ClinVar Miner

List of variants in gene BRCA1 studied for Hereditary cancer-predisposing syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 3137
Download table as spreadsheet
HGVS dbSNP
NM_007294.3(BRCA1):c.(441+1_442-1)_(547+1_548-1)del
NM_007294.3(BRCA1):c.(5074+1-5075-1)_(5193+1_5194-1)del
NM_007294.3(BRCA1):c.(5467+1_5468-1)_(*1_?)del
NM_007294.3(BRCA1):c.(80+1_81-1)_(134+1_135-1)del
NM_007294.3(BRCA1):c.(?_-1)_(80+1_81-1)del
NM_007294.3(BRCA1):c.*1271T>C rs1555574034
NM_007294.3(BRCA1):c.*13A>G rs762552027
NM_007294.3(BRCA1):c.*1C>T rs587782097
NM_007294.3(BRCA1):c.*20C>T rs375042815
NM_007294.3(BRCA1):c.*4C>T rs1057520246
NM_007294.3(BRCA1):c.-10A>C rs748057929
NM_007294.3(BRCA1):c.-16A>G rs777262055
NM_007294.3(BRCA1):c.-19-10T>C rs201866997
NM_007294.3(BRCA1):c.-1A>C rs587781565
NM_007294.3(BRCA1):c.-1A>G rs587781565
NM_007294.3(BRCA1):c.-3G>T rs273900720
NM_007294.3(BRCA1):c.1001C>T (p.Pro334Leu) rs41286290
NM_007294.3(BRCA1):c.1002C>T (p.Pro334=) rs1555592693
NM_007294.3(BRCA1):c.1002delC (p.Ser335Alafs) rs876658404
NM_007294.3(BRCA1):c.1005C>A (p.Ser335Arg) rs876660367
NM_007294.3(BRCA1):c.1008A>G (p.Thr336=) rs1060504568
NM_007294.3(BRCA1):c.100C>T (p.Pro34Ser) rs1064793357
NM_007294.3(BRCA1):c.1011dupA (p.Val340Glyfs) rs80357569
NM_007294.3(BRCA1):c.1012A>T (p.Lys338Ter) rs397508826
NM_007294.3(BRCA1):c.1014A>G (p.Lys338=) rs876660793
NM_007294.3(BRCA1):c.1015A>G (p.Lys339Glu) rs55842957
NM_007294.3(BRCA1):c.1016A>C (p.Lys339Thr) rs587781737
NM_007294.3(BRCA1):c.1016delA (p.Lys339Argfs) rs80357569
NM_007294.3(BRCA1):c.1017G>A (p.Lys339=) rs863224416
NM_007294.3(BRCA1):c.1017G>T (p.Lys339Asn) rs863224416
NM_007294.3(BRCA1):c.1018delG (p.Val340Terfs) rs80357774
NM_007294.3(BRCA1):c.101C>T (p.Pro34Leu) rs786203319
NM_007294.3(BRCA1):c.1021G>A (p.Asp341Asn) rs756987689
NM_007294.3(BRCA1):c.1021G>T (p.Asp341Tyr) rs756987689
NM_007294.3(BRCA1):c.1025T>C (p.Leu342Pro) rs1555592634
NM_007294.3(BRCA1):c.1026G>A (p.Leu342=) rs1171571879
NM_007294.3(BRCA1):c.102T>G (p.Pro34=) rs1555599260
NM_007294.3(BRCA1):c.1030G>A (p.Ala344Thr) rs79727659
NM_007294.3(BRCA1):c.1031C>T (p.Ala344Val) rs876658636
NM_007294.3(BRCA1):c.1033G>T (p.Asp345Tyr) rs80356961
NM_007294.3(BRCA1):c.1036C>T (p.Pro346Ser) rs80357015
NM_007294.3(BRCA1):c.1037C>A (p.Pro346His) rs1555592620
NM_007294.3(BRCA1):c.1040T>A (p.Leu347Gln) rs757987511
NM_007294.3(BRCA1):c.1042T>C (p.Cys348Arg) rs786201928
NM_007294.3(BRCA1):c.1054G>T (p.Glu352Ter) rs80357472
NM_007294.3(BRCA1):c.1059G>C (p.Trp353Cys) rs80356935
NM_007294.3(BRCA1):c.1065G>A (p.Lys355=) rs41286292
NM_007294.3(BRCA1):c.1066C>T (p.Gln356Ter) rs80357215
NM_007294.3(BRCA1):c.1067A>G (p.Gln356Arg) rs1799950
NM_007294.3(BRCA1):c.106T>A (p.Ser36Thr) rs905812561
NM_007294.3(BRCA1):c.1071A>G (p.Lys357=) rs786202159
NM_007294.3(BRCA1):c.1072C>T (p.Leu358=) rs377310179
NM_007294.3(BRCA1):c.1072delC (p.Leu358Cysfs) rs80357836
NM_007294.3(BRCA1):c.1075C>T (p.Pro359Ser) rs767666190
NM_007294.3(BRCA1):c.1078T>C (p.Cys360Arg) rs587782790
NM_007294.3(BRCA1):c.107C>A (p.Ser36Tyr) rs183557525
NM_007294.3(BRCA1):c.1081T>C (p.Ser361Pro) rs80356946
NM_007294.3(BRCA1):c.1082_1092delCAGAGAATCCT (p.Ser361Terfs) rs80359880
NM_007294.3(BRCA1):c.1086_1141del56 (p.Asn363Serfs) rs80359875
NM_007294.3(BRCA1):c.1090C>A (p.Pro364Thr) rs876660309
NM_007294.3(BRCA1):c.1096G>C (p.Asp366His) rs1289961661
NM_007294.3(BRCA1):c.1097A>T (p.Asp366Val) rs587781769
NM_007294.3(BRCA1):c.1098T>C (p.Asp366=) rs876658148
NM_007294.3(BRCA1):c.10T>C (p.Ser4Pro) rs876658707
NM_007294.3(BRCA1):c.1102G>T (p.Glu368Ter) rs80357139
NM_007294.3(BRCA1):c.1105G>A (p.Asp369Asn) rs56056711
NM_007294.3(BRCA1):c.1105_1106insTC (p.Asp369Valfs) rs876659396
NM_007294.3(BRCA1):c.1106A>T (p.Asp369Val)
NM_007294.3(BRCA1):c.1106_1108delATG (p.Asp369del) rs80358325
NM_007294.3(BRCA1):c.1108G>C (p.Val370Leu)
NM_007294.3(BRCA1):c.110C>G (p.Thr37Arg) rs80356880
NM_007294.3(BRCA1):c.1113T>C (p.Pro371=) rs876658619
NM_007294.3(BRCA1):c.1114T>C (p.Trp372Arg) rs1306111238
NM_007294.3(BRCA1):c.1115G>A (p.Trp372Ter) rs397508838
NM_007294.3(BRCA1):c.1116G>A (p.Trp372Ter) rs80357468
NM_007294.3(BRCA1):c.111A>G (p.Thr37=)
NM_007294.3(BRCA1):c.1121C>T (p.Thr374Ile) rs80357235
NM_007294.3(BRCA1):c.1121delC (p.Thr374Asnfs) rs80357612
NM_007294.3(BRCA1):c.1125A>G (p.Leu375=) rs1060504578
NM_007294.3(BRCA1):c.1127delA (p.Asn376Ilefs) rs80357821
NM_007294.3(BRCA1):c.1128T>C (p.Asn376=) rs1555592423
NM_007294.3(BRCA1):c.1129A>G (p.Ser377Gly) rs1555592415
NM_007294.3(BRCA1):c.112_113delAA (p.Lys38Valfs) rs80357949
NM_007294.3(BRCA1):c.1131C>A (p.Ser377Arg) rs786203434
NM_007294.3(BRCA1):c.1131C>G (p.Ser377Arg) rs786203434
NM_007294.3(BRCA1):c.1132A>G (p.Ser378Gly) rs1555592404
NM_007294.3(BRCA1):c.1134C>A (p.Ser378Arg) rs863224752
NM_007294.3(BRCA1):c.1135A>G (p.Ile379Val) rs864622723
NM_007294.3(BRCA1):c.1137T>G (p.Ile379Met) rs56128296
NM_007294.3(BRCA1):c.1139A>C (p.Gln380Pro) rs876659193
NM_007294.3(BRCA1):c.1139A>G (p.Gln380Arg) rs876659193
NM_007294.3(BRCA1):c.1140dupG (p.Lys381Glufs) rs876659327
NM_007294.3(BRCA1):c.1149T>C (p.Asn383=) rs979531844
NM_007294.3(BRCA1):c.114G>A (p.Lys38=) rs1800062
NM_007294.3(BRCA1):c.1154G>A (p.Trp385Ter) rs1555592354
NM_007294.3(BRCA1):c.1155G>A (p.Trp385Ter) rs876660558
NM_007294.3(BRCA1):c.1155G>T (p.Trp385Cys) rs876660558
NM_007294.3(BRCA1):c.1159T>A (p.Ser387Thr) rs876659403
NM_007294.3(BRCA1):c.115T>A (p.Cys39Ser) rs80357164
NM_007294.3(BRCA1):c.115T>C (p.Cys39Arg) rs80357164
NM_007294.3(BRCA1):c.1160C>G (p.Ser387Cys)
NM_007294.3(BRCA1):c.1162A>T (p.Arg388Ter) rs111312760
NM_007294.3(BRCA1):c.1163G>C (p.Arg388Thr) rs786203567
NM_007294.3(BRCA1):c.116G>A (p.Cys39Tyr) rs80357498
NM_007294.3(BRCA1):c.116G>T (p.Cys39Phe) rs80357498
NM_007294.3(BRCA1):c.1173A>G (p.Glu391=) rs1131692097
NM_007294.3(BRCA1):c.1175_1214del40 (p.Leu392Glnfs) rs80359874
NM_007294.3(BRCA1):c.117T>A (p.Cys39Ter) rs886040898
NM_007294.3(BRCA1):c.117_118delTG (p.Cys39Terfs) rs80357972
NM_007294.3(BRCA1):c.1181G>T (p.Gly394Val) rs1555592295
NM_007294.3(BRCA1):c.1186G>A (p.Asp396Asn) rs786203145
NM_007294.3(BRCA1):c.1187A>T (p.Asp396Val)
NM_007294.3(BRCA1):c.1193C>G (p.Ser398Ter) rs80357068
NM_007294.3(BRCA1):c.1196A>G (p.His399Arg) rs587780794
NM_007294.3(BRCA1):c.1199A>G (p.Asp400Gly) rs1555592245
NM_007294.3(BRCA1):c.11C>T (p.Ser4Phe) rs786203152
NM_007294.3(BRCA1):c.1200_1206delTGGGGAGinsCTCACATGAACTGTTAGGT (p.Gly401_Glu402delinsSerHisGluLeuLeuGly) rs1555592207
NM_007294.3(BRCA1):c.1202G>A (p.Gly401Glu) rs397507184
NM_007294.3(BRCA1):c.1202G>C (p.Gly401Ala) rs397507184
NM_007294.3(BRCA1):c.1203G>A (p.Gly401=)
NM_007294.3(BRCA1):c.1204delG (p.Glu402Serfs) rs80357859
NM_007294.3(BRCA1):c.1205dup (p.Ser403Valfs) rs1555592219
NM_007294.3(BRCA1):c.1207T>C (p.Ser403Pro) rs1555592200
NM_007294.3(BRCA1):c.1214C>G (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1215A>G (p.Ser405=) rs786201517
NM_007294.3(BRCA1):c.1222A>G (p.Lys408Glu) rs80357253
NM_007294.3(BRCA1):c.1226T>C (p.Val409Ala) rs786202539
NM_007294.3(BRCA1):c.1227A>G (p.Val409=) rs149349675
NM_007294.3(BRCA1):c.1228G>A (p.Ala410Thr) rs779974365
NM_007294.3(BRCA1):c.122A>G (p.His41Arg) rs80357276
NM_007294.3(BRCA1):c.122A>T (p.His41Leu) rs80357276
NM_007294.3(BRCA1):c.1231G>A (p.Asp411Asn) rs80357301
NM_007294.3(BRCA1):c.1232A>T (p.Asp411Val) rs730881469
NM_007294.3(BRCA1):c.1232_1235delATGTinsCA (p.Asp411Alafs) rs876659253
NM_007294.3(BRCA1):c.1233T>G (p.Asp411Glu) rs80357024
NM_007294.3(BRCA1):c.1234G>A (p.Val412Ile) rs587776478
NM_007294.3(BRCA1):c.1236A>G (p.Val412=) rs1555592094
NM_007294.3(BRCA1):c.1237T>C (p.Leu413=) rs574008372
NM_007294.3(BRCA1):c.1237T>G (p.Leu413Val) rs574008372
NM_007294.3(BRCA1):c.123C>T (p.His41=) rs786202211
NM_007294.3(BRCA1):c.1242C>T (p.Asp414=) rs372400428
NM_007294.3(BRCA1):c.1243G>A (p.Val415Ile) rs587782770
NM_007294.3(BRCA1):c.1248A>G (p.Leu416=) rs1057522369
NM_007294.3(BRCA1):c.124A>G (p.Ile42Val) rs80357163
NM_007294.3(BRCA1):c.1250A>G (p.Asn417Ser) rs80357113
NM_007294.3(BRCA1):c.1251T>C (p.Asn417=) rs80357197
NM_007294.3(BRCA1):c.1251T>G (p.Asn417Lys) rs80357197
NM_007294.3(BRCA1):c.1252G>T (p.Glu418Ter) rs80357083
NM_007294.3(BRCA1):c.1252delG (p.Glu418Argfs) rs876660623
NM_007294.3(BRCA1):c.1253A>C (p.Glu418Ala) rs1555592050
NM_007294.3(BRCA1):c.1254G>A (p.Glu418=) rs786201948
NM_007294.3(BRCA1):c.1255G>A (p.Val419Ile) rs876658873
NM_007294.3(BRCA1):c.1255G>C (p.Val419Leu) rs876658873
NM_007294.3(BRCA1):c.1256dupT (p.Asp420Argfs) rs786203103
NM_007294.3(BRCA1):c.1257A>G (p.Val419=) rs751690840
NM_007294.3(BRCA1):c.1258G>T (p.Asp420Tyr) rs80357488
NM_007294.3(BRCA1):c.1259A>G (p.Asp420Gly) rs730881442
NM_007294.3(BRCA1):c.1264T>C (p.Tyr422His) rs764186025
NM_007294.3(BRCA1):c.1265A>T (p.Tyr422Phe)
NM_007294.3(BRCA1):c.1266T>G (p.Tyr422Ter) rs80357417
NM_007294.3(BRCA1):c.1270G>A (p.Gly424Ser)
NM_007294.3(BRCA1):c.1270G>C (p.Gly424Arg) rs763051683
NM_007294.3(BRCA1):c.1275T>A (p.Ser425=) rs786201160
NM_007294.3(BRCA1):c.1276delT (p.Ser426Glnfs) rs80357766
NM_007294.3(BRCA1):c.1278A>C (p.Ser426=) rs1442003131
NM_007294.3(BRCA1):c.127T>C (p.Phe43Leu) rs1555599214
NM_007294.3(BRCA1):c.1286T>C (p.Ile429Thr) rs775869160
NM_007294.3(BRCA1):c.1286T>G (p.Ile429Arg) rs775869160
NM_007294.3(BRCA1):c.1287dupA (p.Asp430Argfs) rs80357576
NM_007294.3(BRCA1):c.128T>C (p.Phe43Ser) rs1298544053
NM_007294.3(BRCA1):c.1297delG (p.Ala433Profs) rs80357794
NM_007294.3(BRCA1):c.1300A>G (p.Ser434Gly) rs786203753
NM_007294.3(BRCA1):c.1308T>C (p.Pro436=) rs770279083
NM_007294.3(BRCA1):c.1309C>T (p.His437Tyr) rs759878392
NM_007294.3(BRCA1):c.130T>A (p.Cys44Ser) rs80357327
NM_007294.3(BRCA1):c.1310A>C (p.His437Pro) rs80357255
NM_007294.3(BRCA1):c.1315dup (p.Ala439Glyfs) rs1555591956
NM_007294.3(BRCA1):c.1319T>G (p.Leu440Ter) rs273897656
NM_007294.3(BRCA1):c.131G>A (p.Cys44Tyr) rs80357446
NM_007294.3(BRCA1):c.131G>T (p.Cys44Phe) rs80357446
NM_007294.3(BRCA1):c.1321A>G (p.Ile441Val)
NM_007294.3(BRCA1):c.1323A>G (p.Ile441Met) rs1555591935
NM_007294.3(BRCA1):c.1324T>C (p.Cys442Arg) rs876660734
NM_007294.3(BRCA1):c.1326T>A (p.Cys442Ter) rs397508854
NM_007294.3(BRCA1):c.132C>T (p.Cys44=) rs876658362
NM_007294.3(BRCA1):c.1332T>G (p.Ser444Arg) rs1555591925
NM_007294.3(BRCA1):c.1333G>C (p.Glu445Gln) rs80356915
NM_007294.3(BRCA1):c.1336A>G (p.Arg446Gly) rs587781715
NM_007294.3(BRCA1):c.1339G>A (p.Val447Ile) rs587782784
NM_007294.3(BRCA1):c.133A>C (p.Lys45Gln) rs769650474
NM_007294.3(BRCA1):c.134+15G>A rs863224417
NM_007294.3(BRCA1):c.134+18A>G
NM_007294.3(BRCA1):c.134+19dup
NM_007294.3(BRCA1):c.134+2T>C rs80358131
NM_007294.3(BRCA1):c.134+3A>G rs80358064
NM_007294.3(BRCA1):c.134+4A>C rs1555599189
NM_007294.3(BRCA1):c.134+4_134+7del
NM_007294.3(BRCA1):c.134+9G>C rs1555599187
NM_007294.3(BRCA1):c.1342C>T (p.His448Tyr) rs786203578
NM_007294.3(BRCA1):c.1344C>T (p.His448=) rs1395644015
NM_007294.3(BRCA1):c.134A>C (p.Lys45Thr) rs80356863
NM_007294.3(BRCA1):c.135-11A>G rs769549104
NM_007294.3(BRCA1):c.135-15_135-12delCTTT rs878854931
NM_007294.3(BRCA1):c.135-18T>G rs80358085
NM_007294.3(BRCA1):c.135-1G>A rs80358158
NM_007294.3(BRCA1):c.135-1G>C rs80358158
NM_007294.3(BRCA1):c.135-1G>T rs80358158
NM_007294.3(BRCA1):c.135-226T>A rs189133089
NM_007294.3(BRCA1):c.135-2A>G rs80358065
NM_007294.3(BRCA1):c.135-3743G>A rs869312517
NM_007294.3(BRCA1):c.135-3T>C rs759417413
NM_007294.3(BRCA1):c.135-5T>C rs587781916
NM_007294.3(BRCA1):c.1354delG (p.Val452Terfs) rs886039946
NM_007294.3(BRCA1):c.1357G>C (p.Glu453Gln) rs768054411
NM_007294.3(BRCA1):c.1360_1361delAG (p.Ser454Terfs) rs80357969
NM_007294.3(BRCA1):c.1361G>A (p.Ser454Asn) rs80357181
NM_007294.3(BRCA1):c.1362T>C (p.Ser454=) rs1555591854
NM_007294.3(BRCA1):c.1363_1364insT (p.Asn455Ilefs) rs1555591850
NM_007294.3(BRCA1):c.1367T>C (p.Ile456Thr) rs80357360
NM_007294.3(BRCA1):c.1374C>T (p.Asp458=) rs397508862
NM_007294.3(BRCA1):c.1380dupA (p.Phe461Ilefs) rs80357714
NM_007294.3(BRCA1):c.1381T>C (p.Phe461Leu) rs62625300
NM_007294.3(BRCA1):c.1383T>A (p.Phe461Leu) rs56046357
NM_007294.3(BRCA1):c.1384G>A (p.Gly462Arg) rs80357221
NM_007294.3(BRCA1):c.1386G>A (p.Gly462=) rs876659749
NM_007294.3(BRCA1):c.1386delG (p.Thr464Profs) rs80357722
NM_007294.3(BRCA1):c.1387A>G (p.Lys463Glu) rs1135401844
NM_007294.3(BRCA1):c.1387_1390delAAAAinsGAAAG (p.Lys463Glufs) rs80357770
NM_007294.3(BRCA1):c.1389_1390delAAinsG (p.Thr464Profs) rs273897659
NM_007294.3(BRCA1):c.1390_1391insG (p.Thr464Serfs) rs397508867
NM_007294.3(BRCA1):c.1391C>T (p.Thr464Ile) rs62625301
NM_007294.3(BRCA1):c.1392C>G (p.Thr464=) rs533802049
NM_007294.3(BRCA1):c.1392C>T (p.Thr464=) rs533802049
NM_007294.3(BRCA1):c.1394A>G (p.Tyr465Cys) rs876659885
NM_007294.3(BRCA1):c.1396C>G (p.Arg466Gly) rs80356964
NM_007294.3(BRCA1):c.1396C>T (p.Arg466Trp) rs80356964
NM_007294.3(BRCA1):c.1397G>A (p.Arg466Gln) rs199540030
NM_007294.3(BRCA1):c.1400A>G (p.Lys467Arg) rs876659316
NM_007294.3(BRCA1):c.1401G>A (p.Lys467=) rs786201323
NM_007294.3(BRCA1):c.1404G>A (p.Lys468=) rs1555591782
NM_007294.3(BRCA1):c.1405G>A (p.Ala469Thr) rs397507187
NM_007294.3(BRCA1):c.1409G>A (p.Ser470Asn)
NM_007294.3(BRCA1):c.140G>A (p.Cys47Tyr) rs80357150
NM_007294.3(BRCA1):c.140G>T (p.Cys47Phe) rs80357150
NM_007294.3(BRCA1):c.1416delC (p.Asn473Thrfs) rs1555591774
NM_007294.3(BRCA1):c.1418A>G (p.Asn473Ser) rs80357057
NM_007294.3(BRCA1):c.1418A>T (p.Asn473Ile) rs80357057
NM_007294.3(BRCA1):c.1419C>T (p.Asn473=) rs777228325
NM_007294.3(BRCA1):c.1421T>G (p.Leu474Ter) rs80357490
NM_007294.3(BRCA1):c.1423A>T (p.Ser475Cys) rs1064794047
NM_007294.3(BRCA1):c.1427A>G (p.His476Arg) rs55720177
NM_007294.3(BRCA1):c.1434T>G (p.Thr478=) rs876658280
NM_007294.3(BRCA1):c.1439dupA (p.Asn480Lysfs) rs80357505
NM_007294.3(BRCA1):c.143delT (p.Met48Serfs) rs80357637
NM_007294.3(BRCA1):c.1441C>G (p.Leu481Val) rs1397842308
NM_007294.3(BRCA1):c.1444_1447delATTA (p.Ile482Terfs) rs80357801
NM_007294.3(BRCA1):c.1446_1448delTAT (p.Ile483del) rs80358327
NM_007294.3(BRCA1):c.1448T>C (p.Ile483Thr) rs80357489
NM_007294.3(BRCA1):c.144G>A (p.Met48Ile) rs587783040
NM_007294.3(BRCA1):c.1456T>A (p.Phe486Ile) rs55906931
NM_007294.3(BRCA1):c.1456T>C (p.Phe486Leu) rs55906931
NM_007294.3(BRCA1):c.1459G>T (p.Val487Phe) rs369588942
NM_007294.3(BRCA1):c.1460T>G (p.Val487Gly) rs748812609
NM_007294.3(BRCA1):c.1462dupA (p.Thr488Asnfs) rs80357599
NM_007294.3(BRCA1):c.1469C>T (p.Pro490Leu) rs876658291
NM_007294.3(BRCA1):c.1470A>G (p.Pro490=) rs775032066
NM_007294.3(BRCA1):c.1471C>G (p.Gln491Glu) rs62625303
NM_007294.3(BRCA1):c.1471C>T (p.Gln491Ter) rs62625303
NM_007294.3(BRCA1):c.1472A>C (p.Gln491Pro) rs80357376
NM_007294.3(BRCA1):c.1477delA (p.Ile493Tyrfs) rs786203982
NM_007294.3(BRCA1):c.1478T>C (p.Ile493Thr) rs1555591707
NM_007294.3(BRCA1):c.147G>A (p.Leu49=) rs1555597297
NM_007294.3(BRCA1):c.1480C>T (p.Gln494Ter) rs80357010
NM_007294.3(BRCA1):c.1486C>T (p.Arg496Cys) rs28897676
NM_007294.3(BRCA1):c.1487G>A (p.Arg496His) rs28897677
NM_007294.3(BRCA1):c.1487G>T (p.Arg496Leu) rs28897677
NM_007294.3(BRCA1):c.1488delT (p.Leu498Serfs) rs587782251
NM_007294.3(BRCA1):c.1489C>A (p.Pro497Thr) rs1555591695
NM_007294.3(BRCA1):c.1490C>T (p.Pro497Leu) rs1555591693
NM_007294.3(BRCA1):c.1491C>G (p.Pro497=) rs786202374
NM_007294.3(BRCA1):c.1492delC (p.Leu498Serfs) rs80357527
NM_007294.3(BRCA1):c.1496C>T (p.Thr499Ile) rs876658285
NM_007294.3(BRCA1):c.1499A>G (p.Asn500Ser) rs1555591677
NM_007294.3(BRCA1):c.1504_1507delTTAA (p.Leu502Serfs) rs886039955
NM_007294.3(BRCA1):c.1504_1508delTTAAA (p.Leu502Alafs) rs80357888
NM_007294.3(BRCA1):c.1505_1509delTAAAG (p.Leu502Serfs) rs876659139
NM_007294.3(BRCA1):c.1506A>G (p.Leu502=) rs786203671
NM_007294.3(BRCA1):c.1508A>G (p.Lys503Arg) rs62625304
NM_007294.3(BRCA1):c.150A>G (p.Lys50=) rs1555597289
NM_007294.3(BRCA1):c.150A>T (p.Lys50Asn) rs1555597289
NM_007294.3(BRCA1):c.1510C>T (p.Arg504Cys) rs80357445
NM_007294.3(BRCA1):c.1510delC (p.Arg504Valfs) rs80357908
NM_007294.3(BRCA1):c.1511G>A (p.Arg504His) rs56272539
NM_007294.3(BRCA1):c.1513A>T (p.Lys505Ter) rs397508877
NM_007294.3(BRCA1):c.1518delG (p.Arg507Aspfs) rs80357947
NM_007294.3(BRCA1):c.1521_1531delACCTACATCAG (p.Thr509Serfs) rs1555591596
NM_007294.3(BRCA1):c.1522C>G (p.Pro508Ala) rs1555591622
NM_007294.3(BRCA1):c.1524T>C (p.Pro508=) rs200616937
NM_007294.3(BRCA1):c.1529C>G (p.Ser510Ter) rs80357427
NM_007294.3(BRCA1):c.1530delA (p.Gly511Alafs) rs80357735
NM_007294.3(BRCA1):c.1533C>A (p.Gly511=) rs1280391272
NM_007294.3(BRCA1):c.1534C>G (p.Leu512Val) rs41286294
NM_007294.3(BRCA1):c.1534C>T (p.Leu512Phe) rs41286294
NM_007294.3(BRCA1):c.1540C>A (p.Pro514Thr) rs1555591584
NM_007294.3(BRCA1):c.1541C>G (p.Pro514Arg)
NM_007294.3(BRCA1):c.1542_1550delTGAGGATTTinsCG (p.Glu515Valfs) rs876659591
NM_007294.3(BRCA1):c.1543G>A (p.Glu515Lys)
NM_007294.3(BRCA1):c.154C>A (p.Leu52Ile) rs80357084
NM_007294.3(BRCA1):c.154C>T (p.Leu52Phe) rs80357084
NM_007294.3(BRCA1):c.1555A>C (p.Lys519Gln) rs397508882
NM_007294.3(BRCA1):c.1556delA (p.Lys519Argfs) rs80357662
NM_007294.3(BRCA1):c.155T>C (p.Leu52Pro) rs1060502346
NM_007294.3(BRCA1):c.1561G>A (p.Ala521Thr) rs80357122
NM_007294.3(BRCA1):c.1563A>G (p.Ala521=) rs754970915
NM_007294.3(BRCA1):c.1568T>G (p.Leu523Trp) rs397508885
NM_007294.3(BRCA1):c.1571C>T (p.Ala524Val) rs80357333
NM_007294.3(BRCA1):c.1573G>A (p.Val525Ile) rs80357273
NM_007294.3(BRCA1):c.1576C>T (p.Gln526Ter) rs80356984
NM_007294.3(BRCA1):c.1579_1580delAA (p.Lys527Aspfs) rs431825387
NM_007294.3(BRCA1):c.1581G>C (p.Lys527Asn) rs80357493
NM_007294.3(BRCA1):c.1589A>G (p.Glu530Gly) rs1555591512
