294.3(BRCA1):c.66dupA (p.Glu23Argfs) rs80357783
NM_007294.3(BRCA1):c.670+10A>G rs1060504562
NM_007294.3(BRCA1):c.670+12G>A rs560661816
NM_007294.3(BRCA1):c.670+16G>A rs199916228
NM_007294.3(BRCA1):c.670+16G>T rs199916228
NM_007294.3(BRCA1):c.670+1G>T rs398122706
NM_007294.3(BRCA1):c.670+1delG rs886040922
NM_007294.3(BRCA1):c.670+3A>G rs1555593531
NM_007294.3(BRCA1):c.670+5T>C rs1030987340
NM_007294.3(BRCA1):c.670+7G>A rs80358167
NM_007294.3(BRCA1):c.670+8C>T rs80358050
NM_007294.3(BRCA1):c.670G>A (p.Ala224Thr) rs431825419
NM_007294.3(BRCA1):c.671-10A>G rs398122707
NM_007294.3(BRCA1):c.671-12delG rs273902781
NM_007294.3(BRCA1):c.671-13delT rs8176152
NM_007294.3(BRCA1):c.671-15T>A rs80358058
NM_007294.3(BRCA1):c.671-18A>T rs746016001
NM_007294.3(BRCA1):c.671-18_671-16del rs398122354
NM_007294.3(BRCA1):c.671-1G>T rs80358020
NM_007294.3(BRCA1):c.671-2A>G rs80358108
NM_007294.3(BRCA1):c.671-2A>T rs80358108
NM_007294.3(BRCA1):c.671-6T>G rs878854964
NM_007294.3(BRCA1):c.671-8A>G rs80358144
NM_007294.3(BRCA1):c.671C>T (p.Ala224Val) rs1060502335
NM_007294.3(BRCA1):c.672T>G (p.Ala224=) rs1064794486
NM_007294.3(BRCA1):c.676del (p.Cys226fs) rs80357941
NM_007294.3(BRCA1):c.679G>T (p.Glu227Ter) rs879255319
NM_007294.3(BRCA1):c.685del (p.Ser229fs) rs80357824
NM_007294.3(BRCA1):c.689_692del (p.Glu230fs) rs886040308
NM_007294.3(BRCA1):c.692C>T (p.Thr231Met) rs80357001
NM_007294.3(BRCA1):c.693G>A (p.Thr231=) rs62625298
NM_007294.3(BRCA1):c.694G>A (p.Asp232Asn) rs55975699
NM_007294.3(BRCA1):c.695A>T (p.Asp232Val) rs398122708
NM_007294.3(BRCA1):c.695dup (p.Asp232fs) rs1555593302
NM_007294.3(BRCA1):c.697G>A (p.Val233Ile) rs959797914
NM_007294.3(BRCA1):c.697_698del (p.Val233fs) rs80357747
NM_007294.3(BRCA1):c.69G>A (p.Glu23=) rs766004110
NM_007294.3(BRCA1):c.69G>C (p.Glu23Asp) rs766004110
NM_007294.3(BRCA1):c.6T>C (p.Asp2=) rs754763517
NM_007294.3(BRCA1):c.700_704del (p.Thr234fs) rs1135401837
NM_007294.3(BRCA1):c.704A>G (p.Asn235Ser) rs1555593283
NM_007294.3(BRCA1):c.707C>T (p.Thr236Ile)
NM_007294.3(BRCA1):c.70T>A (p.Cys24Ser)
NM_007294.3(BRCA1):c.70T>C (p.Cys24Arg) rs80357410
NM_007294.3(BRCA1):c.70T>G (p.Cys24Gly)
NM_007294.3(BRCA1):c.70_80delTGTCCCATCTG (p.Cys24Serfs) rs80357696
NM_007294.3(BRCA1):c.714_716TCA[1] (p.His239del) rs786202378
NM_007294.3(BRCA1):c.716A>T (p.His239Leu) rs80357396
NM_007294.3(BRCA1):c.718C>T (p.Gln240Ter) rs886040313
NM_007294.3(BRCA1):c.72T>G (p.Cys24Trp)
NM_007294.3(BRCA1):c.733G>C (p.Asp245His)
NM_007294.3(BRCA1):c.733G>T (p.Asp245Tyr) rs147519994