NM_007294.3(BRCA1):c.1596A>T (p.Ile532=) rs1555591508
NM_007294.3(BRCA1):c.1601A>G (p.Gln534Arg) rs80357173
NM_007294.3(BRCA1):c.1601_1602delAG (p.Gln534Argfs) rs878854933
NM_007294.3(BRCA1):c.1607C>A (p.Thr536Asn) rs398122638
NM_007294.3(BRCA1):c.1607C>G (p.Thr536Ser) rs398122638
NM_007294.3(BRCA1):c.1608T>G (p.Thr536=) rs1555591482
NM_007294.3(BRCA1):c.1609A>G (p.Asn537Asp) rs398122639
NM_007294.3(BRCA1):c.160C>T (p.Gln54Ter) rs80356864
NM_007294.3(BRCA1):c.1612C>T (p.Gln538Ter) rs80356893
NM_007294.3(BRCA1):c.1612_1616delCAAAC (p.Gln538Glyfs) rs587776480
NM_007294.3(BRCA1):c.1616C>T (p.Thr539Met) rs80357374
NM_007294.3(BRCA1):c.1617G>A (p.Thr539=) rs372002119
NM_007294.3(BRCA1):c.1618G>A (p.Glu540Lys) rs730881471
NM_007294.3(BRCA1):c.1618delG (p.Glu540Serfs) rs1555591470
NM_007294.3(BRCA1):c.1630C>T (p.Gln544Ter) rs80356952
NM_007294.3(BRCA1):c.1631A>T (p.Gln544Leu)
NM_007294.3(BRCA1):c.1632A>G (p.Gln544=) rs876658401
NM_007294.3(BRCA1):c.1635G>A (p.Val545=) rs770842236
NM_007294.3(BRCA1):c.1636A>G (p.Met546Val) rs587782390
NM_007294.3(BRCA1):c.1636_1654del19 (p.Met546Valfs) rs80359881
NM_007294.3(BRCA1):c.1639A>C (p.Asn547His) rs1060502351
NM_007294.3(BRCA1):c.1639A>T (p.Asn547Tyr)
NM_007294.3(BRCA1):c.1648A>C (p.Asn550His) rs56012641
NM_007294.3(BRCA1):c.1650T>C (p.Asn550=) rs777595821
NM_007294.3(BRCA1):c.1654G>A (p.Gly552Ser) rs758598971
NM_007294.3(BRCA1):c.1655G>A (p.Gly552Asp)
NM_007294.3(BRCA1):c.1658A>C (p.His553Pro) rs748431827
NM_007294.3(BRCA1):c.1662G>C (p.Glu554Asp) rs876659028
NM_007294.3(BRCA1):c.1670C>T (p.Thr557Ile)
NM_007294.3(BRCA1):c.1673_1674delAA (p.Lys558Argfs) rs80357600
NM_007294.3(BRCA1):c.1674delA (p.Gly559Valfs) rs80357600
NM_007294.3(BRCA1):c.1674dupA (p.Gly559Argfs) rs80357600
NM_007294.3(BRCA1):c.1675G>A (p.Gly559Ser) rs1555591384
NM_007294.3(BRCA1):c.1676G>A (p.Gly559Asp)
NM_007294.3(BRCA1):c.1676delG (p.Gly559Valfs) rs1555591383
NM_007294.3(BRCA1):c.1679A>T (p.Asp560Val)
NM_007294.3(BRCA1):c.1684A>G (p.Ile562Val)
NM_007294.3(BRCA1):c.1686T>G (p.Ile562Met) rs1268133978
NM_007294.3(BRCA1):c.1687C>T (p.Gln563Ter) rs80356898
NM_007294.3(BRCA1):c.169G>A (p.Gly57Arg) rs879255289
NM_007294.3(BRCA1):c.169G>C (p.Gly57Arg) rs879255289
NM_007294.3(BRCA1):c.1702C>T (p.Pro568Ser) rs755122577
NM_007294.3(BRCA1):c.1703C>G (p.Pro568Arg) rs80356910
NM_007294.3(BRCA1):c.1703C>T (p.Pro568Leu) rs80356910
NM_007294.3(BRCA1):c.1704T>G (p.Pro568=) rs587780795
NM_007294.3(BRCA1):c.1705A>G (p.Asn569Asp) rs587781315
NM_007294.3(BRCA1):c.1707C>T (p.Asn569=) rs876659110
NM_007294.3(BRCA1):c.1709C>A (p.Pro570Gln) rs879254020
NM_007294.3(BRCA1):c.1710A>G (p.Pro570=) rs876659901
NM_007294.3(BRCA1):c.1712T>A (p.Ile571Lys) rs80357159
NM_007294.3(BRCA1):c.1712T>C (p.Ile571Thr) rs80357159
NM_007294.3(BRCA1):c.1713A>G (p.Ile571Met) rs552505690
NM_007294.3(BRCA1):c.1713_1717delAGAAT (p.Glu572Thrfs) rs80357640
NM_007294.3(BRCA1):c.1714G>A (p.Glu572Lys) rs730881473
NM_007294.3(BRCA1):c.1714G>C (p.Glu572Gln) rs730881473
NM_007294.3(BRCA1):c.1714G>T (p.Glu572Ter) rs730881473
NM_007294.3(BRCA1):c.1717T>C (p.Ser573Pro) rs876660448
NM_007294.3(BRCA1):c.1718C>T (p.Ser573Leu) rs876660434
NM_007294.3(BRCA1):c.1721T>C (p.Leu574Pro) rs1060502341
NM_007294.3(BRCA1):c.1723G>A (p.Glu575Lys) rs397508902
NM_007294.3(BRCA1):c.1724A>G (p.Glu575Gly) rs111539978
NM_007294.3(BRCA1):c.1728A>G (p.Lys576=) rs786201232
NM_007294.3(BRCA1):c.1729G>T (p.Glu577Ter) rs397508903
NM_007294.3(BRCA1):c.172C>A (p.Pro58Thr) rs397508904
NM_007294.3(BRCA1):c.172C>G (p.Pro58Ala) rs397508904
NM_007294.3(BRCA1):c.1731A>G (p.Glu577=) rs28897678
NM_007294.3(BRCA1):c.1733C>A (p.Ser578Tyr) rs80356939
NM_007294.3(BRCA1):c.1733C>T (p.Ser578Phe) rs80356939
NM_007294.3(BRCA1):c.1737T>G (p.Ala579=)
NM_007294.3(BRCA1):c.1740C>T (p.Phe580=) rs1057520244
NM_007294.3(BRCA1):c.1745C>A (p.Thr582Lys)
NM_007294.3(BRCA1):c.1745C>T (p.Thr582Met) rs786202386
NM_007294.3(BRCA1):c.1747A>G (p.Lys583Glu) rs80356928
NM_007294.3(BRCA1):c.1749A>G (p.Lys583=) rs876659580
NM_007294.3(BRCA1):c.1757C>G (p.Pro586Arg) rs1064795270
NM_007294.3(BRCA1):c.1757delC (p.Pro586Leufs) rs80357723
NM_007294.3(BRCA1):c.1758T>C (p.Pro586=)
NM_007294.3(BRCA1):c.1762A>G (p.Ser588Gly) rs1169162396
NM_007294.3(BRCA1):c.1763_1764delGCinsAA (p.Ser588Lys) rs1555591274
NM_007294.3(BRCA1):c.1763_1764delGCinsTT (p.Ser588Ile) rs1555591274
NM_007294.3(BRCA1):c.1765delA (p.Ser589Alafs) rs1555591273
NM_007294.3(BRCA1):c.1768_1770delAGTinsC (p.Ser590Hisfs) rs876659196
NM_007294.3(BRCA1):c.1769_1771delGTA (p.Ser590del) rs1555591267
NM_007294.3(BRCA1):c.1772T>C (p.Ile591Thr) rs80356859
NM_007294.3(BRCA1):c.1773A>C (p.Ile591=) rs1555591259
NM_007294.3(BRCA1):c.1775G>A (p.Ser592Asn) rs786203044
NM_007294.3(BRCA1):c.1776C>T (p.Ser592=) rs876658911
NM_007294.3(BRCA1):c.1784A>G (p.Glu595Gly) rs876660455
NM_007294.3(BRCA1):c.1786C>T (p.Leu596Phe) rs80357371
NM_007294.3(BRCA1):c.1789G>A (p.Glu597Lys) rs55650082
NM_007294.3(BRCA1):c.1793T>A (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1793T>G (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1794A>G (p.Leu598=) rs876659644
NM_007294.3(BRCA1):c.1797T>C (p.Asn599=) rs756211343
NM_007294.3(BRCA1):c.1799T>C (p.Ile600Thr) rs398122643
NM_007294.3(BRCA1):c.179A>G (p.Gln60Arg) rs373655067
NM_007294.3(BRCA1):c.1802A>G (p.His601Arg) rs371631805
NM_007294.3(BRCA1):c.1805A>G (p.Asn602Ser)
NM_007294.3(BRCA1):c.1812delA (p.Ala605Hisfs) rs80357927
NM_007294.3(BRCA1):c.1813G>T (p.Ala605Ser) rs587781613
NM_007294.3(BRCA1):c.1819A>G (p.Lys607Glu) rs80357220
NM_007294.3(BRCA1):c.181T>G (p.Cys61Gly) rs28897672
NM_007294.3(BRCA1):c.1823_1826delAGAA (p.Lys608Ilefs) rs80357585
NM_007294.3(BRCA1):c.1824_1826delGAA (p.Lys608del) rs587781614
NM_007294.3(BRCA1):c.1829G>A (p.Arg610Lys) rs876660322
NM_007294.3(BRCA1):c.182G>A (p.Cys61Tyr) rs80357093
NM_007294.3(BRCA1):c.182_183delGT (p.Cys61Serfs) rs397508912
NM_007294.3(BRCA1):c.1830G>A (p.Arg610=) rs587780796
NM_007294.3(BRCA1):c.1833G>A (p.Leu611=) rs786201548
NM_007294.3(BRCA1):c.1834A>G (p.Arg612Gly) rs80357245
NM_007294.3(BRCA1):c.1836dupG (p.Arg613Glufs) rs876660523
NM_007294.3(BRCA1):c.1837A>G (p.Arg613Gly) rs863224753
NM_007294.3(BRCA1):c.1838G>A (p.Arg613Lys) rs786203937
NM_007294.3(BRCA1):c.1842G>A (p.Lys614=) rs760109939
NM_007294.3(BRCA1):c.1842G>T (p.Lys614Asn) rs760109939
NM_007294.3(BRCA1):c.1846_1848delTCT (p.Ser616del) rs80358329
NM_007294.3(BRCA1):c.1849A>G (p.Thr617Ala) rs45564238
NM_007294.3(BRCA1):c.1853G>A (p.Arg618Lys) rs876659527
NM_007294.3(BRCA1):c.1853G>C (p.Arg618Thr)
NM_007294.3(BRCA1):c.1859T>A (p.Ile620Asn) rs1555591085
NM_007294.3(BRCA1):c.185C>G (p.Pro62Arg) rs786202286
NM_007294.3(BRCA1):c.1860delT (p.His621Metfs) rs730881459
NM_007294.3(BRCA1):c.1863T>C (p.His621=) rs786201460
NM_007294.3(BRCA1):c.1865C>T (p.Ala622Val) rs56039126
NM_007294.3(BRCA1):c.1866G>A (p.Ala622=) rs1800064
NM_007294.3(BRCA1):c.1873C>T (p.Leu625=) rs769044421
NM_007294.3(BRCA1):c.1874_1877dupTAGT (p.Val627Serfs) rs80357516
NM_007294.3(BRCA1):c.1875A>G (p.Leu625=) rs786201429
NM_007294.3(BRCA1):c.1878A>G (p.Val626=) rs8176154
NM_007294.3(BRCA1):c.1879G>A (p.Val627Ile) rs80357425
NM_007294.3(BRCA1):c.1881C>G (p.Val627=) rs80356838
NM_007294.3(BRCA1):c.1881C>T (p.Val627=) rs80356838
NM_007294.3(BRCA1):c.1881_1884delCAGT (p.Ser628Glufs) rs80357567
NM_007294.3(BRCA1):c.1882A>G (p.Ser628Gly) rs1555591000
NM_007294.3(BRCA1):c.1884T>G (p.Ser628Arg) rs80357495
NM_007294.3(BRCA1):c.1886G>T (p.Arg629Ile) rs876660144
NM_007294.3(BRCA1):c.188T>A (p.Leu63Ter) rs80357086
NM_007294.3(BRCA1):c.1891C>A (p.Leu631Ile) rs876659175
NM_007294.3(BRCA1):c.1892dupT (p.Ser632Lysfs) rs80357932
NM_007294.3(BRCA1):c.1893A>C (p.Leu631=) rs80356834
NM_007294.3(BRCA1):c.1895G>A (p.Ser632Asn) rs80356983
NM_007294.3(BRCA1):c.1897C>T (p.Pro633Ser) rs80356902
NM_007294.3(BRCA1):c.1898C>T (p.Pro633Leu) rs398122647
NM_007294.3(BRCA1):c.189A>T (p.Leu63Phe) rs80356956
NM_007294.3(BRCA1):c.1903A>G (p.Asn635Asp)
NM_007294.3(BRCA1):c.1905T>C (p.Asn635=) rs369373293
NM_007294.3(BRCA1):c.1907G>A (p.Cys636Tyr) rs398122649
NM_007294.3(BRCA1):c.190T>C (p.Cys64Arg) rs80357064
NM_007294.3(BRCA1):c.190T>G (p.Cys64Gly) rs80357064
NM_007294.3(BRCA1):c.1910C>T (p.Thr637Ile) rs1555590925
NM_007294.3(BRCA1):c.1911T>C (p.Thr637=) rs62625305
NM_007294.3(BRCA1):c.1912G>A (p.Glu638Lys) rs80357005
NM_007294.3(BRCA1):c.1913A>C (p.Glu638Ala) rs786201944
NM_007294.3(BRCA1):c.1916T>A (p.Leu639Ter) rs80357267
NM_007294.3(BRCA1):c.1917G>A (p.Leu639=) rs786202103
NM_007294.3(BRCA1):c.1919A>C (p.Gln640Pro) rs786203965
NM_007294.3(BRCA1):c.191G>A (p.Cys64Tyr) rs55851803
NM_007294.3(BRCA1):c.1920A>G (p.Gln640=) rs587782843
NM_007294.3(BRCA1):c.1920A>T (p.Gln640His) rs587782843
NM_007294.3(BRCA1):c.1921dupA (p.Ile641Asnfs) rs397507194
NM_007294.3(BRCA1):c.1922T>C (p.Ile641Thr) rs730881474
NM_007294.3(BRCA1):c.1924G>A (p.Asp642Asn)
NM_007294.3(BRCA1):c.1924G>C (p.Asp642His) rs80357344
NM_007294.3(BRCA1):c.1925A>G (p.Asp642Gly) rs786204049
NM_007294.3(BRCA1):c.1926T>C (p.Asp642=) rs786203720
NM_007294.3(BRCA1):c.1927A>G (p.Ser643Gly) rs80357105
NM_007294.3(BRCA1):c.1928G>T (p.Ser643Ile) rs876660335
NM_007294.3(BRCA1):c.1929_1930delTTinsA (p.Ser643Argfs) rs886039982
NM_007294.3(BRCA1):c.192T>A (p.Cys64Ter) rs587781632
NM_007294.3(BRCA1):c.1930T>A (p.Cys644Ser) rs753521391
NM_007294.3(BRCA1):c.1931G>C (p.Cys644Ser)
NM_007294.3(BRCA1):c.1931G>T (p.Cys644Phe) rs876658606
NM_007294.3(BRCA1):c.1931_1933delGTT (p.Cys644del) rs587782739
NM_007294.3(BRCA1):c.1934C>A (p.Ser645Tyr) rs80357129
NM_007294.3(BRCA1):c.1944A>G (p.Glu648=) rs876660781
NM_007294.3(BRCA1):c.1945G>C (p.Glu649Gln) rs80356907
NM_007294.3(BRCA1):c.1949T>G (p.Ile650Arg) rs1555590816
NM_007294.3(BRCA1):c.1950A>T (p.Ile650=) rs1060504579
NM_007294.3(BRCA1):c.1951A>C (p.Lys651Gln) rs1555590804
NM_007294.3(BRCA1):c.1953_1956delGAAA (p.Lys653Serfs) rs80357526
NM_007294.3(BRCA1):c.1953dupG (p.Lys652Glufs) rs80357753
NM_007294.3(BRCA1):c.1954A>G (p.Lys652Glu)
NM_007294.3(BRCA1):c.1959A>G (p.Lys653=) rs767530204
NM_007294.3(BRCA1):c.1960A>T (p.Lys654Ter) rs80357355
NM_007294.3(BRCA1):c.1961delA (p.Lys654Serfs) rs80357522
NM_007294.3(BRCA1):c.1961dupA (p.Tyr655Valfs) rs80357522
NM_007294.3(BRCA1):c.1964delA (p.Tyr655Serfs) rs786203594
NM_007294.3(BRCA1):c.1965C>A (p.Tyr655Ter) rs886039987
NM_007294.3(BRCA1):c.1966A>G (p.Asn656Asp) rs786203455
NM_007294.3(BRCA1):c.1967A>G (p.Asn656Ser) rs397508925
NM_007294.3(BRCA1):c.1971A>G (p.Gln657=) rs28897679
NM_007294.3(BRCA1):c.1974G>C (p.Met658Ile) rs55678461
NM_007294.3(BRCA1):c.1975C>G (p.Pro659Ala) rs587776481
NM_007294.3(BRCA1):c.1978G>A (p.Val660Ile) rs876660889
NM_007294.3(BRCA1):c.1983G>A (p.Arg661=) rs869320788
NM_007294.3(BRCA1):c.1984C>T (p.His662Tyr) rs397508927
NM_007294.3(BRCA1):c.198T>C (p.Asn66=) rs878854936
NM_007294.3(BRCA1):c.1996C>G (p.Leu666Val) rs1555590709
NM_007294.3(BRCA1):c.1998A>G (p.Leu666=) rs864622452
NM_007294.3(BRCA1):c.1999C>T (p.Gln667Ter) rs80356889
NM_007294.3(BRCA1):c.199G>T (p.Asp67Tyr) rs80357102
NM_007294.3(BRCA1):c.19C>T (p.Arg7Cys) rs80356994
NM_007294.3(BRCA1):c.19_47del29 (p.Arg7Cysfs) rs80359871
NM_007294.3(BRCA1):c.1A>G (p.Met1Val) rs80357287
NM_007294.3(BRCA1):c.2001A>G (p.Gln667=) rs878854937
NM_007294.3(BRCA1):c.2001dupA (p.Leu668Thrfs) rs80357521
NM_007294.3(BRCA1):c.2002C>T (p.Leu668Phe) rs80357250
NM_007294.3(BRCA1):c.2004C>A (p.Leu668=) rs1057520832
NM_007294.3(BRCA1):c.2004C>T (p.Leu668=) rs1057520832
NM_007294.3(BRCA1):c.2006T>C (p.Met669Thr) rs80356895
NM_007294.3(BRCA1):c.2008G>A (p.Glu670Lys) rs80357029
NM_007294.3(BRCA1):c.2014A>G (p.Lys672Glu) rs397508929
NM_007294.3(BRCA1):c.2014A>T (p.Lys672Ter) rs397508929
NM_007294.3(BRCA1):c.2017G>T (p.Glu673Ter) rs80357391
NM_007294.3(BRCA1):c.2018_2023delAACCTG (p.Glu673_Pro674del) rs879254165
NM_007294.3(BRCA1):c.2019delA (p.Glu673Aspfs) rs80357626
NM_007294.3(BRCA1):c.2021C>G (p.Pro674Arg) rs876660543
NM_007294.3(BRCA1):c.2022T>G (p.Pro674=) rs771519405
NM_007294.3(BRCA1):c.202A>G (p.Ile68Val) rs1555597195
NM_007294.3(BRCA1):c.2035A>T (p.Lys679Ter) rs80357082
NM_007294.3(BRCA1):c.2037delGinsCC (p.Lys679Asnfs) rs397508932
NM_007294.3(BRCA1):c.2038A>G (p.Lys680Glu)
NM_007294.3(BRCA1):c.203_204delTA (p.Ile68Asnfs) rs398122651
NM_007294.3(BRCA1):c.2042G>A (p.Ser681Asn)
NM_007294.3(BRCA1):c.2043T>G (p.Ser681Arg) rs143920945
NM_007294.3(BRCA1):c.2043dupT (p.Asn682Terfs) rs863224510
NM_007294.3(BRCA1):c.2048A>G (p.Lys683Arg) rs1060502357
NM_007294.3(BRCA1):c.204A>T (p.Ile68=) rs1555597192
NM_007294.3(BRCA1):c.2050C>A (p.Pro684Thr) rs397508934
NM_007294.3(BRCA1):c.2050C>T (p.Pro684Ser) rs397508934
NM_007294.3(BRCA1):c.2055T>C (p.Asn685=) rs1555590600
NM_007294.3(BRCA1):c.2056G>T (p.Glu686Ter) rs587782709
NM_007294.3(BRCA1):c.2059C>T (p.Gln687Ter) rs273898674
NM_007294.3(BRCA1):c.2060A>C (p.Gln687Pro) rs28897680
NM_007294.3(BRCA1):c.2065A>G (p.Ser689Gly) rs876660188
NM_007294.3(BRCA1):c.2068A>G (p.Lys690Glu) rs587781448
NM_007294.3(BRCA1):c.206C>T (p.Thr69Ile) rs273898675
NM_007294.3(BRCA1):c.2070_2071delAA (p.Arg691Thrfs) rs80357688
NM_007294.3(BRCA1):c.2071delA (p.Arg691Aspfs) rs80357688
NM_007294.3(BRCA1):c.2074C>T (p.His692Tyr) rs545736576
NM_007294.3(BRCA1):c.2074delC (p.His692Metfs) rs80357554
NM_007294.3(BRCA1):c.2076T>A (p.His692Gln) rs587782595
NM_007294.3(BRCA1):c.2076T>C (p.His692=) rs587782595
NM_007294.3(BRCA1):c.2077G>A (p.Asp693Asn) rs4986850
NM_007294.3(BRCA1):c.2078A>G (p.Asp693Gly)
NM_007294.3(BRCA1):c.207C>G (p.Thr69=)
NM_007294.3(BRCA1):c.2081G>A (p.Ser694Asn) rs431825388
NM_007294.3(BRCA1):c.2082C>T (p.Ser694=) rs1799949
NM_007294.3(BRCA1):c.2083G>A (p.Asp695Asn) rs28897681
NM_007294.3(BRCA1):c.2083G>T (p.Asp695Tyr) rs28897681
NM_007294.3(BRCA1):c.2086A>G (p.Thr696Ala) rs80357441
NM_007294.3(BRCA1):c.2093C>T (p.Pro698Leu) rs1555590478
NM_007294.3(BRCA1):c.2095G>C (p.Glu699Gln) rs876658306
NM_007294.3(BRCA1):c.2099T>C (p.Leu700Pro)
NM_007294.3(BRCA1):c.20G>A (p.Arg7His) rs144792613
NM_007294.3(BRCA1):c.2101A>T (p.Lys701Ter) rs876660282
NM_007294.3(BRCA1):c.2102A>G (p.Lys701Arg) rs876658307
NM_007294.3(BRCA1):c.2103G>A (p.Lys701=) rs273898677
NM_007294.3(BRCA1):c.2105dupT (p.Leu702Phefs) rs80357880
NM_007294.3(BRCA1):c.2108C>T (p.Thr703Ile) rs1302055573
NM_007294.3(BRCA1):c.2109A>G (p.Thr703=) rs4986844
NM_007294.3(BRCA1):c.2110_2111delAA (p.Asn704Cysfs) rs80357814
NM_007294.3(BRCA1):c.2117C>T (p.Pro706Leu)
NM_007294.3(BRCA1):c.2119G>C (p.Gly707Arg) rs587781420
NM_007294.3(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.3(BRCA1):c.212+10T>C rs80358174
NM_007294.3(BRCA1):c.212+13G>A rs752088834
NM_007294.3(BRCA1):c.212+15A>G rs587780797
NM_007294.3(BRCA1):c.212+17T>C rs369461674
NM_007294.3(BRCA1):c.212+1G>A rs80358042
NM_007294.3(BRCA1):c.212+1G>T rs80358042
NM_007294.3(BRCA1):c.212+1delG rs786203526
NM_007294.3(BRCA1):c.212+23T>A rs8176128
NM_007294.3(BRCA1):c.212+3A>G rs80358083
NM_007294.3(BRCA1):c.212+4T>A rs398122652
NM_007294.3(BRCA1):c.212+4T>C rs398122652
NM_007294.3(BRCA1):c.2120G>A (p.Gly707Asp) rs80357192
NM_007294.3(BRCA1):c.2121T>G (p.Gly707=) rs786201649
NM_007294.3(BRCA1):c.2123C>A (p.Ser708Tyr) rs80357182
NM_007294.3(BRCA1):c.2123C>G (p.Ser708Cys) rs80357182
NM_007294.3(BRCA1):c.2123C>T (p.Ser708Phe) rs80357182
NM_007294.3(BRCA1):c.2126_2127delTT (p.Phe709Tyrfs) rs397508939
NM_007294.3(BRCA1):c.2128A>G (p.Thr710Ala) rs876659959
NM_007294.3(BRCA1):c.212G>C (p.Arg71Thr) rs80356913
NM_007294.3(BRCA1):c.212G>T (p.Arg71Met) rs80356913
NM_007294.3(BRCA1):c.213-11T>G rs80358061
NM_007294.3(BRCA1):c.213-12A>G rs80358163
NM_007294.3(BRCA1):c.213-15A>G rs886040903
NM_007294.3(BRCA1):c.2130T>G (p.Thr710=) rs273898678
NM_007294.3(BRCA1):c.2131A>G (p.Lys711Glu) rs747046197
NM_007294.3(BRCA1):c.2131_2132delAA (p.Lys711Valfs) rs398122653
NM_007294.3(BRCA1):c.2133G>A (p.Lys711=)
NM_007294.3(BRCA1):c.2134T>C (p.Cys712Arg) rs786202015
NM_007294.3(BRCA1):c.2135G>T (p.Cys712Phe) rs1555590395
NM_007294.3(BRCA1):c.2138C>A (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2138C>G (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2153T>G (p.Leu718Arg) rs748550848
NM_007294.3(BRCA1):c.2155A>G (p.Lys719Glu) rs80357147
NM_007294.3(BRCA1):c.2156A>C (p.Lys719Thr) rs876660920
NM_007294.3(BRCA1):c.2156_2163dup (p.Val722Lysfs) rs1555590322
NM_007294.3(BRCA1):c.2157dupA (p.Glu720Argfs) rs80357715
NM_007294.3(BRCA1):c.2158G>A (p.Glu720Lys) rs80356875
NM_007294.3(BRCA1):c.2158G>T (p.Glu720Ter) rs80356875
NM_007294.3(BRCA1):c.2164delG (p.Val722Serfs) rs1555590315
NM_007294.3(BRCA1):c.2167A>G (p.Asn723Asp) rs4986845
NM_007294.3(BRCA1):c.216C>G (p.Ser72Arg) rs80356967
NM_007294.3(BRCA1):c.2178T>A (p.Leu726=) rs1555590270
NM_007294.3(BRCA1):c.217C>T (p.Leu73=) rs786201203
NM_007294.3(BRCA1):c.2180C>T (p.Pro727Leu) rs80356912
NM_007294.3(BRCA1):c.2183G>A (p.Arg728Lys) rs80357335
NM_007294.3(BRCA1):c.2185G>A (p.Glu729Lys) rs876659852
NM_007294.3(BRCA1):c.2190A>G (p.Glu730=) rs1555590252
NM_007294.3(BRCA1):c.2191_2196delAAAGAA (p.Lys731_Glu732del) rs1394201588
NM_007294.3(BRCA1):c.2192_2196delAAGAA (p.Lys731Argfs) rs397508946
NM_007294.3(BRCA1):c.2193_2196delAGAA (p.Glu732Argfs) rs397508947
NM_007294.3(BRCA1):c.2193delA (p.Glu732Lysfs) rs886040009
NM_007294.3(BRCA1):c.2195A>C (p.Glu732Ala) rs876660463
NM_007294.3(BRCA1):c.2197G>T (p.Glu733Ter) rs397508949
NM_007294.3(BRCA1):c.2197_2201delGAGAA (p.Glu733Thrfs) rs80357507
NM_007294.3(BRCA1):c.2199delG (p.Lys734Asnfs) rs80357944
NM_007294.3(BRCA1):c.219A>G (p.Leu73=) rs876659123
NM_007294.3(BRCA1):c.21C>T (p.Arg7=) rs149402012
NM_007294.3(BRCA1):c.2203C>G (p.Leu735Val) rs587781781
NM_007294.3(BRCA1):c.2205A>G (p.Leu735=) rs1555590208
NM_007294.3(BRCA1):c.2207A>C (p.Glu736Ala) rs397507196
NM_007294.3(BRCA1):c.2207A>G (p.Glu736Gly) rs397507196
NM_007294.3(BRCA1):c.220C>A (p.Gln74Lys)
NM_007294.3(BRCA1):c.220C>T (p.Gln74Ter) rs80357234
NM_007294.3(BRCA1):c.2210_2211delCA (p.Thr737Serfs) rs80357654
NM_007294.3(BRCA1):c.2212_2215delGTTA (p.Val738Lysfs) rs397508951
NM_007294.3(BRCA1):c.2214_2215insTT (p.Lys739Leufs) rs80357574
NM_007294.3(BRCA1):c.2214dupT (p.Lys739Terfs) rs80357574
NM_007294.3(BRCA1):c.2215A>C (p.Lys739Gln) rs56329598
NM_007294.3(BRCA1):c.2215A>G (p.Lys739Glu) rs56329598
NM_007294.3(BRCA1):c.2215A>T (p.Lys739Ter) rs56329598
NM_007294.3(BRCA1):c.2216_2217delAA (p.Lys739Serfs) rs397508952
NM_007294.3(BRCA1):c.2217A>G (p.Lys739=) rs200521980
NM_007294.3(BRCA1):c.2218G>C (p.Val740Leu) rs80357415
NM_007294.3(BRCA1):c.2218G>T (p.Val740Leu) rs80357415
NM_007294.3(BRCA1):c.2222C>G (p.Ser741Cys) rs80357051
NM_007294.3(BRCA1):c.2222C>T (p.Ser741Phe) rs80357051
NM_007294.3(BRCA1):c.2223T>C (p.Ser741=) rs1555590129
NM_007294.3(BRCA1):c.2224A>G (p.Asn742Asp) rs876658733
NM_007294.3(BRCA1):c.2227A>C (p.Asn743His) rs1212635015
NM_007294.3(BRCA1):c.2228A>G (p.Asn743Ser)
NM_007294.3(BRCA1):c.222A>G (p.Gln74=) rs730881465
NM_007294.3(BRCA1):c.2230G>A (p.Ala744Thr) rs786203435
NM_007294.3(BRCA1):c.2232T>C (p.Ala744=) rs4986846
NM_007294.3(BRCA1):c.2232T>G (p.Ala744=) rs4986846
NM_007294.3(BRCA1):c.2235A>C (p.Glu745Asp) rs876660266
NM_007294.3(BRCA1):c.2236G>T (p.Asp746Tyr) rs876660267
NM_007294.3(BRCA1):c.2238C>A (p.Asp746Glu) rs786202757
NM_007294.3(BRCA1):c.2239C>T (p.Pro747Ser) rs1555590087
NM_007294.3(BRCA1):c.2243A>G (p.Lys748Arg)
NM_007294.3(BRCA1):c.2245G>T (p.Asp749Tyr) rs80357114
NM_007294.3(BRCA1):c.2246A>T (p.Asp749Val) rs730881479
NM_007294.3(BRCA1):c.2246_2280delATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACT (p.Asp749Glyfs) rs886037998
NM_007294.3(BRCA1):c.2247T>C (p.Asp749=) rs1289739423
NM_007294.3(BRCA1):c.2252T>C (p.Met751Thr) rs587781684
NM_007294.3(BRCA1):c.2258G>A (p.Ser753Asn) rs878854939
NM_007294.3(BRCA1):c.2263G>A (p.Glu755Lys) rs41286296
NM_007294.3(BRCA1):c.2264A>C (p.Glu755Ala)
NM_007294.3(BRCA1):c.2264A>G (p.Glu755Gly) rs922908090
NM_007294.3(BRCA1):c.2266A>G (p.Arg756Gly) rs1064795091
NM_007294.3(BRCA1):c.2267G>A (p.Arg756Lys) rs975724885
NM_007294.3(BRCA1):c.2268G>C (p.Arg756Ser) rs80356884
NM_007294.3(BRCA1):c.2268G>T (p.Arg756Ser) rs80356884
NM_007294.3(BRCA1):c.2269delG (p.Val757Phefs) rs80357583
NM_007294.3(BRCA1):c.2273dupT (p.Leu758Phefs) rs80357681
NM_007294.3(BRCA1):c.2274G>A (p.Leu758=) rs876660823
NM_007294.3(BRCA1):c.2281G>C (p.Glu761Gln) rs397507198
NM_007294.3(BRCA1):c.2282A>C (p.Glu761Ala) rs80356869
NM_007294.3(BRCA1):c.2284A>C (p.Arg762=) rs1555589988
NM_007294.3(BRCA1):c.2286A>T (p.Arg762Ser) rs273898682
NM_007294.3(BRCA1):c.2288C>G (p.Ser763Cys) rs876660112
NM_007294.3(BRCA1):c.2289T>C (p.Ser763=)
NM_007294.3(BRCA1):c.2289delT (p.Val764Terfs) rs876658791
NM_007294.3(BRCA1):c.2292A>G (p.Val764=) rs1555589969
NM_007294.3(BRCA1):c.2293G>T (p.Glu765Ter) rs80357449
NM_007294.3(BRCA1):c.2295G>A (p.Glu765=) rs201875054
NM_007294.3(BRCA1):c.2296A>C (p.Ser766Arg) rs398122655
NM_007294.3(BRCA1):c.2296A>G (p.Ser766Gly) rs398122655
NM_007294.3(BRCA1):c.2296_2297delAG (p.Ser766Terfs) rs80357780
NM_007294.3(BRCA1):c.2299A>G (p.Ser767Gly) rs80357194
NM_007294.3(BRCA1):c.2299A>T (p.Ser767Cys) rs80357194
NM_007294.3(BRCA1):c.2299delA (p.Ser767Alafs) rs80357786
NM_007294.3(BRCA1):c.22G>A (p.Val8Ile) rs528902306
NM_007294.3(BRCA1):c.2300G>C (p.Ser767Thr)
NM_007294.3(BRCA1):c.2302A>G (p.Ser768Gly) rs398122656
NM_007294.3(BRCA1):c.2302delA (p.Ser768Valfs) rs1555589953
NM_007294.3(BRCA1):c.2309C>A (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.230C>T (p.Thr77Met) rs80357209
NM_007294.3(BRCA1):c.2311T>C (p.Leu771=) rs16940
NM_007294.3(BRCA1):c.2312T>C (p.Leu771Ser) rs730881481
NM_007294.3(BRCA1):c.2314delG (p.Val772Tyrfs) rs80357957
NM_007294.3(BRCA1):c.2315T>C (p.Val772Ala) rs80357467
NM_007294.3(BRCA1):c.2316A>C (p.Val772=) rs876658590
NM_007294.3(BRCA1):c.231G>A (p.Thr77=) rs80356847
NM_007294.3(BRCA1):c.231G>C (p.Thr77=) rs80356847
NM_007294.3(BRCA1):c.231G>T (p.Thr77=) rs80356847
NM_007294.3(BRCA1):c.2329T>G (p.Tyr777Asp) rs397507199
NM_007294.3(BRCA1):c.2329delT (p.Tyr777Metfs) rs80357725
NM_007294.3(BRCA1):c.2331_2332dupTG (p.Gly778Valfs) rs431825390
NM_007294.3(BRCA1):c.2333G>A (p.Gly778Asp) rs730881483
NM_007294.3(BRCA1):c.2334C>T (p.Gly778=) rs777404687
NM_007294.3(BRCA1):c.2338C>G (p.Gln780Glu) rs80356945
NM_007294.3(BRCA1):c.2338C>T (p.Gln780Ter) rs80356945
NM_007294.3(BRCA1):c.2339A>G (p.Gln780Arg) rs1410232200
NM_007294.3(BRCA1):c.2340G>A (p.Gln780=) rs1555589856
NM_007294.3(BRCA1):c.2341G>C (p.Glu781Gln)
NM_007294.3(BRCA1):c.2342A>C (p.Glu781Ala) rs587776482
NM_007294.3(BRCA1):c.2346dupT (p.Ile783Tyrfs) rs886040027
NM_007294.3(BRCA1):c.2347A>G (p.Ile783Val) rs80356948
NM_007294.3(BRCA1):c.2351C>T (p.Ser784Leu) rs55914168
NM_007294.3(BRCA1):c.2352G>A (p.Ser784=) rs372017932
NM_007294.3(BRCA1):c.2355A>C (p.Leu785Phe)
NM_007294.3(BRCA1):c.2357T>C (p.Leu786Pro)
NM_007294.3(BRCA1):c.2359delG (p.Glu787Lysfs) rs80357739
NM_007294.3(BRCA1):c.2359dupG (p.Glu787Glyfs) rs80357739
NM_007294.3(BRCA1):c.2362G>A (p.Val788Ile) rs80357060
NM_007294.3(BRCA1):c.2362delG (p.Val788Leufs) rs876659136
NM_007294.3(BRCA1):c.2368A>G (p.Thr790Ala) rs41286298
NM_007294.3(BRCA1):c.2371C>G (p.Leu791Val)
NM_007294.3(BRCA1):c.2374G>A (p.Gly792Arg) rs1555589778
NM_007294.3(BRCA1):c.2381C>T (p.Ala794Val) rs7502059
NM_007294.3(BRCA1):c.2383A>G (p.Lys795Glu)
NM_007294.3(BRCA1):c.2386_2387delACinsT (p.Thr796Terfs) rs876660305
NM_007294.3(BRCA1):c.2387C>T (p.Thr796Ile) rs80357364
NM_007294.3(BRCA1):c.2389G>T (p.Glu797Ter) rs62625306
NM_007294.3(BRCA1):c.2389_2390delGA (p.Glu797Thrfs) rs80357695
NM_007294.3(BRCA1):c.238_239delAGins22 (p.?)
NM_007294.3(BRCA1):c.2392C>A (p.Pro798Thr) rs398122658
NM_007294.3(BRCA1):c.2392_2393delCCinsA (p.Pro798Lysfs) rs80357850
NM_007294.3(BRCA1):c.2393C>T (p.Pro798Leu) rs876660005
NM_007294.3(BRCA1):c.2396A>G (p.Asn799Ser) rs587782027
NM_007294.3(BRCA1):c.2397T>A (p.Asn799Lys) rs80357203
NM_007294.3(BRCA1):c.2398_2401delAAAT (p.Lys800Valfs) rs786202684
NM_007294.3(BRCA1):c.2402delG (p.Cys801Leufs) rs876659447
NM_007294.3(BRCA1):c.2404G>C (p.Val802Leu) rs876660885
NM_007294.3(BRCA1):c.2404G>T (p.Val802Leu) rs876660885
NM_007294.3(BRCA1):c.2405_2406delTG (p.Val802Glufs) rs80357706
NM_007294.3(BRCA1):c.2406_2409delGAGT (p.Gln804Valfs) rs80357674
NM_007294.3(BRCA1):c.2407_2408delAG (p.Gln804Valfs) rs786202919
NM_007294.3(BRCA1):c.2409T>C (p.Ser803=) rs1555589731
NM_007294.3(BRCA1):c.2410C>G (p.Gln804Glu) rs80356982
NM_007294.3(BRCA1):c.2411_2412delAG (p.Gln804Leufs) rs80357664
NM_007294.3(BRCA1):c.2412G>A (p.Gln804=) rs55746541
NM_007294.3(BRCA1):c.2412G>C (p.Gln804His) rs55746541
NM_007294.3(BRCA1):c.2416G>A (p.Ala806Thr) rs80357144
NM_007294.3(BRCA1):c.2416_2417delGC (p.Ala806Serfs) rs1555589706
NM_007294.3(BRCA1):c.2421A>G (p.Ala807=) rs772960140
NM_007294.3(BRCA1):c.2425G>A (p.Glu809Lys) rs786204151
NM_007294.3(BRCA1):c.2426A>G (p.Glu809Gly) rs397507201
NM_007294.3(BRCA1):c.2428A>T (p.Asn810Tyr) rs28897682
NM_007294.3(BRCA1):c.2433delC (p.Lys812Argfs) rs80357524
NM_007294.3(BRCA1):c.2433dupC (p.Lys812Glnfs) rs80357524
NM_007294.3(BRCA1):c.2437G>A (p.Gly813Arg)
NM_007294.3(BRCA1):c.2440C>T (p.Leu814=) rs786202054
NM_007294.3(BRCA1):c.2443delA (p.Ile815Phefs) rs80357598
NM_007294.3(BRCA1):c.2447A>G (p.His816Arg) rs80357108
NM_007294.3(BRCA1):c.2449G>A (p.Gly817Ser) rs1555589646
NM_007294.3(BRCA1):c.2457delC (p.Asp821Ilefs) rs80357669
NM_007294.3(BRCA1):c.2458A>G (p.Lys820Glu) rs56082113
NM_007294.3(BRCA1):c.2465A>G (p.Asn822Ser) rs1555589630
NM_007294.3(BRCA1):c.2466T>C (p.Asn822=) rs1064794701
NM_007294.3(BRCA1):c.2468G>C (p.Arg823Thr) rs876659731
NM_007294.3(BRCA1):c.2468G>T (p.Arg823Ile) rs876659731
NM_007294.3(BRCA1):c.2470A>C (p.Asn824His) rs1555589617
NM_007294.3(BRCA1):c.2471A>G (p.Asn824Ser) rs1485586275
NM_007294.3(BRCA1):c.2472T>C (p.Asn824=) rs786201415
NM_007294.3(BRCA1):c.2473G>T (p.Asp825Tyr) rs80357328
NM_007294.3(BRCA1):c.2475delC (p.Asp825Glufs) rs80357970
NM_007294.3(BRCA1):c.2477C>A (p.Thr826Lys) rs28897683
NM_007294.3(BRCA1):c.247G>A (p.Val83Ile)
NM_007294.3(BRCA1):c.2481A>C (p.Glu827Asp) rs397508970
NM_007294.3(BRCA1):c.2481A>G (p.Glu827=) rs397508970
NM_007294.3(BRCA1):c.2482G>A (p.Gly828Ser) rs80357185
NM_007294.3(BRCA1):c.2483_2485delGCT (p.Gly828_Phe829delinsVal) rs80358331
NM_007294.3(BRCA1):c.2488A>T (p.Lys830Ter) rs1555589569
NM_007294.3(BRCA1):c.248_250delTTG (p.Val83del) rs876660423
NM_007294.3(BRCA1):c.2496A>T (p.Pro832=) rs767666029
NM_007294.3(BRCA1):c.2500G>C (p.Gly834Arg) rs786202215
NM_007294.3(BRCA1):c.2501G>A (p.Gly834Glu) rs757383244
NM_007294.3(BRCA1):c.2501G>T (p.Gly834Val) rs757383244
NM_007294.3(BRCA1):c.2503C>T (p.His835Tyr) rs751656678
NM_007294.3(BRCA1):c.2504dup (p.His835Glnfs) rs1555589513
NM_007294.3(BRCA1):c.250G>T (p.Glu84Ter) rs398122661
NM_007294.3(BRCA1):c.2515delC (p.His839Thrfs) rs80357607
NM_007294.3(BRCA1):c.2518A>C (p.Ser840Arg) rs377475866
NM_007294.3(BRCA1):c.2518A>G (p.Ser840Gly) rs377475866
NM_007294.3(BRCA1):c.2518A>T (p.Ser840Cys) rs377475866
NM_007294.3(BRCA1):c.2521C>T (p.Arg841Trp) rs1800709
NM_007294.3(BRCA1):c.2522G>A (p.Arg841Gln) rs80357337
NM_007294.3(BRCA1):c.2522G>C (p.Arg841Pro) rs80357337
NM_007294.3(BRCA1):c.2523G>A (p.Arg841=) rs773013395
NM_007294.3(BRCA1):c.2524G>A (p.Glu842Lys) rs876658552
NM_007294.3(BRCA1):c.2525A>G (p.Glu842Gly) rs28897684
NM_007294.3(BRCA1):c.2528C>G (p.Thr843Arg) rs1555589466
NM_007294.3(BRCA1):c.2531G>A (p.Ser844Asn)
NM_007294.3(BRCA1):c.2534T>C (p.Ile845Thr) rs397508976
NM_007294.3(BRCA1):c.2535A>C (p.Ile845=) rs876660248
NM_007294.3(BRCA1):c.2536G>A (p.Glu846Lys) rs786203523
NM_007294.3(BRCA1):c.2539A>G (p.Met847Val) rs1555589446
NM_007294.3(BRCA1):c.2545G>T (p.Glu849Ter) rs80356951
NM_007294.3(BRCA1):c.2546A>G (p.Glu849Gly)
NM_007294.3(BRCA1):c.2548delA (p.Ser850Valfs) rs1555589434
NM_007294.3(BRCA1):c.2551G>A (p.Glu851Lys) rs398122662
NM_007294.3(BRCA1):c.2551G>T (p.Glu851Ter) rs398122662
NM_007294.3(BRCA1):c.2552A>G (p.Glu851Gly)
NM_007294.3(BRCA1):c.2555T>C (p.Leu852Pro) rs1555589415
NM_007294.3(BRCA1):c.2556T>C (p.Leu852=) rs1555589414
NM_007294.3(BRCA1):c.255G>A (p.Glu85=) rs756499058
NM_007294.3(BRCA1):c.255G>T (p.Glu85Asp) rs756499058
NM_007294.3(BRCA1):c.2560_2561dupGC (p.Gln855Leufs) rs80357968
NM_007294.3(BRCA1):c.2561_2565delCTCAG (p.Ala854Valfs) rs397508981
NM_007294.3(BRCA1):c.2563C>T (p.Gln855Ter) rs80357131
NM_007294.3(BRCA1):c.2564A>C (p.Gln855Pro) rs768001441
NM_007294.3(BRCA1):c.2564A>T (p.Gln855Leu) rs768001441
NM_007294.3(BRCA1):c.2566T>C (p.Tyr856His) rs80356892
NM_007294.3(BRCA1):c.2569T>C (p.Leu857=) rs779895958
NM_007294.3(BRCA1):c.2574G>A (p.Gln858=) rs1555589357
NM_007294.3(BRCA1):c.2575A>G (p.Asn859Asp) rs1555589354
NM_007294.3(BRCA1):c.2580A>C (p.Thr860=) rs556684572
NM_007294.3(BRCA1):c.2580A>G (p.Thr860=) rs556684572
NM_007294.3(BRCA1):c.2582T>G (p.Phe861Cys) rs80357098
NM_007294.3(BRCA1):c.2583C>T (p.Phe861=) rs1555589334
NM_007294.3(BRCA1):c.2584A>G (p.Lys862Glu) rs80356927
NM_007294.3(BRCA1):c.2586G>C (p.Lys862Asn) rs1555589330
NM_007294.3(BRCA1):c.2587G>A (p.Val863Ile) rs1555589325
NM_007294.3(BRCA1):c.258A>G (p.Leu86=) rs777491912
NM_007294.3(BRCA1):c.258A>T (p.Leu86=) rs777491912
NM_007294.3(BRCA1):c.2590T>G (p.Ser864Ala) rs80357285
NM_007294.3(BRCA1):c.2591C>G (p.Ser864Ter) rs80357003
NM_007294.3(BRCA1):c.2591C>T (p.Ser864Leu) rs80357003
NM_007294.3(BRCA1):c.2593A>T (p.Lys865Ter) rs587782628
NM_007294.3(BRCA1):c.2594delA (p.Lys865Serfs) rs80357756
NM_007294.3(BRCA1):c.2596C>T (p.Arg866Cys) rs41286300
NM_007294.3(BRCA1):c.2597G>A (p.Arg866His) rs80356911
NM_007294.3(BRCA1):c.259T>C (p.Leu87=) rs80357091
NM_007294.3(BRCA1):c.259T>G (p.Leu87Val) rs80357091
NM_007294.3(BRCA1):c.25G>C (p.Glu9Gln)
NM_007294.3(BRCA1):c.2601G>A (p.Gln867=) rs876659166
NM_007294.3(BRCA1):c.2603C>G (p.Ser868Ter) rs80356925
NM_007294.3(BRCA1):c.2604A>C (p.Ser868=) rs864622491
NM_007294.3(BRCA1):c.2609C>G (p.Ala870Gly) rs1060502324
NM_007294.3(BRCA1):c.2612C>G (p.Pro871Arg) rs799917
NM_007294.3(BRCA1):c.2612C>T (p.Pro871Leu) rs799917
NM_007294.3(BRCA1):c.2612delCinsTT (p.Pro871Leufs) rs397508986
NM_007294.3(BRCA1):c.2613G>A (p.Pro871=) rs587782608
NM_007294.3(BRCA1):c.2618C>T (p.Ser873Leu)
NM_007294.3(BRCA1):c.2620A>C (p.Asn874His) rs1064795862
NM_007294.3(BRCA1):c.2621delA (p.Asn874Ilefs) rs587781423
NM_007294.3(BRCA1):c.2623C>T (p.Pro875Ser)
NM_007294.3(BRCA1):c.2625A>G (p.Pro875=) rs754222140
NM_007294.3(BRCA1):c.2625A>T (p.Pro875=) rs754222140
NM_007294.3(BRCA1):c.2626G>A (p.Gly876Arg)
NM_007294.3(BRCA1):c.2630A>G (p.Asn877Ser) rs786203689
NM_007294.3(BRCA1):c.2633C>T (p.Ala878Val) rs1555589255
NM_007294.3(BRCA1):c.2634A>G (p.Ala878=) rs730881451
NM_007294.3(BRCA1):c.2635G>T (p.Glu879Ter) rs80357251
NM_007294.3(BRCA1):c.2638G>C (p.Glu880Gln) rs587782370
NM_007294.3(BRCA1):c.2641G>T (p.Glu881Ter) rs397508988
NM_007294.3(BRCA1):c.2644T>C (p.Cys882Arg) rs184374817
NM_007294.3(BRCA1):c.2645G>A (p.Cys882Tyr) rs1555589241
NM_007294.3(BRCA1):c.2654dupT (p.Ser886Leufs) rs398122663
NM_007294.3(BRCA1):c.2657C>G (p.Ser886Cys) rs587782134
NM_007294.3(BRCA1):c.2657_2658delCT (p.Ser886Cysfs) rs397508990
NM_007294.3(BRCA1):c.2662C>T (p.His888Tyr) rs80357480
NM_007294.3(BRCA1):c.2663A>C (p.His888Pro) rs876658843
NM_007294.3(BRCA1):c.2663A>G (p.His888Arg) rs876658843
NM_007294.3(BRCA1):c.2663A>T (p.His888Leu) rs876658843
NM_007294.3(BRCA1):c.2666C>T (p.Ser889Phe) rs769712441
NM_007294.3(BRCA1):c.2666dupC (p.Gly890Trpfs) rs876660425
NM_007294.3(BRCA1):c.2668G>A (p.Gly890Arg) rs80357200
NM_007294.3(BRCA1):c.2669G>T (p.Gly890Val) rs80356874
NM_007294.3(BRCA1):c.266T>C (p.Ile89Thr) rs80357097
NM_007294.3(BRCA1):c.2670G>T (p.Gly890=) rs786201677
NM_007294.3(BRCA1):c.2674T>C (p.Leu892=) rs137998759
NM_007294.3(BRCA1):c.2679G>A (p.Lys893=) rs587781771
NM_007294.3(BRCA1):c.2679G>T (p.Lys893Asn) rs587781771
NM_007294.3(BRCA1):c.2679_2682delGAAA (p.Lys893Asnfs) rs80357596
NM_007294.3(BRCA1):c.267C>G (p.Ile89Met) rs80356963
NM_007294.3(BRCA1):c.2680A>T (p.Lys894Ter) rs876659457
NM_007294.3(BRCA1):c.2681_2682delAA (p.Lys894Thrfs) rs80357971
NM_007294.3(BRCA1):c.2682A>T (p.Lys894Asn) rs1131692093
NM_007294.3(BRCA1):c.2683C>T (p.Gln895Ter) rs397508997
NM_007294.3(BRCA1):c.2684A>G (p.Gln895Arg) rs587781914
NM_007294.3(BRCA1):c.2685_2686delAA (p.Pro897Lysfs) rs80357636
NM_007294.3(BRCA1):c.2686A>T (p.Ser896Cys) rs80357188
NM_007294.3(BRCA1):c.2686dupA (p.Ser896Lysfs) rs80357636
NM_007294.3(BRCA1):c.2687_2693delGTCCAAA (p.Ser896Lysfs) rs886040062
NM_007294.3(BRCA1):c.268A>G (p.Ile90Val) rs1555596673
NM_007294.3(BRCA1):c.2690C>T (p.Pro897Leu) rs587776484
NM_007294.3(BRCA1):c.2702T>C (p.Phe901Ser) rs397507202
NM_007294.3(BRCA1):c.2706A>C (p.Glu902Asp) rs398122665
NM_007294.3(BRCA1):c.2706A>G (p.Glu902=) rs398122665
NM_007294.3(BRCA1):c.2706_2707dupAT (p.Cys903Tyrfs) rs80357717
NM_007294.3(BRCA1):c.2707T>C (p.Cys903Arg) rs1555589103
NM_007294.3(BRCA1):c.2710G>C (p.Glu904Gln) rs80357035
NM_007294.3(BRCA1):c.2712A>G (p.Glu904=) rs1057522242
NM_007294.3(BRCA1):c.2716A>C (p.Lys906Gln)
NM_007294.3(BRCA1):c.2716_2730del15 (p.Lys906_Gln910del) rs755789142
NM_007294.3(BRCA1):c.2717delA (p.Lys906Argfs) rs876659072
NM_007294.3(BRCA1):c.2719G>T (p.Glu907Ter) rs876658593
NM_007294.3(BRCA1):c.2719_2722delGAAG (p.Glu907Lysfs) rs80357731
NM_007294.3(BRCA1):c.271T>C (p.Cys91Arg) rs786203939
NM_007294.3(BRCA1):c.2720A>G (p.Glu907Gly) rs1555589078
NM_007294.3(BRCA1):c.2721A>G (p.Glu907=)
NM_007294.3(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.3(BRCA1):c.2723A>C (p.Glu908Ala) rs1064794969
NM_007294.3(BRCA1):c.2724A>C (p.Glu908Asp) rs1350643283
NM_007294.3(BRCA1):c.2726A>T (p.Asn909Ile) rs80357127
NM_007294.3(BRCA1):c.2727_2730delTCAA (p.Asn909Lysfs) rs80357605
NM_007294.3(BRCA1):c.2728delC (p.Gln910Lysfs) rs397509005
NM_007294.3(BRCA1):c.2732G>A (p.Gly911Glu) rs431825392
NM_007294.3(BRCA1):c.2733A>G (p.Gly911=) rs1800740
NM_007294.3(BRCA1):c.2735A>G (p.Lys912Arg) rs397507204
NM_007294.3(BRCA1):c.2736G>C (p.Lys912Asn) rs1555589046
NM_007294.3(BRCA1):c.2736G>T (p.Lys912Asn)
NM_007294.3(BRCA1):c.2738A>G (p.Asn913Ser) rs199954851
NM_007294.3(BRCA1):c.2739T>A (p.Asn913Lys) rs273899688
NM_007294.3(BRCA1):c.2739T>C (p.Asn913=) rs273899688
NM_007294.3(BRCA1):c.273_274delTG (p.Ala92Phefs) rs587776485
NM_007294.3(BRCA1):c.2740G>A (p.Glu914Lys) rs80357419
NM_007294.3(BRCA1):c.2740G>T (p.Glu914Ter) rs80357419
NM_007294.3(BRCA1):c.2742G>A (p.Glu914=) rs961042365
NM_007294.3(BRCA1):c.2744_2745delCT (p.Ser915Terfs) rs80357540
NM_007294.3(BRCA1):c.2745T>G (p.Ser915=) rs876658748
NM_007294.3(BRCA1):c.2746A>G (p.Asn916Asp) rs398122666
NM_007294.3(BRCA1):c.2747A>G (p.Asn916Ser) rs864622588
NM_007294.3(BRCA1):c.2747A>T (p.Asn916Ile) rs864622588
NM_007294.3(BRCA1):c.274G>C (p.Ala92Pro) rs863224755
NM_007294.3(BRCA1):c.2750T>C (p.Ile917Thr) rs587781492
NM_007294.3(BRCA1):c.2752A>C (p.Lys918Gln) rs397509010
NM_007294.3(BRCA1):c.2753_2755delAGCinsCA (p.Lys918Thrfs) rs886040069
NM_007294.3(BRCA1):c.2757T>C (p.Pro919=) rs755516286
NM_007294.3(BRCA1):c.2758G>A (p.Val920Ile) rs80357361
NM_007294.3(BRCA1):c.2761C>T (p.Gln921Ter) rs80357377
NM_007294.3(BRCA1):c.2762delA (p.Gln921Argfs) rs80357703
NM_007294.3(BRCA1):c.2763G>A (p.Gln921=) rs1057522511