NM_007294.3(BRCA1):c.734A>T (p.Asp245Val) rs80356865
NM_007294.3(BRCA1):c.736T>G (p.Leu246Val) rs28897675
NM_007294.3(BRCA1):c.737del (p.Asp245_Leu246insTer) rs397509312
NM_007294.3(BRCA1):c.738G>A (p.Leu246=) rs768416164
NM_007294.3(BRCA1):c.742A>C (p.Thr248Pro) rs879255288
NM_007294.3(BRCA1):c.742A>G (p.Thr248Ala) rs879255288
NM_007294.3(BRCA1):c.744del (p.Thr249fs) rs1060502360
NM_007294.3(BRCA1):c.74C>T (p.Pro25Leu) rs876660096
NM_007294.3(BRCA1):c.754del (p.Arg252fs) rs1555593195
NM_007294.3(BRCA1):c.755G>A (p.Arg252His) rs80357138
NM_007294.3(BRCA1):c.756T>C (p.Arg252=) rs786201338
NM_007294.3(BRCA1):c.75C>T (p.Pro25=) rs80356839
NM_007294.3(BRCA1):c.765G>A (p.Glu255=) rs62625299
NM_007294.3(BRCA1):c.765G>C (p.Glu255Asp)
NM_007294.3(BRCA1):c.766A>T (p.Arg256Trp) rs587781833
NM_007294.3(BRCA1):c.767G>A (p.Arg256Lys) rs11658785
NM_007294.3(BRCA1):c.768G>A (p.Arg256=) rs746067447
NM_007294.3(BRCA1):c.773C>G (p.Pro258Arg) rs80357225
NM_007294.3(BRCA1):c.779dup (p.Tyr261fs) rs886040317
NM_007294.3(BRCA1):c.783T>G (p.Tyr261Ter) rs80357321
NM_007294.3(BRCA1):c.788G>A (p.Gly263Asp) rs397509319
NM_007294.3(BRCA1):c.788dup (p.Gly263_Ser264insTer) rs886040319
NM_007294.3(BRCA1):c.794_795del (p.Ser265fs) rs80357955
NM_007294.3(BRCA1):c.795T>C (p.Ser265=) rs201441987
NM_007294.3(BRCA1):c.796_807delinsA (p.Val266fs) rs1064792958
NM_007294.3(BRCA1):c.798_799del (p.Ser267fs) rs80357724
NM_007294.3(BRCA1):c.799T>C (p.Ser267Pro) rs587781496
NM_007294.3(BRCA1):c.80+14A>G rs1555600851
NM_007294.3(BRCA1):c.80+15G>C rs771594437
NM_007294.3(BRCA1):c.80+17G>A rs540373654
NM_007294.3(BRCA1):c.80+1G>A rs80358010
NM_007294.3(BRCA1):c.80+1G>T rs80358010
NM_007294.3(BRCA1):c.80+4A>T rs80358003
NM_007294.3(BRCA1):c.80+5G>C rs80358045
NM_007294.3(BRCA1):c.800C>A (p.Ser267Ter) rs80357392
NM_007294.3(BRCA1):c.804C>T (p.Asn268=) rs771076131
NM_007294.3(BRCA1):c.807G>A (p.Leu269=) rs149867679
NM_007294.3(BRCA1):c.809A>G (p.His270Arg)
NM_007294.3(BRCA1):c.80G>T (p.Cys27Phe) rs1064793052
NM_007294.3(BRCA1):c.81-11T>C
NM_007294.3(BRCA1):c.81-11delT rs273902788
NM_007294.3(BRCA1):c.81-12C>G rs80358055
NM_007294.3(BRCA1):c.81-12delC rs273902789
NM_007294.3(BRCA1):c.81-12dupC rs273902789
NM_007294.3(BRCA1):c.81-13C>A rs56328013
NM_007294.3(BRCA1):c.81-13C>G rs56328013
NM_007294.3(BRCA1):c.81-13C>T rs56328013
NM_007294.3(BRCA1):c.81-14C>G rs80358006
NM_007294.3(BRCA1):c.81-14C>T rs80358006
NM_007294.3(BRCA1):c.81-16C>A rs1057520829