NM_007294.3(BRCA1):c.2764A>G (p.Thr922Ala) rs1555588988
NM_007294.3(BRCA1):c.2764_2767delACAG (p.Thr922Leufs) rs80357822
NM_007294.3(BRCA1):c.2765C>G (p.Thr922Arg) rs80357460
NM_007294.3(BRCA1):c.2765C>T (p.Thr922Ile) rs80357460
NM_007294.3(BRCA1):c.2766delA (p.Val923Leufs) rs80357812
NM_007294.3(BRCA1):c.2767_2770delGTTA (p.Val923Ilefs) rs80357661
NM_007294.3(BRCA1):c.2773A>C (p.Ile925Leu) rs4986847
NM_007294.3(BRCA1):c.2773A>G (p.Ile925Val) rs4986847
NM_007294.3(BRCA1):c.2775C>T (p.Ile925=) rs786201104
NM_007294.3(BRCA1):c.2783G>A (p.Gly928Asp) rs202004680
NM_007294.3(BRCA1):c.2790T>C (p.Pro930=) rs876659151
NM_007294.3(BRCA1):c.2791G>A (p.Val931Met)
NM_007294.3(BRCA1):c.2791G>T (p.Val931Leu) rs763639161
NM_007294.3(BRCA1):c.2793G>A (p.Val931=) rs876660555
NM_007294.3(BRCA1):c.2796delT (p.Gly933Valfs) rs1555588942
NM_007294.3(BRCA1):c.2798G>A (p.Gly933Asp) rs80356941
NM_007294.3(BRCA1):c.2798G>C (p.Gly933Ala) rs80356941
NM_007294.3(BRCA1):c.2800C>T (p.Gln934Ter) rs80357223
NM_007294.3(BRCA1):c.2806_2809delGATA (p.Asp936Serfs) rs80357832
NM_007294.3(BRCA1):c.2808T>G (p.Asp936Glu) rs730881485
NM_007294.3(BRCA1):c.2811G>A (p.Lys937=) rs876659271
NM_007294.3(BRCA1):c.2814A>C (p.Pro938=) rs80356851
NM_007294.3(BRCA1):c.2814A>G (p.Pro938=) rs80356851
NM_007294.3(BRCA1):c.2816T>C (p.Val939Ala) rs1555588894
NM_007294.3(BRCA1):c.2818G>C (p.Asp940His)
NM_007294.3(BRCA1):c.2818G>T (p.Asp940Tyr) rs80357077
NM_007294.3(BRCA1):c.2820_2830delTAATGCCAAATinsAAGATAAGCCAGTTTGATAA (p.Asp940_Lys1278delinsGluArgTer) rs1555588883
NM_007294.3(BRCA1):c.2822A>G (p.Asn941Ser) rs776512377
NM_007294.3(BRCA1):c.2830T>A (p.Cys944Ser) rs1064795603
NM_007294.3(BRCA1):c.2831G>A (p.Cys944Tyr) rs770769275
NM_007294.3(BRCA1):c.2834_2836delGTA (p.Ser945del) rs80358332
NM_007294.3(BRCA1):c.2834_2836delGTAinsC (p.Ser945Thrfs) rs386134270
NM_007294.3(BRCA1):c.2835dupT (p.Ile946Tyrfs) rs80357519
NM_007294.3(BRCA1):c.2836A>T (p.Ile946Phe) rs876660901
NM_007294.3(BRCA1):c.2840A>G (p.Lys947Arg) rs778118145
NM_007294.3(BRCA1):c.2841A>T (p.Lys947Asn) rs864622618
NM_007294.3(BRCA1):c.2847C>T (p.Gly949=) rs1555588850
NM_007294.3(BRCA1):c.2849C>T (p.Ser950Phe) rs1555588847
NM_007294.3(BRCA1):c.2851A>C (p.Arg951=) rs1347533994
NM_007294.3(BRCA1):c.2857T>C (p.Cys953Arg) rs1555588840
NM_007294.3(BRCA1):c.2860C>T (p.Leu954=) rs730881452
NM_007294.3(BRCA1):c.2862A>C (p.Leu954=) rs559190752
NM_007294.3(BRCA1):c.2862A>G (p.Leu954=) rs559190752
NM_007294.3(BRCA1):c.2864C>A (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2866_2870delTCTCA (p.Ser956Valfs) rs80357819
NM_007294.3(BRCA1):c.286G>A (p.Asp96Asn) rs80357110
NM_007294.3(BRCA1):c.2872T>C (p.Phe958Leu) rs80356878
NM_007294.3(BRCA1):c.2874C>T (p.Phe958=) rs1029207537
NM_007294.3(BRCA1):c.2877A>C (p.Arg959Ser) rs587782743
NM_007294.3(BRCA1):c.2877A>G (p.Arg959=) rs587782743
NM_007294.3(BRCA1):c.2878G>A (p.Gly960Ser) rs1555588796
NM_007294.3(BRCA1):c.2881A>C (p.Asn961His) rs786203786
NM_007294.3(BRCA1):c.2882A>G (p.Asn961Ser) rs879254130
NM_007294.3(BRCA1):c.2883C>T (p.Asn961=) rs201190540
NM_007294.3(BRCA1):c.2884G>A (p.Glu962Lys) rs80356955
NM_007294.3(BRCA1):c.2887delA (p.Thr963Leufs) rs80357559
NM_007294.3(BRCA1):c.2888C>T (p.Thr963Ile) rs730881443
NM_007294.3(BRCA1):c.2889T>C (p.Thr963=) rs876659125
NM_007294.3(BRCA1):c.288C>T (p.Asp96=) rs146085503
NM_007294.3(BRCA1):c.288_292delCACAGinsAACCTGT (p.Asp96Glufs) rs483353091
NM_007294.3(BRCA1):c.2894T>G (p.Leu965Arg) rs876660682
NM_007294.3(BRCA1):c.2895C>T (p.Leu965=) rs1555588774
NM_007294.3(BRCA1):c.2897T>C (p.Ile966Thr) rs879254045
NM_007294.3(BRCA1):c.2898T>C (p.Ile966=) rs786202249
NM_007294.3(BRCA1):c.289A>G (p.Thr97Ala) rs1404795980
NM_007294.3(BRCA1):c.2902_2903insTC (p.Pro968Leufs) rs398122670
NM_007294.3(BRCA1):c.2905A>G (p.Asn969Asp) rs587781641
NM_007294.3(BRCA1):c.2908A>G (p.Lys970Glu)
NM_007294.3(BRCA1):c.2909A>T (p.Lys970Ile) rs756559408
NM_007294.3(BRCA1):c.290C>G (p.Thr97Arg) rs431825393
NM_007294.3(BRCA1):c.2910A>C (p.Lys970Asn) rs431825394
NM_007294.3(BRCA1):c.2910A>G (p.Lys970=) rs431825394
NM_007294.3(BRCA1):c.2911C>G (p.His971Asp) rs80357478
NM_007294.3(BRCA1):c.2912A>G (p.His971Arg)
NM_007294.3(BRCA1):c.2913T>C (p.His971=) rs786203804
NM_007294.3(BRCA1):c.2915G>A (p.Gly972Glu) rs587782721
NM_007294.3(BRCA1):c.2915delG (p.Gly972Aspfs) rs80357573
NM_007294.3(BRCA1):c.2917C>G (p.Leu973Val) rs80357080
NM_007294.3(BRCA1):c.2920T>C (p.Leu974=) rs763845063
NM_007294.3(BRCA1):c.2921T>A (p.Leu974Ter) rs80356872
NM_007294.3(BRCA1):c.2921T>C (p.Leu974Ser) rs80356872
NM_007294.3(BRCA1):c.2923C>T (p.Gln975Ter) rs80357497
NM_007294.3(BRCA1):c.2930C>T (p.Pro977Leu) rs141465583
NM_007294.3(BRCA1):c.2931A>C (p.Pro977=)
NM_007294.3(BRCA1):c.2931A>G (p.Pro977=) rs273899691
NM_007294.3(BRCA1):c.2932T>C (p.Tyr978His) rs876659545
NM_007294.3(BRCA1):c.2933A>G (p.Tyr978Cys) rs863224756
NM_007294.3(BRCA1):c.2934T>G (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934delT (p.Arg979Valfs) rs80357741
NM_007294.3(BRCA1):c.2935C>T (p.Arg979Cys) rs80356970
NM_007294.3(BRCA1):c.2936G>A (p.Arg979His) rs80356985
NM_007294.3(BRCA1):c.2940delA (p.Pro981Hisfs) rs80357876
NM_007294.3(BRCA1):c.2942C>A (p.Pro981Gln) rs876659025
NM_007294.3(BRCA1):c.2947delC (p.Leu983Phefs) rs876659108
NM_007294.3(BRCA1):c.2952dupT (p.Pro985Serfs) rs80357627
NM_007294.3(BRCA1):c.2959A>G (p.Lys987Glu) rs878854941
NM_007294.3(BRCA1):c.2960A>G (p.Lys987Arg) rs876659990
NM_007294.3(BRCA1):c.2960_2964delAGTCA (p.Lys987Ilefs) rs1555588625
NM_007294.3(BRCA1):c.2963C>A (p.Ser988Ter) rs397507206
NM_007294.3(BRCA1):c.2963C>T (p.Ser988Leu) rs397507206
NM_007294.3(BRCA1):c.2967T>A (p.Phe989Leu) rs876659270
NM_007294.3(BRCA1):c.2968G>A (p.Val990Ile) rs397509029
NM_007294.3(BRCA1):c.2969T>C (p.Val990Ala) rs760588785
NM_007294.3(BRCA1):c.2973A>C (p.Lys991Asn) rs876660683
NM_007294.3(BRCA1):c.2973_2979delAACTAAA (p.Lys991Asnfs) rs397509030
NM_007294.3(BRCA1):c.2979A>G (p.Lys993=) rs772854836
NM_007294.3(BRCA1):c.2981G>A (p.Cys994Tyr) rs1238452758
NM_007294.3(BRCA1):c.2981_2982delGT (p.Cys994Terfs) rs397507207
NM_007294.3(BRCA1):c.2985G>A (p.Lys995=) rs1555588591
NM_007294.3(BRCA1):c.2987A>G (p.Lys996Arg) rs786202898
NM_007294.3(BRCA1):c.2989_2990dupAA (p.Asn997Lysfs) rs80357829
NM_007294.3(BRCA1):c.2992C>G (p.Leu998Val) rs876659077
NM_007294.3(BRCA1):c.2993T>A (p.Leu998Gln)
NM_007294.3(BRCA1):c.2995_2996delCTinsTA (p.Leu999Ter) rs273899692
NM_007294.3(BRCA1):c.2996T>G (p.Leu999Arg) rs876659514
NM_007294.3(BRCA1):c.2998G>A (p.Glu1000Lys) rs80357124
NM_007294.3(BRCA1):c.2998_3003delGAGGAA (p.Glu1000_Glu1001del) rs80358333
NM_007294.3(BRCA1):c.2T>G (p.Met1Arg) rs80357111
NM_007294.3(BRCA1):c.3000G>C (p.Glu1000Asp)
NM_007294.3(BRCA1):c.3003A>G (p.Glu1001=) rs774644946
NM_007294.3(BRCA1):c.3004A>G (p.Asn1002Asp) rs786202665
NM_007294.3(BRCA1):c.3005delA (p.Asn1002Thrfs) rs80357601
NM_007294.3(BRCA1):c.3008_3009delTT (p.Phe1003Terfs) rs80357617
NM_007294.3(BRCA1):c.3009T>C (p.Phe1003=) rs786201587
NM_007294.3(BRCA1):c.301+10G>A rs80358001
NM_007294.3(BRCA1):c.301+12A>C rs863224757
NM_007294.3(BRCA1):c.301+1G>A rs587782173
NM_007294.3(BRCA1):c.301+1G>C rs587782173
NM_007294.3(BRCA1):c.301+1G>T rs587782173
NM_007294.3(BRCA1):c.301+3A>G
NM_007294.3(BRCA1):c.301+4dup rs1555596630
NM_007294.3(BRCA1):c.301+6T>C rs753859240
NM_007294.3(BRCA1):c.301+7G>A rs80358113
NM_007294.3(BRCA1):c.301+8T>C rs80358101
NM_007294.3(BRCA1):c.3010G>C (p.Glu1004Gln) rs786202534
NM_007294.3(BRCA1):c.3012G>A (p.Glu1004=) rs786201784
NM_007294.3(BRCA1):c.3013delG (p.Glu1005Asnfs) rs80357937
NM_007294.3(BRCA1):c.3018_3021delTTCA (p.His1006Glnfs) rs80357749
NM_007294.3(BRCA1):c.301T>C (p.Tyr101His) rs1555596637
NM_007294.3(BRCA1):c.302-10T>A rs747733248
NM_007294.3(BRCA1):c.302-10T>C rs747733248
NM_007294.3(BRCA1):c.302-15C>G rs1057520871
NM_007294.3(BRCA1):c.302-167T>C rs869312509
NM_007294.3(BRCA1):c.302-1G>T rs80358116
NM_007294.3(BRCA1):c.302-22T>C
NM_007294.3(BRCA1):c.302-23A>G rs781404807
NM_007294.3(BRCA1):c.302-24_302-22delAAT rs756577139
NM_007294.3(BRCA1):c.302-2A>G rs80358011
NM_007294.3(BRCA1):c.302-2delA rs273899695
NM_007294.3(BRCA1):c.302-3C>G rs80358051
NM_007294.3(BRCA1):c.302-5T>A rs778668665
NM_007294.3(BRCA1):c.302-5T>C rs778668665
NM_007294.3(BRCA1):c.302-70G>A rs147809611
NM_007294.3(BRCA1):c.302-9A>G rs1389128798
NM_007294.3(BRCA1):c.3022A>C (p.Met1008Leu) rs56321129
NM_007294.3(BRCA1):c.3022A>G (p.Met1008Val) rs56321129
NM_007294.3(BRCA1):c.3024G>A (p.Met1008Ile) rs1800704
NM_007294.3(BRCA1):c.3029_3030delCT (p.Pro1010Argfs) rs80357510
NM_007294.3(BRCA1):c.302A>G (p.Tyr101Cys) rs587781798
NM_007294.3(BRCA1):c.3030T>G (p.Pro1010=) rs876660048
NM_007294.3(BRCA1):c.3031G>A (p.Glu1011Lys) rs876659974
NM_007294.3(BRCA1):c.3034A>G (p.Arg1012Gly) rs1555588503
NM_007294.3(BRCA1):c.3035G>A (p.Arg1012Lys) rs876658464
NM_007294.3(BRCA1):c.303T>G (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.3040A>T (p.Met1014Leu) rs80356933
NM_007294.3(BRCA1):c.3041T>A (p.Met1014Lys) rs80357020
NM_007294.3(BRCA1):c.3041T>C (p.Met1014Thr) rs80357020
NM_007294.3(BRCA1):c.3044dupG (p.Asn1016Lysfs) rs80357746
NM_007294.3(BRCA1):c.3046A>G (p.Asn1016Asp) rs80357154
NM_007294.3(BRCA1):c.3048T>G (p.Asn1016Lys) rs879255482
NM_007294.3(BRCA1):c.3048_3052dupTGAGA (p.Asn1018Metfs) rs80357856
NM_007294.3(BRCA1):c.3049G>T (p.Glu1017Ter) rs80357004
NM_007294.3(BRCA1):c.304G>A (p.Ala102Thr) rs1555596491
NM_007294.3(BRCA1):c.3053A>G (p.Asn1018Ser)
NM_007294.3(BRCA1):c.3054C>T (p.Asn1018=) rs1429701835
NM_007294.3(BRCA1):c.3055A>G (p.Ile1019Val) rs80357311
NM_007294.3(BRCA1):c.305C>G (p.Ala102Gly) rs80357190
NM_007294.3(BRCA1):c.3060A>G (p.Pro1020=) rs781435355
NM_007294.3(BRCA1):c.3062delG (p.Ser1021Ilefs) rs1135401857
NM_007294.3(BRCA1):c.3065C>T (p.Thr1022Ile) rs786202070
NM_007294.3(BRCA1):c.3066A>T (p.Thr1022=) rs1555588441
NM_007294.3(BRCA1):c.3066delA (p.Val1023Terfs) rs786202906
NM_007294.3(BRCA1):c.3071G>A (p.Ser1024Asn) rs757579891
NM_007294.3(BRCA1):c.3075A>C (p.Thr1025=) rs786201258
NM_007294.3(BRCA1):c.3082C>T (p.Arg1028Cys) rs80357049
NM_007294.3(BRCA1):c.3083G>A (p.Arg1028His) rs80357459
NM_007294.3(BRCA1):c.3083G>T (p.Arg1028Leu) rs80357459
NM_007294.3(BRCA1):c.3083delG (p.Arg1028Leufs) rs1484076591
NM_007294.3(BRCA1):c.3084_3094delTAATAACATTA (p.Asn1029Argfs) rs80357647
NM_007294.3(BRCA1):c.3086A>G (p.Asn1029Ser)
NM_007294.3(BRCA1):c.3090C>T (p.Asn1030=) rs1221088119
NM_007294.3(BRCA1):c.3091A>G (p.Ile1031Val) rs786203979
NM_007294.3(BRCA1):c.3091A>T (p.Ile1031Phe) rs786203979
NM_007294.3(BRCA1):c.3092T>G (p.Ile1031Ser) rs863224758
NM_007294.3(BRCA1):c.3093T>A (p.Ile1031=) rs786204265
NM_007294.3(BRCA1):c.3097G>A (p.Glu1033Lys) rs273899698
NM_007294.3(BRCA1):c.3097G>T (p.Glu1033Ter) rs273899698
NM_007294.3(BRCA1):c.309C>T (p.Asn103=) rs876659814
NM_007294.3(BRCA1):c.3108dupT (p.Lys1037Terfs) rs80357841
NM_007294.3(BRCA1):c.3112G>T (p.Glu1038Ter) rs80357161
NM_007294.3(BRCA1):c.3113A>C (p.Glu1038Ala) rs16941
NM_007294.3(BRCA1):c.3113A>G (p.Glu1038Gly) rs16941
NM_007294.3(BRCA1):c.3116C>T (p.Ala1039Val)
NM_007294.3(BRCA1):c.3119G>A (p.Ser1040Asn) rs4986852
NM_007294.3(BRCA1):c.3127A>C (p.Asn1043His) rs587782630
NM_007294.3(BRCA1):c.3127A>G (p.Asn1043Asp) rs587782630
NM_007294.3(BRCA1):c.3128A>C (p.Asn1043Thr)
NM_007294.3(BRCA1):c.3130A>G (p.Ile1044Val) rs80357271
NM_007294.3(BRCA1):c.3132T>G (p.Ile1044Met) rs1555588333
NM_007294.3(BRCA1):c.3134A>G (p.Asn1045Ser) rs1555588330
NM_007294.3(BRCA1):c.3136G>C (p.Glu1046Gln) rs1555588329
NM_007294.3(BRCA1):c.3139_3180del42 (p.Val1047_Glu1060del) rs876660145
NM_007294.3(BRCA1):c.3143G>A (p.Gly1048Asp) rs80356899
NM_007294.3(BRCA1):c.3143G>T (p.Gly1048Val) rs80356899
NM_007294.3(BRCA1):c.3143delG (p.Gly1048Valfs) rs886040100
NM_007294.3(BRCA1):c.314A>G (p.Tyr105Cys) rs28897673
NM_007294.3(BRCA1):c.3150T>G (p.Ser1050Arg) rs1555588305
NM_007294.3(BRCA1):c.3151A>G (p.Thr1051Ala) rs398122671
NM_007294.3(BRCA1):c.3152C>T (p.Thr1051Ile) rs397509039
NM_007294.3(BRCA1):c.3153T>C (p.Thr1051=) rs1057521053
NM_007294.3(BRCA1):c.3154A>G (p.Asn1052Asp) rs768995134
NM_007294.3(BRCA1):c.3155A>G (p.Asn1052Ser) rs398122672
NM_007294.3(BRCA1):c.3157G>T (p.Glu1053Ter) rs786203587
NM_007294.3(BRCA1):c.3159A>C (p.Glu1053Asp)
NM_007294.3(BRCA1):c.3160G>A (p.Val1054Met) rs876658479
NM_007294.3(BRCA1):c.3163G>A (p.Gly1055Ser)
NM_007294.3(BRCA1):c.3165C>T (p.Gly1055=) rs1399306338
NM_007294.3(BRCA1):c.3166T>C (p.Ser1056Pro) rs876659601
NM_007294.3(BRCA1):c.3167C>G (p.Ser1056Cys) rs587781588
NM_007294.3(BRCA1):c.3167C>T (p.Ser1056Phe) rs587781588
NM_007294.3(BRCA1):c.3169A>C (p.Ser1057Arg) rs80357479
NM_007294.3(BRCA1):c.3169A>G (p.Ser1057Gly) rs80357479
NM_007294.3(BRCA1):c.316A>C (p.Asn106His) rs786202937
NM_007294.3(BRCA1):c.3170G>A (p.Ser1057Asn) rs587776487
NM_007294.3(BRCA1):c.3171T>C (p.Ser1057=) rs746394738
NM_007294.3(BRCA1):c.3172A>G (p.Ile1058Val) rs1064795478
NM_007294.3(BRCA1):c.3178G>T (p.Glu1060Ter) rs80357424
NM_007294.3(BRCA1):c.3179A>C (p.Glu1060Ala) rs80357184
NM_007294.3(BRCA1):c.3181A>C (p.Ile1061Leu) rs876658975
NM_007294.3(BRCA1):c.3181A>G (p.Ile1061Val) rs876658975
NM_007294.3(BRCA1):c.3184G>A (p.Gly1062Ser)
NM_007294.3(BRCA1):c.3185G>T (p.Gly1062Val) rs397507211
NM_007294.3(BRCA1):c.3190A>T (p.Ser1064Cys) rs273899702
NM_007294.3(BRCA1):c.3193dupG (p.Asp1065Glyfs) rs80357511
NM_007294.3(BRCA1):c.3195T>G (p.Asp1065Glu)
NM_007294.3(BRCA1):c.3196G>T (p.Glu1066Ter) rs1555588220
NM_007294.3(BRCA1):c.3207A>T (p.Gln1069His)
NM_007294.3(BRCA1):c.3211G>A (p.Glu1071Lys) rs41293445
NM_007294.3(BRCA1):c.3218G>A (p.Gly1073Asp)
NM_007294.3(BRCA1):c.321delT (p.Phe107Leufs) rs80357544
NM_007294.3(BRCA1):c.3220A>G (p.Arg1074Gly) rs80357263
NM_007294.3(BRCA1):c.3221G>C (p.Arg1074Thr) rs786202155
NM_007294.3(BRCA1):c.3225C>G (p.Asn1075Lys) rs778607600
NM_007294.3(BRCA1):c.3227G>T (p.Arg1076Ile) rs80357313
NM_007294.3(BRCA1):c.3228_3229delAG (p.Gly1077Alafs) rs80357635
NM_007294.3(BRCA1):c.3230G>A (p.Gly1077Glu)
NM_007294.3(BRCA1):c.3231G>A (p.Gly1077=)
NM_007294.3(BRCA1):c.3234A>G (p.Pro1078=) rs876660522
NM_007294.3(BRCA1):c.3237A>G (p.Lys1079=) rs1555588126
NM_007294.3(BRCA1):c.3238T>C (p.Leu1080=) rs754597283
NM_007294.3(BRCA1):c.3241A>G (p.Asn1081Asp) rs876659928
NM_007294.3(BRCA1):c.3243T>C (p.Asn1081=) rs876659805
NM_007294.3(BRCA1):c.3245C>T (p.Ala1082Val) rs1555588115
NM_007294.3(BRCA1):c.3247A>C (p.Met1083Leu) rs397507213
NM_007294.3(BRCA1):c.3247A>G (p.Met1083Val) rs397507213
NM_007294.3(BRCA1):c.3248T>C (p.Met1083Thr) rs786203958
NM_007294.3(BRCA1):c.3252T>G (p.Leu1084=)
NM_007294.3(BRCA1):c.3253A>T (p.Arg1085Ter) rs1432504119
NM_007294.3(BRCA1):c.3254_3255dupGA (p.Leu1086Aspfs) rs80357624
NM_007294.3(BRCA1):c.3257T>A (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3257T>G (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.325A>G (p.Lys109Glu) rs1555596474
NM_007294.3(BRCA1):c.3260G>C (p.Gly1087Ala) rs80357172
NM_007294.3(BRCA1):c.3267G>T (p.Leu1089Phe) rs767544239
NM_007294.3(BRCA1):c.3270A>G (p.Gln1090=) rs369925993
NM_007294.3(BRCA1):c.3270A>T (p.Gln1090His) rs369925993
NM_007294.3(BRCA1):c.3274G>A (p.Glu1092Lys) rs876658360
NM_007294.3(BRCA1):c.3276G>T (p.Glu1092Asp) rs764458412
NM_007294.3(BRCA1):c.3277G>T (p.Val1093Phe) rs587778117
NM_007294.3(BRCA1):c.3279C>G (p.Val1093=)
NM_007294.3(BRCA1):c.3279delC (p.Tyr1094Ilefs) rs397509050
NM_007294.3(BRCA1):c.3285delA (p.Lys1095Asnfs) rs397509051
NM_007294.3(BRCA1):c.3286C>A (p.Gln1096Lys) rs80357485
NM_007294.3(BRCA1):c.3286C>T (p.Gln1096Ter) rs80357485
NM_007294.3(BRCA1):c.3286delC (p.Gln1096Lysfs) rs80357533
NM_007294.3(BRCA1):c.3287A>G (p.Gln1096Arg) rs273899704
NM_007294.3(BRCA1):c.3288_3289delAA (p.Leu1098Serfs) rs80357686
NM_007294.3(BRCA1):c.3289A>T (p.Ser1097Cys) rs587782864
NM_007294.3(BRCA1):c.3289dupA (p.Ser1097Lysfs) rs80357686
NM_007294.3(BRCA1):c.3292_3293delCT (p.Leu1098Serfs) rs80357992
NM_007294.3(BRCA1):c.3294delT (p.Pro1099Leufs) rs876658626
NM_007294.3(BRCA1):c.3296C>T (p.Pro1099Leu) rs80357201
NM_007294.3(BRCA1):c.3296delC (p.Pro1099Leufs) rs80357815
NM_007294.3(BRCA1):c.3298G>A (p.Gly1100Arg) rs1555587999
NM_007294.3(BRCA1):c.329_330delAG (p.Lys110Argfs) rs80357754
NM_007294.3(BRCA1):c.329dupA (p.Glu111Glyfs) rs80357604
NM_007294.3(BRCA1):c.32T>G (p.Val11Gly) rs80357017
NM_007294.3(BRCA1):c.3302G>A (p.Ser1101Asn) rs41293447
NM_007294.3(BRCA1):c.3302_3305delGTAA (p.Ser1101Ilefs) rs1555587992
NM_007294.3(BRCA1):c.3305A>G (p.Asn1102Ser) rs80356900
NM_007294.3(BRCA1):c.3306T>C (p.Asn1102=) rs876658664
NM_007294.3(BRCA1):c.3308G>T (p.Cys1103Phe) rs80357135
NM_007294.3(BRCA1):c.3312G>A (p.Lys1104=) rs876659024
NM_007294.3(BRCA1):c.3316C>T (p.Pro1106Ser)
NM_007294.3(BRCA1):c.3319G>T (p.Glu1107Ter) rs80357106
NM_007294.3(BRCA1):c.3323_3324delTA (p.Ile1108Lysfs) rs786202791
NM_007294.3(BRCA1):c.3326_3329delAAAA (p.Lys1109Serfs) rs80357575
NM_007294.3(BRCA1):c.3327A>C (p.Lys1109Asn) rs41293449
NM_007294.3(BRCA1):c.3327_3329delAAA (p.Lys1110del) rs80357575
NM_007294.3(BRCA1):c.3328_3330delAAG (p.Lys1110del) rs80358335
NM_007294.3(BRCA1):c.3329delA (p.Lys1110Serfs) rs80357575
NM_007294.3(BRCA1):c.3329dupA (p.Gln1111Alafs) rs80357575
NM_007294.3(BRCA1):c.3331_3334delCAAG (p.Gln1111Asnfs) rs80357701
NM_007294.3(BRCA1):c.3333delA (p.Glu1112Asnfs) rs80357966
NM_007294.3(BRCA1):c.3339T>C (p.Tyr1113=) rs80357421
NM_007294.3(BRCA1):c.3342_3345delAGAA (p.Glu1115Terfs) rs397509058
NM_007294.3(BRCA1):c.3344_3346delAAG (p.Glu1115del) rs80358336
NM_007294.3(BRCA1):c.3344_3346dupAAG (p.Glu1115_Val1116insGlu) rs80358336
NM_007294.3(BRCA1):c.3345A>C (p.Glu1115Asp) rs876658243
NM_007294.3(BRCA1):c.3346G>C (p.Val1116Leu) rs55909400
NM_007294.3(BRCA1):c.3347T>G (p.Val1116Gly) rs786203153
NM_007294.3(BRCA1):c.334A>G (p.Asn112Asp) rs587782017
NM_007294.3(BRCA1):c.3352C>T (p.Gln1118Ter) rs397507215
NM_007294.3(BRCA1):c.3354G>A (p.Gln1118=)
NM_007294.3(BRCA1):c.3354G>T (p.Gln1118His) rs80357334
NM_007294.3(BRCA1):c.3355A>T (p.Thr1119Ser) rs80356949
NM_007294.3(BRCA1):c.3357T>C (p.Thr1119=) rs772383323
NM_007294.3(BRCA1):c.3358G>A (p.Val1120Ile) rs748894760
NM_007294.3(BRCA1):c.3358_3359delGT (p.Val1120Terfs) rs80357945
NM_007294.3(BRCA1):c.3359T>A (p.Val1120Asp) rs1361427704
NM_007294.3(BRCA1):c.3359_3360delTT (p.Val1120Glufs) rs80357843
NM_007294.3(BRCA1):c.335_338delATAA (p.Asn112Thrfs) rs587782666
NM_007294.3(BRCA1):c.3361A>C (p.Asn1121His) rs876660526
NM_007294.3(BRCA1):c.3362A>G (p.Asn1121Ser) rs80356919
NM_007294.3(BRCA1):c.3365_3366delCA (p.Thr1122Argfs) rs80357892
NM_007294.3(BRCA1):c.3367G>T (p.Asp1123Tyr) rs80356867
NM_007294.3(BRCA1):c.3372C>T (p.Phe1124=) rs786203431
NM_007294.3(BRCA1):c.3373T>C (p.Ser1125Pro) rs1555587839
NM_007294.3(BRCA1):c.3377C>T (p.Pro1126Leu) rs80356887
NM_007294.3(BRCA1):c.3379T>C (p.Tyr1127His) rs1451089848
NM_007294.3(BRCA1):c.3383T>C (p.Leu1128Pro) rs1555587827
NM_007294.3(BRCA1):c.3392A>T (p.Asp1131Val) rs1555587813
NM_007294.3(BRCA1):c.3392_3393delATinsTA (p.Asp1131Val) rs786203428
NM_007294.3(BRCA1):c.3394A>G (p.Asn1132Asp) rs530464947
NM_007294.3(BRCA1):c.3398T>C (p.Leu1133Ser) rs80356971
NM_007294.3(BRCA1):c.339C>G (p.Asn113Lys) rs587779367
NM_007294.3(BRCA1):c.33A>G (p.Val11=) rs1555601010
NM_007294.3(BRCA1):c.3400G>A (p.Glu1134Lys) rs80357018
NM_007294.3(BRCA1):c.3400G>T (p.Glu1134Ter) rs80357018
NM_007294.3(BRCA1):c.3401A>T (p.Glu1134Val) rs762744684
NM_007294.3(BRCA1):c.3403C>G (p.Gln1135Glu) rs80357136
NM_007294.3(BRCA1):c.3403C>T (p.Gln1135Ter) rs80357136
NM_007294.3(BRCA1):c.3406C>A (p.Pro1136Thr) rs431825395
NM_007294.3(BRCA1):c.3407C>G (p.Pro1136Arg) rs80357329
NM_007294.3(BRCA1):c.3409A>G (p.Met1137Val) rs771479616
NM_007294.3(BRCA1):c.3410T>C (p.Met1137Thr) rs80357297
NM_007294.3(BRCA1):c.3411G>A (p.Met1137Ile) rs786202900
NM_007294.3(BRCA1):c.3415A>C (p.Ser1139Arg) rs587781765
NM_007294.3(BRCA1):c.3416G>T (p.Ser1139Ile) rs80357228
NM_007294.3(BRCA1):c.3418A>C (p.Ser1140Arg) rs2227945
NM_007294.3(BRCA1):c.3418A>G (p.Ser1140Gly) rs2227945
NM_007294.3(BRCA1):c.3418_3420delAGT (p.Ser1140del) rs80358337
NM_007294.3(BRCA1):c.341C>G (p.Ser114Cys) rs786202620
NM_007294.3(BRCA1):c.3421C>T (p.His1141Tyr) rs1555587727
NM_007294.3(BRCA1):c.3423T>C (p.His1141=) rs863224419
NM_007294.3(BRCA1):c.3424G>C (p.Ala1142Pro) rs80357101
NM_007294.3(BRCA1):c.3425C>T (p.Ala1142Val) rs1555587711
NM_007294.3(BRCA1):c.3428C>G (p.Ser1143Cys) rs80357434
NM_007294.3(BRCA1):c.342delT (p.Pro115Leufs) rs886040129
NM_007294.3(BRCA1):c.3432G>A (p.Gln1144=) rs80356922
NM_007294.3(BRCA1):c.3433G>A (p.Val1145Ile) rs431825396
NM_007294.3(BRCA1):c.3433G>T (p.Val1145Phe) rs431825396
NM_007294.3(BRCA1):c.3435T>C (p.Val1145=) rs786201222
NM_007294.3(BRCA1):c.3436T>G (p.Cys1146Gly)
NM_007294.3(BRCA1):c.3436_3439delTGTT (p.Cys1146Leufs) rs397509067
NM_007294.3(BRCA1):c.3437G>A (p.Cys1146Tyr) rs80357247
NM_007294.3(BRCA1):c.3438T>C (p.Cys1146=) rs1555587693
NM_007294.3(BRCA1):c.343C>T (p.Pro115Ser) rs1468589409
NM_007294.3(BRCA1):c.3440C>A (p.Ser1147Tyr) rs876660757
NM_007294.3(BRCA1):c.3442delG (p.Glu1148Argfs) rs80357808
NM_007294.3(BRCA1):c.3448C>T (p.Pro1150Ser) rs80357272
NM_007294.3(BRCA1):c.3449C>T (p.Pro1150Leu) rs587782752
NM_007294.3(BRCA1):c.344C>T (p.Pro115Leu) rs876659528
NM_007294.3(BRCA1):c.3454G>A (p.Asp1152Asn) rs80357175
NM_007294.3(BRCA1):c.3457C>G (p.Leu1153Val) rs1555587658
NM_007294.3(BRCA1):c.3462A>G (p.Leu1154=) rs876659048
NM_007294.3(BRCA1):c.3463G>C (p.Asp1155His) rs80357484
NM_007294.3(BRCA1):c.346delG (p.Glu116Asnfs) rs762635795
NM_007294.3(BRCA1):c.3470G>C (p.Gly1157Ala) rs876659133
NM_007294.3(BRCA1):c.3472G>T (p.Glu1158Ter) rs397509072
NM_007294.3(BRCA1):c.3474A>G (p.Glu1158=)
NM_007294.3(BRCA1):c.3475A>G (p.Ile1159Val) rs876658318
NM_007294.3(BRCA1):c.3477_3480delAAAG (p.Ile1159Metfs) rs80357781
NM_007294.3(BRCA1):c.3478_3487delAAGGAAGATA (p.Lys1160Leufs) rs786203694
NM_007294.3(BRCA1):c.3481G>T (p.Glu1161Ter) rs786203438
NM_007294.3(BRCA1):c.3481_3491delGAAGATACTAG (p.Glu1161Phefs) rs80357877
NM_007294.3(BRCA1):c.3484G>T (p.Asp1162Tyr) rs1555587619
NM_007294.3(BRCA1):c.3485delA (p.Asp1162Valfs) rs80357509
NM_007294.3(BRCA1):c.3486T>C (p.Asp1162=) rs1555587617
NM_007294.3(BRCA1):c.3487A>G (p.Thr1163Ala) rs769456095
NM_007294.3(BRCA1):c.3491G>T (p.Ser1164Ile) rs397509075
NM_007294.3(BRCA1):c.3498T>C (p.Ala1166=) rs1298897645
NM_007294.3(BRCA1):c.349C>T (p.His117Tyr) rs1042173379
NM_007294.3(BRCA1):c.3504T>G (p.Asn1168Lys)
NM_007294.3(BRCA1):c.3505G>T (p.Asp1169Tyr) rs876659269
NM_007294.3(BRCA1):c.3508A>G (p.Ile1170Val) rs273899708
NM_007294.3(BRCA1):c.3511A>G (p.Lys1171Glu) rs730882164
NM_007294.3(BRCA1):c.3511A>T (p.Lys1171Ter) rs730882164
NM_007294.3(BRCA1):c.3513G>A (p.Lys1171=) rs786202844
NM_007294.3(BRCA1):c.3514G>T (p.Glu1172Ter) rs397509079
NM_007294.3(BRCA1):c.3515A>G (p.Glu1172Gly) rs80357206
NM_007294.3(BRCA1):c.3524_3526delCTG (p.Ala1175del) rs1555587557
NM_007294.3(BRCA1):c.352C>G (p.Leu118Val) rs876659315
NM_007294.3(BRCA1):c.3533G>A (p.Ser1178Asn) rs1294360179
NM_007294.3(BRCA1):c.3533G>C (p.Ser1178Thr) rs1294360179
NM_007294.3(BRCA1):c.3535A>C (p.Lys1179Gln) rs587782188
NM_007294.3(BRCA1):c.3540C>T (p.Ser1180=) rs928545955
NM_007294.3(BRCA1):c.3541G>A (p.Val1181Ile) rs56336919
NM_007294.3(BRCA1):c.3545A>T (p.Gln1182Leu) rs1555587532
NM_007294.3(BRCA1):c.3548A>G (p.Lys1183Arg) rs16942
NM_007294.3(BRCA1):c.3548A>T (p.Lys1183Ile) rs16942
NM_007294.3(BRCA1):c.3551G>A (p.Gly1184Glu)
NM_007294.3(BRCA1):c.3555G>T (p.Glu1185Asp) rs587779368
NM_007294.3(BRCA1):c.3560G>A (p.Ser1187Asn) rs80356975
NM_007294.3(BRCA1):c.3561C>T (p.Ser1187=) rs1555587501
NM_007294.3(BRCA1):c.3569C>T (p.Pro1190Leu) rs755209182
NM_007294.3(BRCA1):c.3569delC (p.Pro1190Leufs) rs1555587497
NM_007294.3(BRCA1):c.3572G>A (p.Ser1191Asn) rs878854948
NM_007294.3(BRCA1):c.3576T>C (p.Pro1192=) rs766447664
NM_007294.3(BRCA1):c.3579_3580insT (p.Thr1194Tyrfs) rs587782824
NM_007294.3(BRCA1):c.3581C>T (p.Thr1194Ile) rs80357290
NM_007294.3(BRCA1):c.3582C>T (p.Thr1194=) rs786202722
NM_007294.3(BRCA1):c.3582_3589delCCATACAC (p.His1195Phefs) rs886040146
NM_007294.3(BRCA1):c.3583C>T (p.His1195Tyr) rs876659903
NM_007294.3(BRCA1):c.3584A>G (p.His1195Arg) rs28897685
NM_007294.3(BRCA1):c.3586A>T (p.Thr1196Ser) rs1340335862
NM_007294.3(BRCA1):c.3587C>A (p.Thr1196Lys) rs80356944
NM_007294.3(BRCA1):c.3587C>T (p.Thr1196Ile) rs80356944
NM_007294.3(BRCA1):c.3588A>C (p.Thr1196=) rs876658595
NM_007294.3(BRCA1):c.3588A>G (p.Thr1196=) rs876658595
NM_007294.3(BRCA1):c.358G>A (p.Asp120Asn) rs587782882
NM_007294.3(BRCA1):c.3592_3593dupTT (p.Leu1198Phefs) rs80357562
NM_007294.3(BRCA1):c.3596C>T (p.Ala1199Val) rs587782458
NM_007294.3(BRCA1):c.3597T>A (p.Ala1199=) rs1555587434
NM_007294.3(BRCA1):c.3598C>T (p.Gln1200Ter) rs62625307
NM_007294.3(BRCA1):c.3599_3600delAG (p.Gln1200Argfs) rs398122674
NM_007294.3(BRCA1):c.359A>G (p.Asp120Gly) rs587781491
NM_007294.3(BRCA1):c.35A>G (p.Gln12Arg) rs1555601006
NM_007294.3(BRCA1):c.3600G>C (p.Gln1200His) rs56214134
NM_007294.3(BRCA1):c.3600G>T (p.Gln1200His) rs56214134
NM_007294.3(BRCA1):c.3601G>A (p.Gly1201Ser) rs55725337
NM_007294.3(BRCA1):c.3601G>C (p.Gly1201Arg) rs55725337
NM_007294.3(BRCA1):c.3602G>A (p.Gly1201Asp)
NM_007294.3(BRCA1):c.3607C>T (p.Arg1203Ter) rs62625308
NM_007294.3(BRCA1):c.3608G>A (p.Arg1203Gln) rs55930959
NM_007294.3(BRCA1):c.3611G>C (p.Arg1204Thr) rs1456509049
NM_007294.3(BRCA1):c.3612A>G (p.Arg1204=) rs537737635
NM_007294.3(BRCA1):c.3612delA (p.Ala1206Profs) rs80357980
NM_007294.3(BRCA1):c.3613G>A (p.Gly1205Arg) rs80357294
NM_007294.3(BRCA1):c.3615G>A (p.Gly1205=) rs750113197
NM_007294.3(BRCA1):c.3616G>T (p.Ala1206Ser) rs1555587407
NM_007294.3(BRCA1):c.3621_3622delGAinsAG (p.Lys1208Glu)
NM_007294.3(BRCA1):c.3624dupA (p.Leu1209Ilefs) rs80357512
NM_007294.3(BRCA1):c.3625T>G (p.Leu1209Val) rs273900711
NM_007294.3(BRCA1):c.3626T>G (p.Leu1209Ter) rs786203884
NM_007294.3(BRCA1):c.3626delT (p.Leu1209Terfs) rs80357571
NM_007294.3(BRCA1):c.3627A>G (p.Leu1209=) rs770579978
NM_007294.3(BRCA1):c.3627dupA (p.Glu1210Argfs) rs80357729
NM_007294.3(BRCA1):c.3629_3630delAG (p.Glu1210Valfs) rs80357589
NM_007294.3(BRCA1):c.3632C>G (p.Ser1211Cys) rs1555587377
NM_007294.3(BRCA1):c.3636A>G (p.Ser1212=) rs148038877
NM_007294.3(BRCA1):c.3636A>T (p.Ser1212=) rs148038877
NM_007294.3(BRCA1):c.3637delG (p.Glu1213Lysfs) rs1555587365
NM_007294.3(BRCA1):c.3640G>A (p.Glu1214Lys) rs80356923
NM_007294.3(BRCA1):c.3640G>T (p.Glu1214Ter) rs80356923
NM_007294.3(BRCA1):c.3640_3644delGAGAA (p.Glu1214Leufs) rs1555587356
NM_007294.3(BRCA1):c.3642_3643delGA (p.Asn1215Leufs) rs80357805
NM_007294.3(BRCA1):c.3644A>G (p.Asn1215Ser) rs786203310
NM_007294.3(BRCA1):c.3647T>A (p.Leu1216Ter) rs397509091
NM_007294.3(BRCA1):c.3648dupA (p.Ser1217Ilefs) rs80357902
NM_007294.3(BRCA1):c.3649T>C (p.Ser1217Pro) rs273900712
NM_007294.3(BRCA1):c.3652A>G (p.Ser1218Gly) rs80356894
NM_007294.3(BRCA1):c.3655G>A (p.Glu1219Lys) rs80356921
NM_007294.3(BRCA1):c.3657G>A (p.Glu1219=) rs80356876
NM_007294.3(BRCA1):c.3657G>C (p.Glu1219Asp) rs80356876
NM_007294.3(BRCA1):c.3658delG (p.Asp1220Metfs) rs786202963
NM_007294.3(BRCA1):c.3659A>T (p.Asp1220Val) rs766572561
NM_007294.3(BRCA1):c.3661G>T (p.Glu1221Ter) rs80357310
NM_007294.3(BRCA1):c.3662A>C (p.Glu1221Ala) rs273900713
NM_007294.3(BRCA1):c.3664G>T (p.Glu1222Ter) rs80357356
NM_007294.3(BRCA1):c.3664_3666delGAG (p.Glu1222del) rs587781779
NM_007294.3(BRCA1):c.3666G>C (p.Glu1222Asp) rs1555587312
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.366T>G (p.Val122=) rs190900046
NM_007294.3(BRCA1):c.3672delC (p.Cys1225Alafs) rs398122677
NM_007294.3(BRCA1):c.3675C>A (p.Cys1225Ter) rs879254023
NM_007294.3(BRCA1):c.3681A>T (p.Gln1227His) rs730881488
NM_007294.3(BRCA1):c.3683delA (p.His1228Profs) rs397507217
NM_007294.3(BRCA1):c.3684C>T (p.His1228=) rs786201623
NM_007294.3(BRCA1):c.3688T>C (p.Leu1230=) rs786201581
NM_007294.3(BRCA1):c.3689T>G (p.Leu1230Ter) rs80357162
NM_007294.3(BRCA1):c.3691T>C (p.Phe1231Leu) rs41293451
NM_007294.3(BRCA1):c.3699A>G (p.Lys1233=) rs368690455
NM_007294.3(BRCA1):c.369T>A (p.Ser123=) rs774583925
NM_007294.3(BRCA1):c.36A>G (p.Gln12=) rs763230080
NM_007294.3(BRCA1):c.3700G>C (p.Val1234Leu) rs763354142
NM_007294.3(BRCA1):c.3700_3704delGTAAA (p.Val1234Glnfs) rs80357609
NM_007294.3(BRCA1):c.3702A>G (p.Val1234=) rs587780862
NM_007294.3(BRCA1):c.3705_3747dup (p.Glu1250Glnfs) rs797044631
NM_007294.3(BRCA1):c.3706A>G (p.Asn1236Asp)
NM_007294.3(BRCA1):c.3706_3713delAATATACC (p.Asn1236Phefs) rs80357552
NM_007294.3(BRCA1):c.3707A>G (p.Asn1236Ser) rs863224760
NM_007294.3(BRCA1):c.3708T>G (p.Asn1236Lys) rs28897687
NM_007294.3(BRCA1):c.370A>G (p.Ile124Val) rs80357448
NM_007294.3(BRCA1):c.3710T>C (p.Ile1237Thr) rs876660883
NM_007294.3(BRCA1):c.3710delT (p.Ile1237Asnfs) rs80357564
NM_007294.3(BRCA1):c.3711A>G (p.Ile1237Met) rs80357388
NM_007294.3(BRCA1):c.3712C>T (p.Pro1238Ser) rs876659772
NM_007294.3(BRCA1):c.3713C>G (p.Pro1238Arg) rs28897688
NM_007294.3(BRCA1):c.3713C>T (p.Pro1238Leu) rs28897688
NM_007294.3(BRCA1):c.3717T>A (p.Ser1239=) rs730881453
NM_007294.3(BRCA1):c.3718C>T (p.Gln1240Ter) rs80356903
NM_007294.3(BRCA1):c.3720G>A (p.Gln1240=) rs876658341
NM_007294.3(BRCA1):c.3722C>A (p.Ser1241Tyr) rs80357143
NM_007294.3(BRCA1):c.3722_3740del19 (p.Ser1241Leufs) rs80359882
NM_007294.3(BRCA1):c.3724A>G (p.Thr1242Ala) rs80357037
NM_007294.3(BRCA1):c.3726T>C (p.Thr1242=) rs1060504567
NM_007294.3(BRCA1):c.372C>A (p.Ile124=) rs273900715
NM_007294.3(BRCA1):c.3734G>A (p.Ser1245Asn) rs1060502348
NM_007294.3(BRCA1):c.3736A>G (p.Thr1246Ala) rs587776488
NM_007294.3(BRCA1):c.3737C>A (p.Thr1246Asn) rs878854949
NM_007294.3(BRCA1):c.3738C>T (p.Thr1246=) rs778655093
NM_007294.3(BRCA1):c.3739G>A (p.Val1247Ile) rs80357191
NM_007294.3(BRCA1):c.373A>G (p.Ile125Val) rs587776489
NM_007294.3(BRCA1):c.3744T>A (p.Ala1248=) rs1555587190
NM_007294.3(BRCA1):c.3746C>G (p.Thr1249Ser) rs80357099
NM_007294.3(BRCA1):c.3747C>T (p.Thr1249=) rs587780801
NM_007294.3(BRCA1):c.3748G>A (p.Glu1250Lys) rs28897686
NM_007294.3(BRCA1):c.3748G>T (p.Glu1250Ter) rs28897686
NM_007294.3(BRCA1):c.3750G>A (p.Glu1250=) rs145903082
NM_007294.3(BRCA1):c.3750G>C (p.Glu1250Asp) rs145903082
NM_007294.3(BRCA1):c.3753T>G (p.Cys1251Trp)
NM_007294.3(BRCA1):c.3755T>C (p.Leu1252Pro) rs1555587147
NM_007294.3(BRCA1):c.3756G>C (p.Leu1252=) rs752122039
NM_007294.3(BRCA1):c.3756_3759delGTCT (p.Ser1253Argfs) rs80357868
NM_007294.3(BRCA1):c.3758C>G (p.Ser1253Cys) rs397509100
NM_007294.3(BRCA1):c.3759T>G (p.Ser1253=) rs80356852
NM_007294.3(BRCA1):c.3759_3760delTA (p.Lys1254Glufs) rs80357520
NM_007294.3(BRCA1):c.3759dupT (p.Lys1254Terfs) rs80357687
NM_007294.3(BRCA1):c.375C>T (p.Ile125=)
NM_007294.3(BRCA1):c.3760A>G (p.Lys1254Glu) rs80357362
NM_007294.3(BRCA1):c.3761_3762insTT (p.Lys1254Asnfs) rs80357928
NM_007294.3(BRCA1):c.3764dupA (p.Asn1255Lysfs) rs80357848
NM_007294.3(BRCA1):c.3767_3768delCA (p.Thr1256Argfs) rs730881440
NM_007294.3(BRCA1):c.3768A>G (p.Thr1256=) rs786202803
NM_007294.3(BRCA1):c.376C>T (p.Gln126Ter) rs1085307902
NM_007294.3(BRCA1):c.3770_3771delAG (p.Glu1257Glyfs) rs80357579
NM_007294.3(BRCA1):c.3771_3772delGGinsC (p.Glu1257Aspfs) rs397507218
NM_007294.3(BRCA1):c.3772_3774delGAG (p.Glu1258del) rs1057517536
NM_007294.3(BRCA1):c.3776A>C (p.Asn1259Thr) rs483353090
NM_007294.3(BRCA1):c.3778T>G (p.Leu1260Val) rs1555587079
NM_007294.3(BRCA1):c.3779delT (p.Leu1260Tyrfs) rs80357798
NM_007294.3(BRCA1):c.3782T>C (p.Leu1261Ser) rs397507219
NM_007294.3(BRCA1):c.3783A>G (p.Leu1261=) rs80356831
NM_007294.3(BRCA1):c.3784T>C (p.Ser1262Pro) rs1011096937
NM_007294.3(BRCA1):c.3785_3787delCAT (p.Ser1262del) rs1555587043
NM_007294.3(BRCA1):c.3787T>C (p.Leu1263=) rs1057523961
NM_007294.3(BRCA1):c.378A>G (p.Gln126=) rs786201256
NM_007294.3(BRCA1):c.3793A>C (p.Asn1265His) rs1060502364
NM_007294.3(BRCA1):c.3797G>C (p.Ser1266Thr) rs80357160
NM_007294.3(BRCA1):c.3797G>T (p.Ser1266Ile) rs80357160
NM_007294.3(BRCA1):c.3798C>A (p.Ser1266Arg) rs200648498
NM_007294.3(BRCA1):c.37_40delAATG (p.Asn13Serfs) rs80357530
NM_007294.3(BRCA1):c.3800T>C (p.Leu1267Ser) rs587782190
NM_007294.3(BRCA1):c.3804T>C (p.Asn1268=) rs140588714
NM_007294.3(BRCA1):c.3804T>G (p.Asn1268Lys) rs140588714
NM_007294.3(BRCA1):c.3807C>G (p.Asp1269Glu) rs786202569
NM_007294.3(BRCA1):c.3807C>T (p.Asp1269=) rs786202569
NM_007294.3(BRCA1):c.380G>A (p.Ser127Asn) rs80357189
NM_007294.3(BRCA1):c.380G>T (p.Ser127Ile) rs80357189
NM_007294.3(BRCA1):c.3815A>G (p.Asn1272Ser) rs772703445
NM_007294.3(BRCA1):c.3816C>A (p.Asn1272Lys) rs786201893
NM_007294.3(BRCA1):c.3817C>T (p.Gln1273Ter) rs80357208
NM_007294.3(BRCA1):c.3818A>G (p.Gln1273Arg) rs431825400
NM_007294.3(BRCA1):c.3822A>C (p.Val1274=) rs372396487
NM_007294.3(BRCA1):c.3823A>G (p.Ile1275Val) rs80357280
NM_007294.3(BRCA1):c.3826T>C (p.Leu1276=) rs876659178
NM_007294.3(BRCA1):c.3833delA (p.Lys1278Argfs) rs1135401868
NM_007294.3(BRCA1):c.3834G>A (p.Lys1278=) rs876660942
NM_007294.3(BRCA1):c.3835G>A (p.Ala1279Thr) rs80357036
NM_007294.3(BRCA1):c.3835G>C (p.Ala1279Pro)
NM_007294.3(BRCA1):c.3835G>T (p.Ala1279Ser) rs80357036
NM_007294.3(BRCA1):c.3838T>C (p.Ser1280Pro)
NM_007294.3(BRCA1):c.3839_3843delCTCAGinsAGGC (p.Ser1280Terfs) rs273900717
NM_007294.3(BRCA1):c.3841C>T (p.Gln1281Ter) rs80356866
NM_007294.3(BRCA1):c.3842A>C (p.Gln1281Pro) rs80357483
NM_007294.3(BRCA1):c.3845A>T (p.Glu1282Val) rs80357217
NM_007294.3(BRCA1):c.3846A>G (p.Glu1282=) rs1555586947
NM_007294.3(BRCA1):c.3847C>T (p.His1283Tyr) rs1555586946
NM_007294.3(BRCA1):c.3848A>G (p.His1283Arg) rs80357047
NM_007294.3(BRCA1):c.3849T>C (p.His1283=)
NM_007294.3(BRCA1):c.3857G>C (p.Ser1286Thr) rs142383077
NM_007294.3(BRCA1):c.3858_3861delTGAG (p.Ser1286Argfs) rs80357842
NM_007294.3(BRCA1):c.3862G>C (p.Glu1288Gln) rs876659708
NM_007294.3(BRCA1):c.3868A>G (p.Lys1290Glu) rs80357254
NM_007294.3(BRCA1):c.3869_3870delAA (p.Lys1290Metfs) rs80357918
NM_007294.3(BRCA1):c.386G>T (p.Gly129Val) rs764231119
NM_007294.3(BRCA1):c.3870_3877delATGTTCTG (p.Lys1290Asnfs) rs1555586879
NM_007294.3(BRCA1):c.3874T>C (p.Ser1292Pro) rs786203823
NM_007294.3(BRCA1):c.3874delT (p.Ser1292Leufs) rs587780802
NM_007294.3(BRCA1):c.3875C>A (p.Ser1292Tyr) rs876658340
NM_007294.3(BRCA1):c.3877G>C (p.Ala1293Pro) rs397507223
NM_007294.3(BRCA1):c.3878C>T (p.Ala1293Val) rs80357213
NM_007294.3(BRCA1):c.3887T>G (p.Phe1296Cys) rs1555586855
NM_007294.3(BRCA1):c.3889T>A (p.Ser1297Thr) rs1450793674
NM_007294.3(BRCA1):c.3889T>C (p.Ser1297Pro) rs1450793674
NM_007294.3(BRCA1):c.3893C>A (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3895C>T (p.Gln1299Ter) rs80357038
NM_007294.3(BRCA1):c.3896A>G (p.Gln1299Arg) rs876660866
NM_007294.3(BRCA1):c.3897G>A (p.Gln1299=) rs398122678
NM_007294.3(BRCA1):c.3897G>T (p.Gln1299His) rs398122678
NM_007294.3(BRCA1):c.389A>T (p.Tyr130Phe) rs56055578
NM_007294.3(BRCA1):c.389_391delACAinsTCT (p.Tyr130_Arg131delinsPheTer) rs1064793054
NM_007294.3(BRCA1):c.3901A>G (p.Ser1301Gly) rs786203580
NM_007294.3(BRCA1):c.3901A>T (p.Ser1301Cys) rs786203580
NM_007294.3(BRCA1):c.3902G>A (p.Ser1301Asn) rs1057519496
NM_007294.3(BRCA1):c.3903T>A (p.Ser1301Arg) rs273900719
NM_007294.3(BRCA1):c.3904G>A (p.Glu1302Lys) rs80357461