NM_007294.3(BRCA1):c.81-17C>A rs757442952
NM_007294.3(BRCA1):c.81-17C>G rs757442952
NM_007294.3(BRCA1):c.81-18C>A rs864622534
NM_007294.3(BRCA1):c.81-1G>A rs80358018
NM_007294.3(BRCA1):c.81-2A>C rs397509326
NM_007294.3(BRCA1):c.81-6T>C rs80358179
NM_007294.3(BRCA1):c.81-9C>A
NM_007294.3(BRCA1):c.81-9C>G rs80358127
NM_007294.3(BRCA1):c.81-?_134+?del
NM_007294.3(BRCA1):c.81-?_4986+?del
NM_007294.3(BRCA1):c.811G>A (p.Val271Met) rs80357244
NM_007294.3(BRCA1):c.811G>C (p.Val271Leu) rs80357244
NM_007294.3(BRCA1):c.811G>T (p.Val271Leu) rs80357244
NM_007294.3(BRCA1):c.812T>C (p.Val271Ala) rs753099787
NM_007294.3(BRCA1):c.815_824dup (p.Thr276fs) rs387906563
NM_007294.3(BRCA1):c.81T>C (p.Cys27=) rs587780805
NM_007294.3(BRCA1):c.821G>A (p.Cys274Tyr)
NM_007294.3(BRCA1):c.823G>A (p.Gly275Ser) rs8176153
NM_007294.3(BRCA1):c.824G>A (p.Gly275Asp) rs397509327
NM_007294.3(BRCA1):c.825C>T (p.Gly275=) rs397509328
NM_007294.3(BRCA1):c.827C>A (p.Thr276Lys) rs80357436
NM_007294.3(BRCA1):c.827C>G (p.Thr276Arg) rs80357436
NM_007294.3(BRCA1):c.828A>G (p.Thr276=) rs186274774
NM_007294.3(BRCA1):c.834T>G (p.Thr278=) rs762956862
NM_007294.3(BRCA1):c.835C>T (p.His279Tyr)
NM_007294.3(BRCA1):c.837T>C (p.His279=) rs775477245
NM_007294.3(BRCA1):c.843_846del (p.Ser282fs) rs80357919
NM_007294.3(BRCA1):c.844_850dup (p.Gln284fs) rs80357989
NM_007294.3(BRCA1):c.845C>T (p.Ser282Leu) rs786203027
NM_007294.3(BRCA1):c.84G>A (p.Leu28=) rs1555599278
NM_007294.3(BRCA1):c.862del (p.Ser288fs) rs886040327
NM_007294.3(BRCA1):c.869T>C (p.Leu290Ser)
NM_007294.3(BRCA1):c.86A>G (p.Glu29Gly) rs773841328
NM_007294.3(BRCA1):c.875del (p.Leu292fs) rs886037981
NM_007294.3(BRCA1):c.878C>G (p.Thr293Ser)
NM_007294.3(BRCA1):c.880_884del (p.Lys294fs) rs1135401838
NM_007294.3(BRCA1):c.881A>G (p.Lys294Arg) rs1555592934
NM_007294.3(BRCA1):c.884A>G (p.Asp295Gly) rs772684048
NM_007294.3(BRCA1):c.885C>T (p.Asp295=) rs1060504557
NM_007294.3(BRCA1):c.885_888del (p.Asp295fs) rs1060502359
NM_007294.3(BRCA1):c.886A>G (p.Arg296Gly) rs748675395
NM_007294.3(BRCA1):c.886A>T (p.Arg296Ter) rs748675395
NM_007294.3(BRCA1):c.886del (p.Arg296fs) rs869320786
NM_007294.3(BRCA1):c.889A>G (p.Met297Val) rs80357196
NM_007294.3(BRCA1):c.891G>A (p.Met297Ile) rs80357103
NM_007294.3(BRCA1):c.893_894del (p.Asn298fs) rs1555592891
NM_007294.3(BRCA1):c.895_896del (p.Val299fs) rs80357670
NM_007294.3(BRCA1):c.898G>A (p.Glu300Lys) rs886040330
NM_007294.3(BRCA1):c.89T>A (p.Leu30Ter) rs397509331
NM_007294.3(BRCA1):c.900A>C (p.Glu300Asp) rs80356861
NM_0072