NM_007294.3(BRCA1):c.3904G>T (p.Glu1302Ter) rs80357461
NM_007294.3(BRCA1):c.3906A>T (p.Glu1302Asp)
NM_007294.3(BRCA1):c.3908dupT (p.Leu1303Phefs) rs80357634
NM_007294.3(BRCA1):c.390C>A (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.3913G>C (p.Asp1305His) rs1555586799
NM_007294.3(BRCA1):c.3914A>T (p.Asp1305Val) rs431825402
NM_007294.3(BRCA1):c.3916_3917delTT (p.Leu1306Aspfs) rs80357678
NM_007294.3(BRCA1):c.3918G>C (p.Leu1306Phe) rs786202068
NM_007294.3(BRCA1):c.391A>T (p.Arg131Ter) rs80357207
NM_007294.3(BRCA1):c.3929C>A (p.Thr1310Lys) rs80357257
NM_007294.3(BRCA1):c.3930A>C (p.Thr1310=) rs1555586780
NM_007294.3(BRCA1):c.3931_3934dupAACA (p.Thr1312Lysfs) rs80357864
NM_007294.3(BRCA1):c.3935C>G (p.Thr1312Ser) rs1555586769
NM_007294.3(BRCA1):c.3936C>T (p.Thr1312=) rs753210219
NM_007294.3(BRCA1):c.3937C>T (p.Gln1313Ter) rs80357318
NM_007294.3(BRCA1):c.3941A>T (p.Asp1314Val) rs759916956
NM_007294.3(BRCA1):c.3944C>G (p.Pro1315Arg) rs80357500
NM_007294.3(BRCA1):c.3952A>G (p.Ile1318Val) rs397509121
NM_007294.3(BRCA1):c.3953T>C (p.Ile1318Thr) rs1388475291
NM_007294.3(BRCA1):c.3956G>A (p.Gly1319Asp) rs587782634
NM_007294.3(BRCA1):c.3962C>A (p.Ser1321Tyr) rs386833394
NM_007294.3(BRCA1):c.3964A>C (p.Lys1322Gln) rs80357343
NM_007294.3(BRCA1):c.3964A>G (p.Lys1322Glu) rs80357343
NM_007294.3(BRCA1):c.3964A>T (p.Lys1322Ter) rs80357343
NM_007294.3(BRCA1):c.3965A>C (p.Lys1322Thr) rs80357042
NM_007294.3(BRCA1):c.3965A>G (p.Lys1322Arg) rs80357042
NM_007294.3(BRCA1):c.3965A>T (p.Lys1322Ile) rs80357042
NM_007294.3(BRCA1):c.3967C>T (p.Gln1323Ter) rs80357262
NM_007294.3(BRCA1):c.3967delC (p.Gln1323Lysfs) rs397509122
NM_007294.3(BRCA1):c.3968_3971delAAAT (p.Gln1323Argfs) rs886040181
NM_007294.3(BRCA1):c.3969A>T (p.Gln1323His) rs876660410
NM_007294.3(BRCA1):c.3969_3970delAA (p.Gln1323Hisfs) rs587782834
NM_007294.3(BRCA1):c.396C>A (p.Asn132Lys) rs80357413
NM_007294.3(BRCA1):c.3970A>T (p.Met1324Leu) rs587782241
NM_007294.3(BRCA1):c.3974G>A (p.Arg1325Lys) rs921253348
NM_007294.3(BRCA1):c.3975G>A (p.Arg1325=) rs761424661
NM_007294.3(BRCA1):c.3979C>T (p.Gln1327Ter) rs876659720
NM_007294.3(BRCA1):c.397C>T (p.Arg133Cys) rs80357457
NM_007294.3(BRCA1):c.3980A>G (p.Gln1327Arg) rs730881444
NM_007294.3(BRCA1):c.3985G>A (p.Glu1329Lys) rs876659467
NM_007294.3(BRCA1):c.398G>A (p.Arg133His) rs80357357
NM_007294.3(BRCA1):c.3990C>T (p.Ser1330=) rs876660808
NM_007294.3(BRCA1):c.3993G>A (p.Gln1331=) rs70953658
NM_007294.3(BRCA1):c.3995G>T (p.Gly1332Val) rs730881490
NM_007294.3(BRCA1):c.3995_4001delGAGTTGG (p.Gly1332Valfs) rs886040185
NM_007294.3(BRCA1):c.3998T>C (p.Val1333Ala) rs1135401872
NM_007294.3(BRCA1):c.399T>C (p.Arg133=) rs1555596341
NM_007294.3(BRCA1):c.3G>A (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.3G>T (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.4002T>C (p.Gly1334=) rs1131692083
NM_007294.3(BRCA1):c.4006A>T (p.Ser1336Cys) rs976725810
NM_007294.3(BRCA1):c.4015G>T (p.Glu1339Ter) rs80357021
NM_007294.3(BRCA1):c.4016A>G (p.Glu1339Gly) rs886039313
NM_007294.3(BRCA1):c.4018T>C (p.Leu1340=) rs786201646
NM_007294.3(BRCA1):c.4020G>T (p.Leu1340Phe) rs1555586637
NM_007294.3(BRCA1):c.4021G>A (p.Val1341Ile) rs762908108
NM_007294.3(BRCA1):c.4026A>C (p.Ser1342=) rs80356828
NM_007294.3(BRCA1):c.4027G>T (p.Asp1343Tyr) rs1160287128
NM_007294.3(BRCA1):c.4028A>T (p.Asp1343Val) rs775339017
NM_007294.3(BRCA1):c.4031A>G (p.Asp1344Gly) rs55639854
NM_007294.3(BRCA1):c.4035delA (p.Glu1346Lysfs) rs80357711
NM_007294.3(BRCA1):c.4036G>A (p.Glu1346Lys) rs80357407
NM_007294.3(BRCA1):c.4038_4041delAAGA (p.Arg1347Glufs) rs431825404
NM_007294.3(BRCA1):c.4039A>G (p.Arg1347Gly) rs28897689
NM_007294.3(BRCA1):c.4039A>T (p.Arg1347Ter) rs28897689
NM_007294.3(BRCA1):c.4041_4042delAG (p.Gly1348Asnfs) rs80357727
NM_007294.3(BRCA1):c.4046C>G (p.Thr1349Arg) rs80357345
NM_007294.3(BRCA1):c.4046C>T (p.Thr1349Met) rs80357345
NM_007294.3(BRCA1):c.4047G>A (p.Thr1349=) rs758515222
NM_007294.3(BRCA1):c.4048G>T (p.Gly1350Cys) rs748674194
NM_007294.3(BRCA1):c.4050C>T (p.Gly1350=) rs779507799
NM_007294.3(BRCA1):c.4054G>A (p.Glu1352Lys) rs80357202
NM_007294.3(BRCA1):c.4054G>C (p.Glu1352Gln) rs80357202
NM_007294.3(BRCA1):c.4063A>G (p.Asn1355Asp) rs876660530
NM_007294.3(BRCA1):c.4063_4065delAAT (p.Asn1355del) rs80358341
NM_007294.3(BRCA1):c.4064A>G (p.Asn1355Ser)
NM_007294.3(BRCA1):c.4065_4068delTCAA (p.Asn1355Lysfs) rs80357508
NM_007294.3(BRCA1):c.406dupA (p.Arg136Lysfs) rs80357709
NM_007294.3(BRCA1):c.4071A>G (p.Glu1357=) rs786201475
NM_007294.3(BRCA1):c.4071A>T (p.Glu1357Asp) rs786201475
NM_007294.3(BRCA1):c.4072G>A (p.Glu1358Lys) rs397509136
NM_007294.3(BRCA1):c.4072G>T (p.Glu1358Ter) rs397509136
NM_007294.3(BRCA1):c.4073A>G (p.Glu1358Gly) rs397507225
NM_007294.3(BRCA1):c.4075C>G (p.Gln1359Glu) rs80357456
NM_007294.3(BRCA1):c.4081A>C (p.Met1361Leu) rs80357218
NM_007294.3(BRCA1):c.4081A>G (p.Met1361Val) rs80357218
NM_007294.3(BRCA1):c.4083G>A (p.Met1361Ile) rs374192364
NM_007294.3(BRCA1):c.4088C>A (p.Ser1363Ter) rs398122680
NM_007294.3(BRCA1):c.4088C>T (p.Ser1363Leu) rs398122680
NM_007294.3(BRCA1):c.4092C>T (p.Asn1364=) rs786201566
NM_007294.3(BRCA1):c.4096+15T>C
NM_007294.3(BRCA1):c.4096+1G>A rs80358178
NM_007294.3(BRCA1):c.4096+3A>G rs80358015
NM_007294.3(BRCA1):c.4096G>A (p.Gly1366Ser) rs431825405
NM_007294.3(BRCA1):c.4096G>C (p.Gly1366Arg) rs431825405
NM_007294.3(BRCA1):c.4097-10G>A rs80358057
NM_007294.3(BRCA1):c.4097-11T>C rs80358072
NM_007294.3(BRCA1):c.4097-16G>A rs1555586303
NM_007294.3(BRCA1):c.4097-20C>T rs80358169
NM_007294.3(BRCA1):c.4097-5T>G
NM_007294.3(BRCA1):c.4097-6T>C rs1555586284
NM_007294.3(BRCA1):c.4097G>A (p.Gly1366Asp) rs876660948
NM_007294.3(BRCA1):c.4099G>T (p.Glu1367Ter) rs786202998
NM_007294.3(BRCA1):c.4107A>G (p.Ala1369=) rs1555586263
NM_007294.3(BRCA1):c.4111G>A (p.Gly1371Arg)
NM_007294.3(BRCA1):c.4111G>C (p.Gly1371Arg) rs774593602
NM_007294.3(BRCA1):c.4113G>A (p.Gly1371=) rs147448807
NM_007294.3(BRCA1):c.4113delG (p.Cys1372Valfs) rs80357861
NM_007294.3(BRCA1):c.4115G>A (p.Cys1372Tyr) rs55848034
NM_007294.3(BRCA1):c.4117G>T (p.Glu1373Ter) rs80357259
NM_007294.3(BRCA1):c.411dup (p.Leu138Serfs) rs886040205
NM_007294.3(BRCA1):c.4120_4121delAG (p.Ser1374Terfs) rs80357787
NM_007294.3(BRCA1):c.4123G>A (p.Glu1375Lys) rs80357397
NM_007294.3(BRCA1):c.4127C>G (p.Thr1376Arg) rs80356986
NM_007294.3(BRCA1):c.4128_4129delAA (p.Ser1377Argfs) rs80357921
NM_007294.3(BRCA1):c.4129A>G (p.Ser1377Gly) rs730881491
NM_007294.3(BRCA1):c.412C>G (p.Leu138Val) rs587782724
NM_007294.3(BRCA1):c.4130G>A (p.Ser1377Asn)
NM_007294.3(BRCA1):c.4131C>A (p.Ser1377Arg) rs80356871
NM_007294.3(BRCA1):c.4131C>T (p.Ser1377=) rs80356871
NM_007294.3(BRCA1):c.4132G>A (p.Val1378Ile) rs28897690
NM_007294.3(BRCA1):c.4132G>T (p.Val1378Phe) rs28897690
NM_007294.3(BRCA1):c.4136_4137delCT (p.Ser1379Terfs) rs397509141
NM_007294.3(BRCA1):c.4137T>C (p.Ser1379=) rs1057521866
NM_007294.3(BRCA1):c.413T>C (p.Leu138Pro) rs200449040
NM_007294.3(BRCA1):c.4143C>G (p.Asp1381Glu)
NM_007294.3(BRCA1):c.4144T>A (p.Cys1382Ser) rs786202106
NM_007294.3(BRCA1):c.4148C>G (p.Ser1383Ter) rs80357071
NM_007294.3(BRCA1):c.4151G>A (p.Gly1384Glu) rs786203545
NM_007294.3(BRCA1):c.4155A>G (p.Leu1385=) rs1057520245
NM_007294.3(BRCA1):c.4158_4162delCTCTC (p.Ser1387Glufs) rs397509142
NM_007294.3(BRCA1):c.4159T>C (p.Ser1387Pro) rs876658221
NM_007294.3(BRCA1):c.415del (p.Gln139Argfs) rs1555596315
NM_007294.3(BRCA1):c.4161_4162delTC (p.Gln1388Glufs) rs80357565
NM_007294.3(BRCA1):c.4162C>T (p.Gln1388Ter) rs876660601
NM_007294.3(BRCA1):c.4165_4166delAG (p.Ser1389Terfs) rs80357572
NM_007294.3(BRCA1):c.4166G>A (p.Ser1389Asn) rs78951648
NM_007294.3(BRCA1):c.416A>G (p.Gln139Arg) rs786202213
NM_007294.3(BRCA1):c.416dupA (p.Ser140Glufs) rs786203432
NM_007294.3(BRCA1):c.4177A>G (p.Thr1393Ala) rs587782870
NM_007294.3(BRCA1):c.4179C>G (p.Thr1393=) rs753735698
NM_007294.3(BRCA1):c.4179C>T (p.Thr1393=) rs753735698
NM_007294.3(BRCA1):c.4181C>T (p.Thr1394Ile) rs397507226
NM_007294.3(BRCA1):c.4182_4183dupTC (p.Gln1395Leufs) rs80357742
NM_007294.3(BRCA1):c.4183C>T (p.Gln1395Ter) rs80357260
NM_007294.3(BRCA1):c.4184A>G (p.Gln1395Arg) rs80356972
NM_007294.3(BRCA1):c.4185+10G>A rs80358104
NM_007294.3(BRCA1):c.4185+10G>C rs80358104
NM_007294.3(BRCA1):c.4185+18G>A
NM_007294.3(BRCA1):c.4185+1G>A rs80358076
NM_007294.3(BRCA1):c.4185+21T>C
NM_007294.3(BRCA1):c.4185+21_4185+22delTG rs273900723
NM_007294.3(BRCA1):c.4185+21_4185+22dupTG rs273900723
NM_007294.3(BRCA1):c.4185+21_4185+38del rs768092833
NM_007294.3(BRCA1):c.4185+24A>C rs763074389
NM_007294.3(BRCA1):c.4185+2_4185+22del21insA rs273900724
NM_007294.3(BRCA1):c.4185+2dup
NM_007294.3(BRCA1):c.4185+3992C>G rs150347361
NM_007294.3(BRCA1):c.4185+9C>T rs80358034
NM_007294.3(BRCA1):c.4185+9_4185+10insTT
NM_007294.3(BRCA1):c.4185G>A (p.Gln1395=) rs80356857
NM_007294.3(BRCA1):c.4185G>C (p.Gln1395His) rs80356857
NM_007294.3(BRCA1):c.4186-10G>A rs80358172
NM_007294.3(BRCA1):c.4186-11C>T rs80358080
NM_007294.3(BRCA1):c.4186-19C>G
NM_007294.3(BRCA1):c.4186-19C>T rs80358016
NM_007294.3(BRCA1):c.4186-2482T>C rs869312513
NM_007294.3(BRCA1):c.4186-2483A>G rs8176177
NM_007294.3(BRCA1):c.4186-2646G>C rs758535463
NM_007294.3(BRCA1):c.4186-3277T>C rs869312516
NM_007294.3(BRCA1):c.4190G>A (p.Arg1397Lys)
NM_007294.3(BRCA1):c.4192G>T (p.Asp1398Tyr) rs876660331
NM_007294.3(BRCA1):c.4193A>G (p.Asp1398Gly) rs761640584
NM_007294.3(BRCA1):c.4196C>G (p.Thr1399Ser) rs876658465
NM_007294.3(BRCA1):c.4197C>G (p.Thr1399=) rs876659552
NM_007294.3(BRCA1):c.4201C>T (p.Gln1401Ter) rs397509151
NM_007294.3(BRCA1):c.4204C>T (p.His1402Tyr) rs80357365
NM_007294.3(BRCA1):c.4205A>G (p.His1402Arg) rs80356882
NM_007294.3(BRCA1):c.4209C>T (p.Asn1403=) rs786201224
NM_007294.3(BRCA1):c.420T>C (p.Ser140=) rs730881448
NM_007294.3(BRCA1):c.420T>G (p.Ser140Arg) rs730881448
NM_007294.3(BRCA1):c.4211T>C (p.Leu1404Pro) rs80356916
NM_007294.3(BRCA1):c.4211T>G (p.Leu1404Arg) rs80356916
NM_007294.3(BRCA1):c.4213A>G (p.Ile1405Val) rs80357353
NM_007294.3(BRCA1):c.4215A>T (p.Ile1405=) rs1555584242
NM_007294.3(BRCA1):c.4220T>G (p.Leu1407Arg) rs80357492
NM_007294.3(BRCA1):c.4222C>T (p.Gln1408Ter) rs80356989
NM_007294.3(BRCA1):c.4223A>G (p.Gln1408Arg) rs1555584227
NM_007294.3(BRCA1):c.4225C>T (p.Gln1409Ter) rs886040218
NM_007294.3(BRCA1):c.4227G>A (p.Gln1409=) rs786201618
NM_007294.3(BRCA1):c.4231A>G (p.Met1411Val) rs587781768
NM_007294.3(BRCA1):c.4233G>A (p.Met1411Ile)
NM_007294.3(BRCA1):c.4234G>A (p.Ala1412Thr) rs765183110
NM_007294.3(BRCA1):c.4234G>T (p.Ala1412Ser) rs765183110
NM_007294.3(BRCA1):c.4241T>C (p.Leu1414Pro) rs878854951
NM_007294.3(BRCA1):c.4242A>G (p.Leu1414=) rs1057521982
NM_007294.3(BRCA1):c.4243G>C (p.Glu1415Gln) rs1057519558
NM_007294.3(BRCA1):c.4243delG (p.Glu1415Lysfs) rs80357981
NM_007294.3(BRCA1):c.4245A>G (p.Glu1415=) rs41293453
NM_007294.3(BRCA1):c.4246G>A (p.Ala1416Thr) rs370999077
NM_007294.3(BRCA1):c.424C>G (p.Pro142Ala) rs397509156
NM_007294.3(BRCA1):c.4250delT (p.Val1417Glyfs) rs587782879
NM_007294.3(BRCA1):c.4251G>A (p.Val1417=) rs777057839
NM_007294.3(BRCA1):c.4251_4252delGT (p.Leu1418Argfs) rs80357977
NM_007294.3(BRCA1):c.4253T>C (p.Leu1418Ser) rs397509157
NM_007294.3(BRCA1):c.4254A>T (p.Leu1418Phe) rs1555584157
NM_007294.3(BRCA1):c.4255G>C (p.Glu1419Gln) rs80357309
NM_007294.3(BRCA1):c.4258C>G (p.Gln1420Glu) rs80357305
NM_007294.3(BRCA1):c.425C>A (p.Pro142His) rs55971303
NM_007294.3(BRCA1):c.4260G>T (p.Gln1420His)
NM_007294.3(BRCA1):c.4261C>T (p.His1421Tyr) rs80357013
NM_007294.3(BRCA1):c.4262A>G (p.His1421Arg) rs80357079
NM_007294.3(BRCA1):c.4265G>A (p.Gly1422Glu) rs747364414
NM_007294.3(BRCA1):c.4268G>T (p.Ser1423Ile) rs876660129
NM_007294.3(BRCA1):c.4269C>T (p.Ser1423=) rs786202278
NM_007294.3(BRCA1):c.426C>T (p.Pro142=) rs542687218
NM_007294.3(BRCA1):c.4273C>T (p.Pro1425Ser) rs768327850
NM_007294.3(BRCA1):c.427G>A (p.Glu143Lys) rs80356991
NM_007294.3(BRCA1):c.427G>C (p.Glu143Gln) rs80356991
NM_007294.3(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.3(BRCA1):c.4282delA (p.Ser1428Alafs) rs1555584125
NM_007294.3(BRCA1):c.4286A>G (p.Tyr1429Cys) rs876659228
NM_007294.3(BRCA1):c.4287C>T (p.Tyr1429=) rs397509160
NM_007294.3(BRCA1):c.4288C>G (p.Pro1430Ala) rs80357466
NM_007294.3(BRCA1):c.4292C>T (p.Ser1431Phe) rs748839289
NM_007294.3(BRCA1):c.4297A>G (p.Ile1433Val) rs541512953
NM_007294.3(BRCA1):c.429A>C (p.Glu143Asp) rs397507228
NM_007294.3(BRCA1):c.42C>T (p.Val14=) rs80356827
NM_007294.3(BRCA1):c.4300dupA (p.Ser1434Lysfs) rs80357790
NM_007294.3(BRCA1):c.4304A>G (p.Asp1435Gly) rs876660809
NM_007294.3(BRCA1):c.4305C>T (p.Asp1435=) rs730881445
NM_007294.3(BRCA1):c.4308T>C (p.Ser1436=) rs1060915
NM_007294.3(BRCA1):c.4314C>G (p.Ala1438=) rs80356856
NM_007294.3(BRCA1):c.4315C>T (p.Leu1439Phe) rs781260818
NM_007294.3(BRCA1):c.4319A>G (p.Glu1440Gly) rs786202288
NM_007294.3(BRCA1):c.4323C>T (p.Asp1441=) rs1057523168
NM_007294.3(BRCA1):c.4327C>G (p.Arg1443Gly) rs41293455
NM_007294.3(BRCA1):c.4327C>T (p.Arg1443Ter) rs41293455
NM_007294.3(BRCA1):c.4328G>A (p.Arg1443Gln) rs4986849
NM_007294.3(BRCA1):c.4332T>C (p.Asn1444=) rs752824502
NM_007294.3(BRCA1):c.4333C>A (p.Pro1445Thr) rs876660684
NM_007294.3(BRCA1):c.4335A>C (p.Pro1445=) rs1555584033
NM_007294.3(BRCA1):c.4335_4338dupAGAA (p.Gln1447Argfs) rs397509164
NM_007294.3(BRCA1):c.4337A>C (p.Glu1446Ala) rs1273755215
NM_007294.3(BRCA1):c.4337A>G (p.Glu1446Gly) rs1273755215
NM_007294.3(BRCA1):c.4339C>A (p.Gln1447Lys) rs80357067
NM_007294.3(BRCA1):c.4339C>T (p.Gln1447Ter) rs80357067
NM_007294.3(BRCA1):c.4342A>G (p.Ser1448Gly) rs80357486
NM_007294.3(BRCA1):c.4343G>A (p.Ser1448Asn) rs80357354
NM_007294.3(BRCA1):c.4344C>T (p.Ser1448=) rs1250691798
NM_007294.3(BRCA1):c.4347A>G (p.Thr1449=) rs80356840
NM_007294.3(BRCA1):c.4349C>T (p.Ser1450Leu)
NM_007294.3(BRCA1):c.434C>T (p.Pro145Leu) rs886041143
NM_007294.3(BRCA1):c.4351G>A (p.Glu1451Lys) rs1555583989
NM_007294.3(BRCA1):c.4352A>G (p.Glu1451Gly) rs949793708
NM_007294.3(BRCA1):c.4353A>G (p.Glu1451=) rs786202387
NM_007294.3(BRCA1):c.4357+13G>A rs1555583969
NM_007294.3(BRCA1):c.4357+14G>T rs760989937
NM_007294.3(BRCA1):c.4357+16C>A rs1060504577
NM_007294.3(BRCA1):c.4357+17A>G rs80358180
NM_007294.3(BRCA1):c.4357+18A>G
NM_007294.3(BRCA1):c.4357+1G>A rs80358027
NM_007294.3(BRCA1):c.4357+1G>C rs80358027
NM_007294.3(BRCA1):c.4357+1G>T rs80358027
NM_007294.3(BRCA1):c.4357+2T>G rs80358152
NM_007294.3(BRCA1):c.4357+4T>C rs1555583978
NM_007294.3(BRCA1):c.4357+6T>C rs80358143
NM_007294.3(BRCA1):c.4357+7A>G rs431825407
NM_007294.3(BRCA1):c.4357+810T>G rs869312511
NM_007294.3(BRCA1):c.4358-10C>T rs80358111
NM_007294.3(BRCA1):c.4358-13A>C
NM_007294.3(BRCA1):c.4358-1950A>C rs869312515
NM_007294.3(BRCA1):c.4358-1G>A rs876658790
NM_007294.3(BRCA1):c.4358-2704C>T rs562625234
NM_007294.3(BRCA1):c.4358-2716C>G rs193146830
NM_007294.3(BRCA1):c.4358-2716C>T rs193146830
NM_007294.3(BRCA1):c.4358-2725T>C rs374519494
NM_007294.3(BRCA1):c.4358-2738C>T rs1555583238
NM_007294.3(BRCA1):c.4358-2858G>T rs186914333
NM_007294.3(BRCA1):c.4358-2859G>A rs191331108
NM_007294.3(BRCA1):c.4358-3A>G
NM_007294.3(BRCA1):c.4358-9C>A
NM_007294.3(BRCA1):c.4358C>T (p.Ala1453Val) rs1171055085
NM_007294.3(BRCA1):c.4361T>C (p.Val1454Ala) rs587782606
NM_007294.3(BRCA1):c.4366A>G (p.Thr1456Ala) rs786201835
NM_007294.3(BRCA1):c.4370C>A (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4372C>T (p.Gln1458Ter) rs80356932
NM_007294.3(BRCA1):c.4376A>G (p.Lys1459Arg) rs1555582697
NM_007294.3(BRCA1):c.4379G>A (p.Ser1460Asn) rs397509167
NM_007294.3(BRCA1):c.4379delG (p.Ser1460Ilefs) rs786203149
NM_007294.3(BRCA1):c.4380T>C (p.Ser1460=) rs786203100
NM_007294.3(BRCA1):c.4384G>A (p.Glu1462Lys) rs141255461
NM_007294.3(BRCA1):c.4387delT (p.Tyr1463Thrfs) rs397507229
NM_007294.3(BRCA1):c.4389C>A (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4389C>G (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.438C>T (p.Ser146=) rs1555596287
NM_007294.3(BRCA1):c.4390C>T (p.Pro1464Ser)
NM_007294.3(BRCA1):c.4391_4393delCTAinsTT (p.Pro1464Leufs) rs273900730
NM_007294.3(BRCA1):c.4392T>A (p.Pro1464=) rs794727102
NM_007294.3(BRCA1):c.4392delT (p.Ile1465Terfs) rs1064793577
NM_007294.3(BRCA1):c.439T>G (p.Leu147Val) rs794727800
NM_007294.3(BRCA1):c.43A>C (p.Ile15Leu) rs80357031
NM_007294.3(BRCA1):c.4400_4418del19insTTT (p.Gln1467Leufs) rs876659310
NM_007294.3(BRCA1):c.4401delG (p.Asn1468Ilefs) rs587781611
NM_007294.3(BRCA1):c.4402A>C (p.Asn1468His) rs80357022
NM_007294.3(BRCA1):c.4405C>T (p.Pro1469Ser) rs80356960
NM_007294.3(BRCA1):c.441+13G>A rs1057520408
NM_007294.3(BRCA1):c.441+14T>C rs750353662
NM_007294.3(BRCA1):c.441+17T>C rs368415464
NM_007294.3(BRCA1):c.441+17_441+20delinsC rs1555596266
NM_007294.3(BRCA1):c.441+17delT rs730881449
NM_007294.3(BRCA1):c.441+18C>T rs371973519
NM_007294.3(BRCA1):c.441+19_441+20delTT rs764884677
NM_007294.3(BRCA1):c.441+1G>A rs397509172
NM_007294.3(BRCA1):c.441+2T>A rs397509173
NM_007294.3(BRCA1):c.441+2T>C rs397509173
NM_007294.3(BRCA1):c.441+346G>T rs752284897
NM_007294.3(BRCA1):c.441+6dup rs1060504561
NM_007294.3(BRCA1):c.4410A>T (p.Glu1470Asp) rs80357075
NM_007294.3(BRCA1):c.4411G>A (p.Gly1471Ser)
NM_007294.3(BRCA1):c.4412G>A (p.Gly1471Asp)
NM_007294.3(BRCA1):c.4412G>C (p.Gly1471Ala) rs587782708
NM_007294.3(BRCA1):c.4412G>T (p.Gly1471Val) rs587782708
NM_007294.3(BRCA1):c.4414C>T (p.Leu1472Phe) rs200582930
NM_007294.3(BRCA1):c.4417T>C (p.Ser1473Pro) rs398122686
NM_007294.3(BRCA1):c.4419T>A (p.Ser1473=) rs730881455
NM_007294.3(BRCA1):c.441G>C (p.Leu147Phe) rs748876625
NM_007294.3(BRCA1):c.442-18_442-4del15 rs587782663
NM_007294.3(BRCA1):c.442-34C>T rs799923
NM_007294.3(BRCA1):c.442-3T>A rs8176139
NM_007294.3(BRCA1):c.442-3T>G rs8176139
NM_007294.3(BRCA1):c.442-3delT rs273900733
NM_007294.3(BRCA1):c.442-6G>T
NM_007294.3(BRCA1):c.4420G>A (p.Ala1474Thr) rs1555582616
NM_007294.3(BRCA1):c.4422T>C (p.Ala1474=) rs756281673
NM_007294.3(BRCA1):c.4423G>T (p.Asp1475Tyr) rs876660940
NM_007294.3(BRCA1):c.4428G>A (p.Lys1476=) rs1057522527
NM_007294.3(BRCA1):c.442C>A (p.Gln148Lys) rs876659614
NM_007294.3(BRCA1):c.442C>T (p.Gln148Ter) rs876659614
NM_007294.3(BRCA1):c.4430T>C (p.Phe1477Ser) rs876660550
NM_007294.3(BRCA1):c.4432G>T (p.Glu1478Ter) rs876659878
NM_007294.3(BRCA1):c.4435G>C (p.Val1479Leu) rs786203524
NM_007294.3(BRCA1):c.4437G>A (p.Val1479=) rs1232117701
NM_007294.3(BRCA1):c.4441G>A (p.Ala1481Thr) rs1135401828
NM_007294.3(BRCA1):c.4446T>G (p.Asp1482Glu) rs1555582586
NM_007294.3(BRCA1):c.4447A>C (p.Ser1483Arg) rs1555582583
NM_007294.3(BRCA1):c.4449T>A (p.Ser1483Arg) rs1555582581
NM_007294.3(BRCA1):c.4450T>A (p.Ser1484Thr) rs80357404
NM_007294.3(BRCA1):c.4450T>G (p.Ser1484Ala)
NM_007294.3(BRCA1):c.4454C>T (p.Thr1485Ile) rs80356870
NM_007294.3(BRCA1):c.4456A>T (p.Ser1486Cys) rs397507232
NM_007294.3(BRCA1):c.445G>A (p.Glu149Lys) rs876658381
NM_007294.3(BRCA1):c.4460A>G (p.Lys1487Arg) rs80357126
NM_007294.3(BRCA1):c.4466A>G (p.Lys1489Arg) rs587781880
NM_007294.3(BRCA1):c.446A>C (p.Glu149Ala) rs397507233
NM_007294.3(BRCA1):c.4470A>T (p.Glu1490Asp) rs1555582549
NM_007294.3(BRCA1):c.4471C>A (p.Pro1491Thr) rs111034213
NM_007294.3(BRCA1):c.4480G>A (p.Glu1494Lys) rs80357148
NM_007294.3(BRCA1):c.4481A>G (p.Glu1494Gly) rs758779691
NM_007294.3(BRCA1):c.4482_4483delAA (p.Arg1495Valfs) rs80357854
NM_007294.3(BRCA1):c.4484+14A>G rs80358022
NM_007294.3(BRCA1):c.4484+15T>C rs760275914
NM_007294.3(BRCA1):c.4484+1G>A rs80358063
NM_007294.3(BRCA1):c.4484+5G>T rs886040910
NM_007294.3(BRCA1):c.4484G>A (p.Arg1495Lys) rs80357389
NM_007294.3(BRCA1):c.4484G>C (p.Arg1495Thr) rs80357389
NM_007294.3(BRCA1):c.4484G>T (p.Arg1495Met) rs80357389
NM_007294.3(BRCA1):c.4485-10A>G rs863224420
NM_007294.3(BRCA1):c.4485-11T>C
NM_007294.3(BRCA1):c.4485-1G>A rs80358189
NM_007294.3(BRCA1):c.4485-2A>G rs80358054
NM_007294.3(BRCA1):c.4485-8C>A rs397507234
NM_007294.3(BRCA1):c.4485-8C>T rs397507234
NM_007294.3(BRCA1):c.4486delT (p.Ser1496Hisfs) rs1555582082
NM_007294.3(BRCA1):c.4493C>G (p.Pro1498Arg) rs1555582079
NM_007294.3(BRCA1):c.44T>C (p.Ile15Thr) rs80357316
NM_007294.3(BRCA1):c.4503C>T (p.Cys1501=) rs747539984
NM_007294.3(BRCA1):c.4504C>T (p.Pro1502Ser) rs80357383
NM_007294.3(BRCA1):c.4505C>A (p.Pro1502Gln) rs56335406
NM_007294.3(BRCA1):c.4505delC (p.Pro1502Hisfs) rs1555582069
NM_007294.3(BRCA1):c.4508C>A (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4510T>G (p.Leu1504Val)
NM_007294.3(BRCA1):c.4512A>G (p.Leu1504=) rs1555582056
NM_007294.3(BRCA1):c.4513G>C (p.Asp1505His) rs1555582052
NM_007294.3(BRCA1):c.4515T>C (p.Asp1505=) rs1057522167
NM_007294.3(BRCA1):c.4516delG (p.Asp1506Ilefs) rs273900736
NM_007294.3(BRCA1):c.4519A>G (p.Arg1507Gly)
NM_007294.3(BRCA1):c.4520G>C (p.Arg1507Thr) rs80357470
NM_007294.3(BRCA1):c.4523G>A (p.Trp1508Ter) rs786202631
NM_007294.3(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.3(BRCA1):c.4526A>G (p.Tyr1509Cys) rs1555582023
NM_007294.3(BRCA1):c.4530G>A (p.Met1510Ile) rs1555582010
NM_007294.3(BRCA1):c.4532A>C (p.His1511Pro) rs1555582004
NM_007294.3(BRCA1):c.4534A>T (p.Ser1512Cys) rs80357137
NM_007294.3(BRCA1):c.4535G>T (p.Ser1512Ile) rs1800744
NM_007294.3(BRCA1):c.4541C>T (p.Ser1514Phe) rs863224761
NM_007294.3(BRCA1):c.4544G>A (p.Gly1515Glu) rs398122688
NM_007294.3(BRCA1):c.4545G>T (p.Gly1515=) rs755731300
NM_007294.3(BRCA1):c.4549C>G (p.Leu1517Val) rs137894496
NM_007294.3(BRCA1):c.4550T>C (p.Leu1517Pro) rs1555581980
NM_007294.3(BRCA1):c.4552C>A (p.Gln1518Lys) rs80356881
NM_007294.3(BRCA1):c.4552C>G (p.Gln1518Glu) rs80356881
NM_007294.3(BRCA1):c.4554G>A (p.Gln1518=) rs786202635
NM_007294.3(BRCA1):c.4557T>C (p.Asn1519=) rs876659243
NM_007294.3(BRCA1):c.4559G>C (p.Arg1520Thr) rs1555581971
NM_007294.3(BRCA1):c.455T>C (p.Leu152Pro) rs80357275
NM_007294.3(BRCA1):c.4564T>C (p.Tyr1522His)
NM_007294.3(BRCA1):c.4565A>G (p.Tyr1522Cys) rs80357379
NM_007294.3(BRCA1):c.4568C>T (p.Pro1523Leu) rs1555581955
NM_007294.3(BRCA1):c.456delC (p.Ser153Valfs) rs876659830
NM_007294.3(BRCA1):c.4571C>G (p.Ser1524Cys) rs1555581944
NM_007294.3(BRCA1):c.4574A>G (p.Gln1525Arg) rs786203386
NM_007294.3(BRCA1):c.4574_4575delAA (p.Gln1525Argfs) rs80357813
NM_007294.3(BRCA1):c.457A>C (p.Ser153Arg) rs28897674
NM_007294.3(BRCA1):c.457A>G (p.Ser153Gly) rs28897674
NM_007294.3(BRCA1):c.4581G>A (p.Glu1527=) rs1060504560
NM_007294.3(BRCA1):c.4583T>C (p.Leu1528Pro) rs1555581911
NM_007294.3(BRCA1):c.4585A>G (p.Ile1529Val) rs80357095
NM_007294.3(BRCA1):c.4591G>A (p.Val1531Ile) rs1555581897
NM_007294.3(BRCA1):c.4594G>A (p.Val1532Ile) rs786201658
NM_007294.3(BRCA1):c.4596T>C (p.Val1532=)
NM_007294.3(BRCA1):c.4597G>A (p.Asp1533Asn) rs899108857
NM_007294.3(BRCA1):c.4597G>T (p.Asp1533Tyr) rs899108857
NM_007294.3(BRCA1):c.4600G>A (p.Val1534Met) rs55815649
NM_007294.3(BRCA1):c.4603G>A (p.Glu1535Lys) rs80357366
NM_007294.3(BRCA1):c.4603G>T (p.Glu1535Ter) rs80357366
NM_007294.3(BRCA1):c.4606G>C (p.Glu1536Gln) rs876660460
NM_007294.3(BRCA1):c.4609C>T (p.Gln1537Ter) rs80357229
NM_007294.3(BRCA1):c.4610A>G (p.Gln1537Arg) rs70953659
NM_007294.3(BRCA1):c.4611_4612insG (p.Gln1538Alafs) rs80357915
NM_007294.3(BRCA1):c.4612C>T (p.Gln1538Ter) rs80356992
NM_007294.3(BRCA1):c.4614G>A (p.Gln1538=) rs1555581876
NM_007294.3(BRCA1):c.4620A>G (p.Glu1540=) rs769566412
NM_007294.3(BRCA1):c.4622_4623delAG (p.Glu1541Valfs) rs886040241
NM_007294.3(BRCA1):c.4625C>G (p.Ser1542Cys) rs41293457
NM_007294.3(BRCA1):c.4626T>C (p.Ser1542=) rs786202425
NM_007294.3(BRCA1):c.4631C>T (p.Pro1544Leu) rs80356917
NM_007294.3(BRCA1):c.4635C>T (p.His1545=) rs373686790
NM_007294.3(BRCA1):c.4636G>A (p.Asp1546Asn) rs28897691
NM_007294.3(BRCA1):c.4636G>C (p.Asp1546His) rs28897691
NM_007294.3(BRCA1):c.4636G>T (p.Asp1546Tyr) rs28897691
NM_007294.3(BRCA1):c.4638T>G (p.Asp1546Glu) rs397507235
NM_007294.3(BRCA1):c.463C>G (p.Gln155Glu) rs80357180
NM_007294.3(BRCA1):c.4643C>T (p.Thr1548Met) rs273900737
NM_007294.3(BRCA1):c.4644G>A (p.Thr1548=) rs28897692
NM_007294.3(BRCA1):c.4646A>T (p.Glu1549Val) rs876659001
NM_007294.3(BRCA1):c.4647A>C (p.Glu1549Asp) rs1371814796
NM_007294.3(BRCA1):c.4649C>T (p.Thr1550Ile) rs80357076
NM_007294.3(BRCA1):c.4650A>G (p.Thr1550=) rs876658608
NM_007294.3(BRCA1):c.4650A>T (p.Thr1550=) rs876658608
NM_007294.3(BRCA1):c.4653T>C (p.Ser1551=) rs587780863
NM_007294.3(BRCA1):c.4654T>C (p.Tyr1552His) rs1265352633
NM_007294.3(BRCA1):c.4654_4673del20 (p.Tyr1552Argfs) rs876659293
NM_007294.3(BRCA1):c.4655_4658delACTT (p.Tyr1552Cysfs) rs80357561
NM_007294.3(BRCA1):c.4655dupA (p.Tyr1552Terfs) rs587782143
NM_007294.3(BRCA1):c.4657T>A (p.Leu1553Met) rs80357431
NM_007294.3(BRCA1):c.465A>C (p.Gln155His) rs864622260
NM_007294.3(BRCA1):c.465A>T (p.Gln155His) rs864622260
NM_007294.3(BRCA1):c.4664G>A (p.Arg1555Lys) rs786202165
NM_007294.3(BRCA1):c.4667A>G (p.Gln1556Arg) rs1555581811
NM_007294.3(BRCA1):c.4669G>A (p.Asp1557Asn) rs80356906
NM_007294.3(BRCA1):c.4669G>T (p.Asp1557Tyr) rs80356906
NM_007294.3(BRCA1):c.466C>A (p.Leu156Ile) rs587778115
NM_007294.3(BRCA1):c.4670A>G (p.Asp1557Gly) rs869320779
NM_007294.3(BRCA1):c.4672C>G (p.Leu1558Val) rs1555581794
NM_007294.3(BRCA1):c.4674A>G (p.Leu1558=) rs996042036
NM_007294.3(BRCA1):c.4675+11A>G rs750095985
NM_007294.3(BRCA1):c.4675+11A>T
NM_007294.3(BRCA1):c.4675+18G>A
NM_007294.3(BRCA1):c.4675+1G>A rs80358044
NM_007294.3(BRCA1):c.4675+1G>T rs80358044
NM_007294.3(BRCA1):c.4675+20A>G rs780870669
NM_007294.3(BRCA1):c.4675+3A>G rs80358082
NM_007294.3(BRCA1):c.4675+3A>T rs80358082
NM_007294.3(BRCA1):c.4675+53C>A rs869312522
NM_007294.3(BRCA1):c.4675+819G>A rs762074644
NM_007294.3(BRCA1):c.4675+918T>C rs554926201
NM_007294.3(BRCA1):c.4675G>A (p.Glu1559Lys) rs80356988
NM_007294.3(BRCA1):c.4675G>C (p.Glu1559Gln) rs80356988
NM_007294.3(BRCA1):c.4676-11A>G rs80358088
NM_007294.3(BRCA1):c.4676-16C>G rs80358067
NM_007294.3(BRCA1):c.4676-1G>A rs80358008
NM_007294.3(BRCA1):c.4676-1G>C rs80358008
NM_007294.3(BRCA1):c.4676-20A>C
NM_007294.3(BRCA1):c.4676-2A>G rs80358096
NM_007294.3(BRCA1):c.4676-487G>A rs869312518
NM_007294.3(BRCA1):c.4676-7C>T rs80358005
NM_007294.3(BRCA1):c.4676-8C>G rs80358021
NM_007294.3(BRCA1):c.4676-93A>C
NM_007294.3(BRCA1):c.4677G>C (p.Glu1559Asp) rs587781876
NM_007294.3(BRCA1):c.4678G>T (p.Gly1560Ter) rs80357349
NM_007294.3(BRCA1):c.4679G>T (p.Gly1560Val) rs564757581
NM_007294.3(BRCA1):c.4682C>T (p.Thr1561Ile) rs56158747
NM_007294.3(BRCA1):c.4683C>A (p.Thr1561=) rs878853265
NM_007294.3(BRCA1):c.4683C>T (p.Thr1561=) rs878853265
NM_007294.3(BRCA1):c.4688_4694delACCTGGAinsG (p.Tyr1563_Tyr1863del) rs1555581087
NM_007294.3(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.3(BRCA1):c.4689C>T (p.Tyr1563=) rs80357433
NM_007294.3(BRCA1):c.468C>G (p.Leu156=) rs748923729
NM_007294.3(BRCA1):c.4691T>C (p.Leu1564Pro) rs56119278
NM_007294.3(BRCA1):c.4699G>A (p.Gly1567Arg) rs568753972
NM_007294.3(BRCA1):c.4700G>T (p.Gly1567Val) rs1555581074
NM_007294.3(BRCA1):c.470C>G (p.Ser157Cys) rs80357045
NM_007294.3(BRCA1):c.470_471delCT (p.Ser157Terfs) rs80357887
NM_007294.3(BRCA1):c.4710C>T (p.Leu1570=) rs786201839
NM_007294.3(BRCA1):c.4713C>G (p.Phe1571Leu) rs768945711
NM_007294.3(BRCA1):c.4727A>G (p.Glu1576Gly) rs876659007
NM_007294.3(BRCA1):c.4729T>C (p.Ser1577Pro) rs80356909
NM_007294.3(BRCA1):c.4730C>A (p.Ser1577Tyr) rs273901741
NM_007294.3(BRCA1):c.4730C>T (p.Ser1577Phe) rs273901741
NM_007294.3(BRCA1):c.4733A>G (p.Asp1578Gly) rs80356930
NM_007294.3(BRCA1):c.4735C>G (p.Pro1579Ala) rs145466894
NM_007294.3(BRCA1):c.4736_4739delCTTC (p.Pro1579Leufs) rs1555581017
NM_007294.3(BRCA1):c.4739C>T (p.Ser1580Phe) rs80357411
NM_007294.3(BRCA1):c.4740T>C (p.Ser1580=) rs777297026
NM_007294.3(BRCA1):c.4743A>G (p.Glu1581=) rs397509194
NM_007294.3(BRCA1):c.4748G>A (p.Arg1583Lys) rs752624544
NM_007294.3(BRCA1):c.4750G>T (p.Ala1584Ser) rs80357070
NM_007294.3(BRCA1):c.4752C>T (p.Ala1584=) rs786201422
NM_007294.3(BRCA1):c.4754_4755delCA (p.Pro1585Argfs) rs80357837
NM_007294.3(BRCA1):c.4764T>A (p.Ala1588=) rs753651115
NM_007294.3(BRCA1):c.4764T>C (p.Ala1588=) rs753651115
NM_007294.3(BRCA1):c.4765C>T (p.Arg1589Cys) rs80357002
NM_007294.3(BRCA1):c.4766G>A (p.Arg1589His) rs80357341
NM_007294.3(BRCA1):c.4767T>G (p.Arg1589=) rs587780864
NM_007294.3(BRCA1):c.4769T>C (p.Val1590Ala) rs773524529
NM_007294.3(BRCA1):c.4771G>A (p.Gly1591Ser) rs587782825
NM_007294.3(BRCA1):c.4774A>C (p.Asn1592His)
NM_007294.3(BRCA1):c.4775A>G (p.Asn1592Ser) rs786203699
NM_007294.3(BRCA1):c.4776C>G (p.Asn1592Lys) rs761925468
NM_007294.3(BRCA1):c.4777A>G (p.Ile1593Val) rs397509197
NM_007294.3(BRCA1):c.477T>C (p.Leu159=) rs779704727
NM_007294.3(BRCA1):c.4780C>G (p.Pro1594Ala) rs587782012
NM_007294.3(BRCA1):c.4781C>A (p.Pro1594Gln) rs1301724072
NM_007294.3(BRCA1):c.4782A>G (p.Pro1594=) rs876659455
NM_007294.3(BRCA1):c.4783T>C (p.Ser1595Pro) rs1325644035
NM_007294.3(BRCA1):c.4787C>A (p.Ser1596Ter) rs80357429
NM_007294.3(BRCA1):c.478G>A (p.Gly160Arg) rs62625285
NM_007294.3(BRCA1):c.4790C>A (p.Thr1597Asn) rs587781623
NM_007294.3(BRCA1):c.4791C>T (p.Thr1597=) rs1555580935
NM_007294.3(BRCA1):c.4798T>C (p.Leu1600=) rs775837744
NM_007294.3(BRCA1):c.4799dupT (p.Leu1600Phefs) rs587782392
NM_007294.3(BRCA1):c.4801A>C (p.Lys1601Gln) rs80357303
NM_007294.3(BRCA1):c.4801A>T (p.Lys1601Ter) rs80357303
NM_007294.3(BRCA1):c.4803A>G (p.Lys1601=) rs886037794
NM_007294.3(BRCA1):c.4803delA (p.Val1602Phefs) rs1555580912
NM_007294.3(BRCA1):c.4807_4821delCCCCAATTGAAAGTT (p.Pro1603_Val1607del) rs397507238
NM_007294.3(BRCA1):c.4810C>T (p.Gln1604Ter) rs80357352
NM_007294.3(BRCA1):c.4812A>G (p.Gln1604=) rs28897693
NM_007294.3(BRCA1):c.4813T>A (p.Leu1605Met) rs80356833
NM_007294.3(BRCA1):c.4813T>C (p.Leu1605=) rs80356833
NM_007294.3(BRCA1):c.4816A>G (p.Lys1606Glu) rs80356943
NM_007294.3(BRCA1):c.4821T>C (p.Val1607=)
NM_007294.3(BRCA1):c.4822G>A (p.Ala1608Thr)
NM_007294.3(BRCA1):c.4824A>G (p.Ala1608=) rs1555580860
NM_007294.3(BRCA1):c.4828dup (p.Ser1610Phefs) rs1555580854
NM_007294.3(BRCA1):c.482C>T (p.Thr161Ile) rs876660138
NM_007294.3(BRCA1):c.4834C>T (p.Gln1612Ter) rs786202064
NM_007294.3(BRCA1):c.4834_4835delCA (p.Gln1612Glufs) rs1555580840
NM_007294.3(BRCA1):c.4836G>C (p.Gln1612His) rs747688901
NM_007294.3(BRCA1):c.4837A>G (p.Ser1613Gly) rs1799966
NM_007294.3(BRCA1):c.4837A>T (p.Ser1613Cys) rs1799966
NM_007294.3(BRCA1):c.4838G>A (p.Ser1613Asn) rs1555580821
NM_007294.3(BRCA1):c.483T>G (p.Thr161=)
NM_007294.3(BRCA1):c.4840C>T (p.Pro1614Ser) rs70953660
NM_007294.3(BRCA1):c.4843G>A (p.Ala1615Thr) rs80356987
NM_007294.3(BRCA1):c.4844C>T (p.Ala1615Val) rs1555580805
NM_007294.3(BRCA1):c.4845T>C (p.Ala1615=) rs144588397
NM_007294.3(BRCA1):c.484G>A (p.Val162Met) rs55816927
NM_007294.3(BRCA1):c.484G>C (p.Val162Leu) rs55816927
NM_007294.3(BRCA1):c.4851T>C (p.Ala1617=) rs786202627
NM_007294.3(BRCA1):c.4852C>T (p.His1618Tyr) rs755920262
NM_007294.3(BRCA1):c.4853A>G (p.His1618Arg) rs1277159752
NM_007294.3(BRCA1):c.4854T>C (p.His1618=) rs750718476
NM_007294.3(BRCA1):c.4856C>T (p.Thr1619Ile) rs876659163
NM_007294.3(BRCA1):c.4858A>G (p.Thr1620Ala) rs8176219
NM_007294.3(BRCA1):c.485_486delTG (p.Val162Glufs) rs80357708
NM_007294.3(BRCA1):c.485dupT (p.Arg163Glufs) rs587781427
NM_007294.3(BRCA1):c.4860T>C (p.Thr1620=) rs750938749
NM_007294.3(BRCA1):c.4862A>C (p.Asp1621Ala) rs1555580777
NM_007294.3(BRCA1):c.4862_4871del10 (p.Asp1621Glyfs) rs1555580773
NM_007294.3(BRCA1):c.4864A>G (p.Thr1622Ala) rs786202026
NM_007294.3(BRCA1):c.4865C>G (p.Thr1622Ser) rs786202573
NM_007294.3(BRCA1):c.4868C>G (p.Ala1623Gly) rs80356862
NM_007294.3(BRCA1):c.4872G>A (p.Gly1624=) rs11555992
NM_007294.3(BRCA1):c.4874A>G (p.Tyr1625Cys) rs730881494
NM_007294.3(BRCA1):c.4875T>A (p.Tyr1625Ter) rs886040251
NM_007294.3(BRCA1):c.4879G>A (p.Ala1627Thr) rs774505084
NM_007294.3(BRCA1):c.4882A>G (p.Met1628Val) rs80357465
NM_007294.3(BRCA1):c.4883T>C (p.Met1628Thr) rs4986854
NM_007294.3(BRCA1):c.4884G>T (p.Met1628Ile) rs80357158
NM_007294.3(BRCA1):c.4891A>T (p.Ser1631Cys) rs786202734
NM_007294.3(BRCA1):c.4892G>A (p.Ser1631Asn) rs273901742
NM_007294.3(BRCA1):c.4893T>A (p.Ser1631Arg)
NM_007294.3(BRCA1):c.4893T>C (p.Ser1631=) rs80356850
NM_007294.3(BRCA1):c.4894G>A (p.Val1632Met) rs770193975
NM_007294.3(BRCA1):c.4894G>C (p.Val1632Leu)
NM_007294.3(BRCA1):c.4894G>T (p.Val1632Leu) rs770193975
NM_007294.3(BRCA1):c.4895T>G (p.Val1632Gly)
NM_007294.3(BRCA1):c.4899C>A (p.Ser1633Arg)
NM_007294.3(BRCA1):c.48T>A (p.Asn16Lys) rs1555600963
NM_007294.3(BRCA1):c.4902G>A (p.Arg1634=) rs746199881
NM_007294.3(BRCA1):c.4903G>A (p.Glu1635Lys) rs200432771
NM_007294.3(BRCA1):c.4903G>T (p.Glu1635Ter) rs200432771
NM_007294.3(BRCA1):c.4908G>A (p.Lys1636=)
NM_007294.3(BRCA1):c.4909C>T (p.Pro1637Ser) rs876659989
NM_007294.3(BRCA1):c.4910C>T (p.Pro1637Leu) rs80357048
NM_007294.3(BRCA1):c.4914A>G (p.Glu1638=) rs786201216
NM_007294.3(BRCA1):c.4916T>C (p.Leu1639Ser)
NM_007294.3(BRCA1):c.4918A>G (p.Thr1640Ala) rs1555580683
NM_007294.3(BRCA1):c.491C>T (p.Thr164Ile) rs1555594889
NM_007294.3(BRCA1):c.4921G>A (p.Ala1641Thr) rs1800726
NM_007294.3(BRCA1):c.4923T>G (p.Ala1641=) rs876658258
NM_007294.3(BRCA1):c.4929A>C (p.Thr1643=) rs786202022
NM_007294.3(BRCA1):c.4930G>T (p.Glu1644Ter) rs397509205
NM_007294.3(BRCA1):c.4931A>G (p.Glu1644Gly) rs80357016
NM_007294.3(BRCA1):c.4934G>C (p.Arg1645Thr) rs70953661
NM_007294.3(BRCA1):c.4934G>T (p.Arg1645Met) rs70953661
NM_007294.3(BRCA1):c.4935G>C (p.Arg1645Ser) rs80357373
NM_007294.3(BRCA1):c.4936delG (p.Val1646Serfs) rs80357653
NM_007294.3(BRCA1):c.4941C>A (p.Asn1647Lys) rs80357302
NM_007294.3(BRCA1):c.4945delA (p.Arg1649Glufs) rs80357655
NM_007294.3(BRCA1):c.4946G>C (p.Arg1649Thr) rs876660509
NM_007294.3(BRCA1):c.4949T>C (p.Met1650Thr) rs778487856
NM_007294.3(BRCA1):c.494dupT (p.Arg166Glufs) rs80357762
NM_007294.3(BRCA1):c.4951T>C (p.Ser1651Pro) rs879254042
NM_007294.3(BRCA1):c.4954A>G (p.Met1652Val) rs1348949389
NM_007294.3(BRCA1):c.4955T>C (p.Met1652Thr) rs80356968
NM_007294.3(BRCA1):c.4956G>A (p.Met1652Ile) rs1799967
NM_007294.3(BRCA1):c.4957G>A (p.Val1653Met) rs80357261
NM_007294.3(BRCA1):c.495G>A (p.Leu165=) rs745321499
NM_007294.3(BRCA1):c.4964C>T (p.Ser1655Phe) rs80357390
NM_007294.3(BRCA1):c.4964_4982del19 (p.Ser1655Tyrfs) rs80359876
NM_007294.3(BRCA1):c.4971G>A (p.Leu1657=) rs786202058
NM_007294.3(BRCA1):c.4971G>C (p.Leu1657=) rs786202058
NM_007294.3(BRCA1):c.4973C>A (p.Thr1658Asn)
NM_007294.3(BRCA1):c.4974C>T (p.Thr1658=) rs1555580615
NM_007294.3(BRCA1):c.4976del (p.Pro1659Glnfs) rs879255295
NM_007294.3(BRCA1):c.4981G>A (p.Glu1661Lys) rs80357401
NM_007294.3(BRCA1):c.4981G>T (p.Glu1661Ter) rs80357401
NM_007294.3(BRCA1):c.4985T>C (p.Phe1662Ser) rs28897695
NM_007294.3(BRCA1):c.4986+1349G>T rs8176225
NM_007294.3(BRCA1):c.4986+13A>G
NM_007294.3(BRCA1):c.4986+1566A>G rs781673566
NM_007294.3(BRCA1):c.4986+19A>G rs751693860
NM_007294.3(BRCA1):c.4986+3G>C rs80358023
NM_007294.3(BRCA1):c.4986+4A>C rs80358087
NM_007294.3(BRCA1):c.4986+4A>T rs80358087
NM_007294.3(BRCA1):c.4986+6T>C rs80358086
NM_007294.3(BRCA1):c.4986+6T>G rs80358086
NM_007294.3(BRCA1):c.4986+9A>T
NM_007294.3(BRCA1):c.4986dup (p.Met1663Tyrfs) rs1555580601
NM_007294.3(BRCA1):c.4987-1060G>A rs145869415
NM_007294.3(BRCA1):c.4987-1085A>G rs869312521
NM_007294.3(BRCA1):c.4987-11T>C rs80358170
NM_007294.3(BRCA1):c.4987-1G>C rs730881495
NM_007294.3(BRCA1):c.4987-20A>G rs80358035
NM_007294.3(BRCA1):c.4987-3C>G rs397509213
NM_007294.3(BRCA1):c.4987-3C>T rs397509213
NM_007294.3(BRCA1):c.4987-4T>G rs1157151499
NM_007294.3(BRCA1):c.4987-635A>G rs190756329
NM_007294.3(BRCA1):c.4987-68A>G rs8176234
NM_007294.3(BRCA1):c.4987-94A>G rs987732791
NM_007294.3(BRCA1):c.4987-94_4987-92delinsGCG rs1555579864
NM_007294.3(BRCA1):c.4988T>A (p.Met1663Lys) rs80357205
NM_007294.3(BRCA1):c.4991T>C (p.Leu1664Pro) rs80357314
NM_007294.3(BRCA1):c.4992C>T (p.Leu1664=) rs142459158
NM_007294.3(BRCA1):c.4993G>A (p.Val1665Met) rs80357169
NM_007294.3(BRCA1):c.4993G>C (p.Val1665Leu) rs80357169
NM_007294.3(BRCA1):c.4997A>G (p.Tyr1666Cys) rs397509216
NM_007294.3(BRCA1):c.4997dupA (p.Tyr1666Terfs) rs876658947
NM_007294.3(BRCA1):c.4998C>A (p.Tyr1666Ter) rs730882165
NM_007294.3(BRCA1):c.4998C>T (p.Tyr1666=) rs730882165
NM_007294.3(BRCA1):c.4999A>G (p.Lys1667Glu) rs80357204
NM_007294.3(BRCA1):c.4999A>T (p.Lys1667Ter) rs80357204
NM_007294.3(BRCA1):c.49G>T (p.Ala17Ser) rs1402064476
NM_007294.3(BRCA1):c.5001G>A (p.Lys1667=) rs889937720
NM_007294.3(BRCA1):c.5002T>A (p.Phe1668Ile) rs587781472
NM_007294.3(BRCA1):c.5003T>C (p.Phe1668Ser)
NM_007294.3(BRCA1):c.5003T>G (p.Phe1668Cys)
NM_007294.3(BRCA1):c.5005G>T (p.Ala1669Ser) rs80357087
NM_007294.3(BRCA1):c.5007C>T (p.Ala1669=) rs751856943
NM_007294.3(BRCA1):c.5008A>C (p.Arg1670=) rs1057523976
NM_007294.3(BRCA1):c.5014C>T (p.His1672Tyr) rs587781477
NM_007294.3(BRCA1):c.5015A>T (p.His1672Leu)
NM_007294.3(BRCA1):c.5017_5019delCAC (p.His1673del) rs80358343
NM_007294.3(BRCA1):c.5022C>T (p.Ile1674=) rs786203868
NM_007294.3(BRCA1):c.5023A>G (p.Thr1675Ala) rs774452090
NM_007294.3(BRCA1):c.5024C>T (p.Thr1675Ile) rs150729791
NM_007294.3(BRCA1):c.5025T>C (p.Thr1675=) rs876658226
NM_007294.3(BRCA1):c.5026T>C (p.Leu1676=)
NM_007294.3(BRCA1):c.5027T>G (p.Leu1676Ter) rs786203754
NM_007294.3(BRCA1):c.502A>G (p.Lys168Glu)
NM_007294.3(BRCA1):c.5030C>T (p.Thr1677Ile) rs876660263
NM_007294.3(BRCA1):c.5030_5033delCTAA (p.Thr1677Ilefs) rs80357580
NM_007294.3(BRCA1):c.5034T>C (p.Asn1678=) rs898511378
NM_007294.3(BRCA1):c.5035_5039delCTAAT (p.Leu1679Tyrfs) rs80357623
NM_007294.3(BRCA1):c.5035delC (p.Leu1679Terfs) rs80357896
NM_007294.3(BRCA1):c.5041A>C (p.Thr1681Pro) rs876659314
NM_007294.3(BRCA1):c.5042C>T (p.Thr1681Ile) rs766784305
NM_007294.3(BRCA1):c.5050A>G (p.Thr1684Ala) rs879255491
NM_007294.3(BRCA1):c.5050_5051delAC (p.Thr1684Tyrfs) rs879255283
NM_007294.3(BRCA1):c.5052T>A (p.Thr1684=)
NM_007294.3(BRCA1):c.5052T>C (p.Thr1684=) rs760922019
NM_007294.3(BRCA1):c.5053A>G (p.Thr1685Ala) rs80356890
NM_007294.3(BRCA1):c.5057A>C (p.His1686Pro)
NM_007294.3(BRCA1):c.5057A>G (p.His1686Arg) rs730882166
NM_007294.3(BRCA1):c.5058T>C (p.His1686=) rs397509218
NM_007294.3(BRCA1):c.5059delG (p.Val1687Leufs) rs1555579633
NM_007294.3(BRCA1):c.505C>T (p.Gln169Ter) rs80357133
NM_007294.3(BRCA1):c.5061T>C (p.Val1687=) rs1555579625
NM_007294.3(BRCA1):c.5062_5064delGTT (p.Val1688del) rs80358344
NM_007294.3(BRCA1):c.5065A>G (p.Met1689Val) rs1555579619
NM_007294.3(BRCA1):c.5066T>C (p.Met1689Thr) rs80357061
NM_007294.3(BRCA1):c.5066T>G (p.Met1689Arg) rs80357061
NM_007294.3(BRCA1):c.5068A>C (p.Lys1690Gln) rs397507239
NM_007294.3(BRCA1):c.5071A>G (p.Thr1691Ala) rs397509219
NM_007294.3(BRCA1):c.5072C>A (p.Thr1691Lys) rs80357034
NM_007294.3(BRCA1):c.5072C>T (p.Thr1691Ile) rs80357034
NM_007294.3(BRCA1):c.5073A>G (p.Thr1691=) rs80356853
NM_007294.3(BRCA1):c.5074+14C>T rs370299792
NM_007294.3(BRCA1):c.5074+1G>A rs80358053
NM_007294.3(BRCA1):c.5074+1G>T rs80358053
NM_007294.3(BRCA1):c.5074+2T>C rs80358089
NM_007294.3(BRCA1):c.5074+5A>T rs431825411
NM_007294.3(BRCA1):c.5074+6C>G rs80358032
NM_007294.3(BRCA1):c.5074G>A (p.Asp1692Asn) rs80187739
NM_007294.3(BRCA1):c.5074G>C (p.Asp1692His) rs80187739
NM_007294.3(BRCA1):c.5075-1G>A rs1800747
NM_007294.3(BRCA1):c.5075-2del rs886040913
NM_007294.3(BRCA1):c.5075-3C>T rs398122690
NM_007294.3(BRCA1):c.5075-53C>T rs8176258
NM_007294.3(BRCA1):c.5075-67T>C
NM_007294.3(BRCA1):c.5075-6C>A rs397507240
NM_007294.3(BRCA1):c.5075-742T>A rs8176253
NM_007294.3(BRCA1):c.5075-9A>T rs80358059
NM_007294.3(BRCA1):c.5075A>T (p.Asp1692Val) rs397509222
NM_007294.3(BRCA1):c.5078C>T (p.Ala1693Val)
NM_007294.3(BRCA1):c.5078_5080delCTG (p.Ala1693del) rs80358345
NM_007294.3(BRCA1):c.507G>A (p.Gln169=) rs759882045
NM_007294.3(BRCA1):c.5080G>T (p.Glu1694Ter) rs80356896
NM_007294.3(BRCA1):c.5080delG (p.Glu1694Serfs) rs1555578650
NM_007294.3(BRCA1):c.5085T>A (p.Phe1695Leu) rs80357387
NM_007294.3(BRCA1):c.5086G>C (p.Val1696Leu) rs80357125
NM_007294.3(BRCA1):c.5087T>C (p.Val1696Ala)
NM_007294.3(BRCA1):c.5089T>A (p.Cys1697Ser) rs80356993
NM_007294.3(BRCA1):c.5089T>C (p.Cys1697Arg) rs80356993
NM_007294.3(BRCA1):c.508C>T (p.Arg170Trp) rs80357325
NM_007294.3(BRCA1):c.5090G>A (p.Cys1697Tyr) rs397507241
NM_007294.3(BRCA1):c.5094A>G (p.Glu1698=) rs764891781
NM_007294.3(BRCA1):c.5095C>A (p.Arg1699=) rs55770810
NM_007294.3(BRCA1):c.5095C>T (p.Arg1699Trp) rs55770810
NM_007294.3(BRCA1):c.5096G>A (p.Arg1699Gln) rs41293459
NM_007294.3(BRCA1):c.5098A>C (p.Thr1700Pro) rs397509227
NM_007294.3(BRCA1):c.509G>A (p.Arg170Gln) rs80357264
NM_007294.3(BRCA1):c.5100A>G (p.Thr1700=) rs45519437
NM_007294.3(BRCA1):c.5101C>A (p.Leu1701Met) rs910555398
NM_007294.3(BRCA1):c.5106delA (p.Lys1702Asnfs) rs80357553
NM_007294.3(BRCA1):c.5108A>G (p.Tyr1703Cys) rs876660071
NM_007294.3(BRCA1):c.5109T>G (p.Tyr1703Ter) rs80356974
NM_007294.3(BRCA1):c.5111T>A (p.Phe1704Tyr) rs1555578598
NM_007294.3(BRCA1):c.5112delT (p.Leu1705Terfs) rs397509228
NM_007294.3(BRCA1):c.5113C>G (p.Leu1705Val) rs80356858
NM_007294.3(BRCA1):c.5117G>A (p.Gly1706Glu) rs80356860
NM_007294.3(BRCA1):c.5117G>C (p.Gly1706Ala) rs80356860
NM_007294.3(BRCA1):c.5120T>C (p.Ile1707Thr) rs1064796143
NM_007294.3(BRCA1):c.5122G>A (p.Ala1708Thr) rs397507243
NM_007294.3(BRCA1):c.5123C>A (p.Ala1708Glu) rs28897696
NM_007294.3(BRCA1):c.5123C>T (p.Ala1708Val) rs28897696
NM_007294.3(BRCA1):c.5124G>A (p.Ala1708=) rs1057520432
NM_007294.3(BRCA1):c.5125G>A (p.Gly1709Arg) rs886038197
NM_007294.3(BRCA1):c.5129G>A (p.Gly1710Glu) rs398122691
NM_007294.3(BRCA1):c.512dupT (p.Gln172Thrfs) rs587781487
NM_007294.3(BRCA1):c.5135G>A (p.Trp1712Ter) rs876658672
NM_007294.3(BRCA1):c.5136G>A (p.Trp1712Ter) rs80357418
NM_007294.3(BRCA1):c.5137delG (p.Val1713Terfs) rs80357997
NM_007294.3(BRCA1):c.5139A>G (p.Val1713=) rs1555578550
NM_007294.3(BRCA1):c.5140G>T (p.Val1714Phe)
NM_007294.3(BRCA1):c.5141T>C (p.Val1714Ala)
NM_007294.3(BRCA1):c.5141T>G (p.Val1714Gly) rs80357243
NM_007294.3(BRCA1):c.5142T>G (p.Val1714=) rs749319480
NM_007294.3(BRCA1):c.5143A>T (p.Ser1715Cys) rs80357222
NM_007294.3(BRCA1):c.5146_5148delTATinsAAA (p.Tyr1716Lys) rs1555578543
NM_007294.3(BRCA1):c.5147A>C (p.Tyr1716Ser) rs587782456
NM_007294.3(BRCA1):c.5147A>G (p.Tyr1716Cys) rs587782456
NM_007294.3(BRCA1):c.514delC (p.Gln172Asnfs) rs80357872
NM_007294.3(BRCA1):c.5150delT (p.Phe1717Serfs) rs80357720
NM_007294.3(BRCA1):c.5152+10A>G rs80358114
NM_007294.3(BRCA1):c.5152+15A>G rs750905289
NM_007294.3(BRCA1):c.5152+1G>A rs80358094
NM_007294.3(BRCA1):c.5152+1G>T rs80358094
NM_007294.3(BRCA1):c.5152+20T>A rs376836050
NM_007294.3(BRCA1):c.5152+2T>C rs886040914
NM_007294.3(BRCA1):c.5152+65C>T
NM_007294.3(BRCA1):c.5152+66G>A rs3092994
NM_007294.3(BRCA1):c.5152+7A>G rs80358046
NM_007294.3(BRCA1):c.5152+8T>C
NM_007294.3(BRCA1):c.5152+9A>G rs1060504576
NM_007294.3(BRCA1):c.5152+9A>T rs1060504576
NM_007294.3(BRCA1):c.5152T>G (p.Trp1718Gly)
NM_007294.3(BRCA1):c.5153-11G>A
NM_007294.3(BRCA1):c.5153-12T>A
NM_007294.3(BRCA1):c.5153-13A>G rs45471406
NM_007294.3(BRCA1):c.5153-150A>C rs869312520
NM_007294.3(BRCA1):c.5153-16_5156del20insAATA rs587781526
NM_007294.3(BRCA1):c.5153-2A>G rs786202545
NM_007294.3(BRCA1):c.5153-2delA rs273901746
NM_007294.3(BRCA1):c.5153-3T>C rs375639469
NM_007294.3(BRCA1):c.5153-6C>A rs80358129
NM_007294.3(BRCA1):c.5153-8C>A rs1060504570
NM_007294.3(BRCA1):c.5153G>A (p.Trp1718Ter) rs41293461
NM_007294.3(BRCA1):c.5154G>A (p.Trp1718Ter) rs80357239
NM_007294.3(BRCA1):c.5154G>T (p.Trp1718Cys) rs80357239
NM_007294.3(BRCA1):c.5156T>G (p.Val1719Gly) rs1247437511
NM_007294.3(BRCA1):c.5157G>A (p.Val1719=) rs28897697
NM_007294.3(BRCA1):c.5157G>T (p.Val1719=) rs28897697
NM_007294.3(BRCA1):c.5158A>G (p.Thr1720Ala) rs56195342
NM_007294.3(BRCA1):c.515A>G (p.Gln172Arg) rs1555594863
NM_007294.3(BRCA1):c.5161C>G (p.Gln1721Glu) rs878854957
NM_007294.3(BRCA1):c.5161C>T (p.Gln1721Ter) rs878854957
NM_007294.3(BRCA1):c.5163G>A (p.Gln1721=) rs1403122031
NM_007294.3(BRCA1):c.5164T>C (p.Ser1722Pro) rs483353100
NM_007294.3(BRCA1):c.5165C>A (p.Ser1722Tyr) rs80357104
NM_007294.3(BRCA1):c.5165C>T (p.Ser1722Phe) rs80357104
NM_007294.3(BRCA1):c.5175A>G (p.Glu1725=) rs191373374
NM_007294.3(BRCA1):c.5176A>G (p.Arg1726Gly) rs80357501
NM_007294.3(BRCA1):c.5176delA (p.Arg1726Glufs) rs876658478
NM_007294.3(BRCA1):c.5177G>T (p.Arg1726Ile) rs786203547
NM_007294.3(BRCA1):c.5179A>T (p.Lys1727Ter) rs80357347
NM_007294.3(BRCA1):c.5186T>A (p.Leu1729Gln) rs730881496
NM_007294.3(BRCA1):c.5189A>G (p.Asn1730Ser) rs80357171
NM_007294.3(BRCA1):c.5189A>T (p.Asn1730Ile) rs80357171
NM_007294.3(BRCA1):c.5191G>T (p.Glu1731Ter) rs397507244
NM_007294.3(BRCA1):c.5193+11G>T
NM_007294.3(BRCA1):c.5193+19A>G rs1555578276
NM_007294.3(BRCA1):c.5193+1G>C rs80358004
NM_007294.3(BRCA1):c.5193+2delT rs273901751
NM_007294.3(BRCA1):c.5193+3A>G rs1060502326
NM_007294.3(BRCA1):c.5193+3_5193+15del rs273901752
NM_007294.3(BRCA1):c.5193+67C>T rs1555578259
NM_007294.3(BRCA1):c.5193G>A (p.Glu1731=) rs876660702
NM_007294.3(BRCA1):c.5194-10_5236dup rs1555576921
NM_007294.3(BRCA1):c.5194-12G>A rs80358079
NM_007294.3(BRCA1):c.5194-18G>A
NM_007294.3(BRCA1):c.5194-18G>T rs80358090
NM_007294.3(BRCA1):c.5194-2A>C rs80358069
NM_007294.3(BRCA1):c.5194-2A>G rs80358069
NM_007294.3(BRCA1):c.5197G>C (p.Asp1733His)
NM_007294.3(BRCA1):c.5198A>G (p.Asp1733Gly) rs80357270
NM_007294.3(BRCA1):c.5198A>T (p.Asp1733Val) rs80357270
NM_007294.3(BRCA1):c.519T>A (p.Pro173=) rs876659179
NM_007294.3(BRCA1):c.5200T>A (p.Phe1734Ile) rs80356957
NM_007294.3(BRCA1):c.5202T>G (p.Phe1734Leu) rs869320780
NM_007294.3(BRCA1):c.5202delT (p.Phe1734Leufs) rs876659867
NM_007294.3(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.3(BRCA1):c.520delC (p.Gln174Lysfs) rs80357639
NM_007294.3(BRCA1):c.5212G>A (p.Gly1738Arg) rs80356937
NM_007294.3(BRCA1):c.5213_5215delGAG (p.Gly1738del) rs80358347
NM_007294.3(BRCA1):c.5215G>A (p.Asp1739Asn) rs80357283
NM_007294.3(BRCA1):c.5215G>C (p.Asp1739His) rs80357283
NM_007294.3(BRCA1):c.5219T>C (p.Val1740Ala) rs1555576951
NM_007294.3(BRCA1):c.5219_5224delTGGTCA (p.Val1740_Asn1742delinsAsp) rs1555576941
NM_007294.3(BRCA1):c.521A>G (p.Gln174Arg)
NM_007294.3(BRCA1):c.5221G>A (p.Val1741Ile) rs876659122
NM_007294.3(BRCA1):c.5225A>G (p.Asn1742Ser) rs864622104
NM_007294.3(BRCA1):c.522A>G (p.Gln174=) rs765432756
NM_007294.3(BRCA1):c.5230delA (p.Arg1744Glufs) rs397509240
NM_007294.3(BRCA1):c.5236C>A (p.His1746Asn) rs80357146
NM_007294.3(BRCA1):c.5236delC (p.His1746Thrfs) rs876659483
NM_007294.3(BRCA1):c.5237A>C (p.His1746Pro) rs876659991
NM_007294.3(BRCA1):c.5238C>G (p.His1746Gln) rs786202389
NM_007294.3(BRCA1):c.5239C>T (p.Gln1747Ter) rs80357367
NM_007294.3(BRCA1):c.5239delC (p.Gln1747Lysfs) rs886040282
NM_007294.3(BRCA1):c.5242G>T (p.Gly1748Cys) rs397507245
NM_007294.3(BRCA1):c.5243G>A (p.Gly1748Asp) rs397509243
NM_007294.3(BRCA1):c.5245C>A (p.Pro1749Thr) rs397509244
NM_007294.3(BRCA1):c.5250delG (p.Lys1750Asnfs) rs1555576868
NM_007294.3(BRCA1):c.5251C>T (p.Arg1751Ter) rs80357123
NM_007294.3(BRCA1):c.5252G>A (p.Arg1751Gln) rs80357442
NM_007294.3(BRCA1):c.5252G>C (p.Arg1751Pro) rs80357442
NM_007294.3(BRCA1):c.5254G>C (p.Ala1752Pro) rs80357074
NM_007294.3(BRCA1):c.5255C>G (p.Ala1752Gly) rs80357028
NM_007294.3(BRCA1):c.5258G>C (p.Arg1753Thr) rs397509246
NM_007294.3(BRCA1):c.5259A>G (p.Arg1753=) rs771577266
NM_007294.3(BRCA1):c.5260G>C (p.Glu1754Gln) rs80357432
NM_007294.3(BRCA1):c.5266C>T (p.Gln1756Ter) rs397509247
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs397507247
NM_007294.3(BRCA1):c.5269G>T (p.Asp1757Tyr) rs863224764
NM_007294.3(BRCA1):c.5269_5273delGACAG (p.Asp1757Lysfs) rs786202040
NM_007294.3(BRCA1):c.5274A>G (p.Arg1758=) rs758739620
NM_007294.3(BRCA1):c.5276A>G (p.Lys1759Arg) rs431825415
NM_007294.3(BRCA1):c.5277+11C>T rs1555576819
NM_007294.3(BRCA1):c.5277+14C>A
NM_007294.3(BRCA1):c.5277+17C>G rs749918224
NM_007294.3(BRCA1):c.5277+1G>A rs80358150
NM_007294.3(BRCA1):c.5277+1delG rs273901754
NM_007294.3(BRCA1):c.5277+20G>A rs766950602
NM_007294.3(BRCA1):c.5277+3A>G
NM_007294.3(BRCA1):c.5277+48_5277+59dup rs572766355
NM_007294.3(BRCA1):c.5277+4A>G rs397509251
NM_007294.3(BRCA1):c.5277+50A>G
NM_007294.3(BRCA1):c.5277G>A (p.Lys1759=) rs80356854
NM_007294.3(BRCA1):c.5277G>T (p.Lys1759Asn) rs80356854
NM_007294.3(BRCA1):c.5278-11T>C
NM_007294.3(BRCA1):c.5278-14C>G rs80358105
NM_007294.3(BRCA1):c.5278-18C>G rs1555575750
NM_007294.3(BRCA1):c.5278-1G>A rs80358099
NM_007294.3(BRCA1):c.5278-1G>C rs80358099
NM_007294.3(BRCA1):c.5278-1G>T rs80358099
NM_007294.3(BRCA1):c.5278-20C>T rs193149108
NM_007294.3(BRCA1):c.5278-2A>T rs397509253
NM_007294.3(BRCA1):c.5278-3C>T rs786203963
NM_007294.3(BRCA1):c.527C>G (p.Thr176Arg) rs587782747
NM_007294.3(BRCA1):c.527C>T (p.Thr176Met) rs587782747
NM_007294.3(BRCA1):c.5280C>A (p.Ile1760=) rs750040616
NM_007294.3(BRCA1):c.5280C>T (p.Ile1760=) rs750040616
NM_007294.3(BRCA1):c.5281T>C (p.Phe1761Leu)
NM_007294.3(BRCA1):c.5282T>C (p.Phe1761Ser) rs80356905
NM_007294.3(BRCA1):c.5285G>T (p.Arg1762Met) rs398122694
NM_007294.3(BRCA1):c.5287G>C (p.Gly1763Arg) rs876660907
NM_007294.3(BRCA1):c.5289G>A (p.Gly1763=) rs1022076404
NM_007294.3(BRCA1):c.5289G>C (p.Gly1763=) rs1022076404
NM_007294.3(BRCA1):c.528G>A (p.Thr176=) rs34545365
NM_007294.3(BRCA1):c.5291T>C (p.Leu1764Pro) rs80357281
NM_007294.3(BRCA1):c.5293G>T (p.Glu1765Ter) rs397509256
NM_007294.3(BRCA1):c.5296A>G (p.Ile1766Val) rs886039314
NM_007294.3(BRCA1):c.5296dup (p.Ile1766Asnfs) rs1555575732
NM_007294.3(BRCA1):c.5297T>G (p.Ile1766Ser) rs80357463
NM_007294.3(BRCA1):c.5299T>C (p.Cys1767Arg)
NM_007294.3(BRCA1):c.529T>A (p.Ser177Thr) rs1555594827
NM_007294.3(BRCA1):c.5302T>G (p.Cys1768Gly) rs431825416
NM_007294.3(BRCA1):c.5304C>T (p.Cys1768=) rs138493864
NM_007294.3(BRCA1):c.5306A>G (p.Tyr1769Cys) rs397509257
NM_007294.3(BRCA1):c.530C>G (p.Ser177Cys) rs753940026
NM_007294.3(BRCA1):c.5310G>A (p.Gly1770=) rs273901761
NM_007294.3(BRCA1):c.5310G>C (p.Gly1770=) rs273901761
NM_007294.3(BRCA1):c.5310_5311delGC (p.Pro1771Leufs) rs587781825
NM_007294.3(BRCA1):c.5312C>T (p.Pro1771Leu) rs80357025
NM_007294.3(BRCA1):c.5317A>T (p.Thr1773Ser) rs80357324
NM_007294.3(BRCA1):c.5318C>T (p.Thr1773Ile) rs80357428
NM_007294.3(BRCA1):c.5319dupC (p.Asn1774Glnfs) rs80357823
NM_007294.3(BRCA1):c.5320_5321delAA (p.Asn1774Hisfs) rs80357818
NM_007294.3(BRCA1):c.5321A>G (p.Asn1774Ser) rs587781770
NM_007294.3(BRCA1):c.5324T>G (p.Met1775Arg) rs41293463
NM_007294.3(BRCA1):c.5327C>A (p.Pro1776His) rs398122695
NM_007294.3(BRCA1):c.5327C>T (p.Pro1776Leu) rs398122695
NM_007294.3(BRCA1):c.5328C>T (p.Pro1776=) rs759867616
NM_007294.3(BRCA1):c.5328delC (p.Thr1777Glnfs) rs80357751
NM_007294.3(BRCA1):c.532G>C (p.Val178Leu) rs1259369962
NM_007294.3(BRCA1):c.5332+13G>C
NM_007294.3(BRCA1):c.5332+13G>T rs372391060
NM_007294.3(BRCA1):c.5332+15G>C rs80358148
NM_007294.3(BRCA1):c.5332+18C>A
NM_007294.3(BRCA1):c.5332+1G>A rs80358041
NM_007294.3(BRCA1):c.5332+1G>T rs80358041
NM_007294.3(BRCA1):c.5332+20C>A rs1057521961
NM_007294.3(BRCA1):c.5332+3A>G rs766614917
NM_007294.3(BRCA1):c.5332+4A>G rs80358166
NM_007294.3(BRCA1):c.5332+7G>T rs773655919
NM_007294.3(BRCA1):c.5332G>A (p.Asp1778Asn) rs80357112
NM_007294.3(BRCA1):c.5333-105T>C rs555270550
NM_007294.3(BRCA1):c.5333-119G>A
NM_007294.3(BRCA1):c.5333-119_5333-118delGA rs1555575256
NM_007294.3(BRCA1):c.5333-130T>C rs774365187
NM_007294.3(BRCA1):c.5333-134C>A rs8176306
NM_007294.3(BRCA1):c.5333-144A>C
NM_007294.3(BRCA1):c.5333-153A>G rs8176305
NM_007294.3(BRCA1):c.5333-156C>T
NM_007294.3(BRCA1):c.5333-157C>A
NM_007294.3(BRCA1):c.5333-157C>G
NM_007294.3(BRCA1):c.5333-179C>A rs573933693
NM_007294.3(BRCA1):c.5333-180G>A
NM_007294.3(BRCA1):c.5333-181G>A
NM_007294.3(BRCA1):c.5333-183G>C rs1555575278
NM_007294.3(BRCA1):c.5333-192G>C rs1555575283
NM_007294.3(BRCA1):c.5333-194A>C rs530647658
NM_007294.3(BRCA1):c.5333-194A>G rs530647658
NM_007294.3(BRCA1):c.5333-197T>C rs1555575286
NM_007294.3(BRCA1):c.5333-201A>G rs1555575289
NM_007294.3(BRCA1):c.5333-216T>C rs1555575293
NM_007294.3(BRCA1):c.5333-220C>T
NM_007294.3(BRCA1):c.5333-221C>A rs8176304
NM_007294.3(BRCA1):c.5333-223G>A rs78467612
NM_007294.3(BRCA1):c.5333-231T>A rs1370196973
NM_007294.3(BRCA1):c.5333-231T>C
NM_007294.3(BRCA1):c.5333-233T>C rs1185493710
NM_007294.3(BRCA1):c.5333-237A>C rs1396982732
NM_007294.3(BRCA1):c.5333-240C>A rs1251476553
NM_007294.3(BRCA1):c.5333-246_5333-245delGA rs1555575309
NM_007294.3(BRCA1):c.5333-249A>G rs1555575311
NM_007294.3(BRCA1):c.5333-250G>C
NM_007294.3(BRCA1):c.5333-251T>C
NM_007294.3(BRCA1):c.5333-254A>G rs8176303
NM_007294.3(BRCA1):c.5333-258T>C rs1555575315
NM_007294.3(BRCA1):c.5333-260C>A
NM_007294.3(BRCA1):c.5333-261G>A rs936474860
NM_007294.3(BRCA1):c.5333-265T>C rs1555575320
NM_007294.3(BRCA1):c.5333-265T>G
NM_007294.3(BRCA1):c.5333-269delT rs995803266
NM_007294.3(BRCA1):c.5333-269dup rs995803266
NM_007294.3(BRCA1):c.5333-271T>C rs1354176978
NM_007294.3(BRCA1):c.5333-272T>C rs1555575328
NM_007294.3(BRCA1):c.5333-278A>G rs1555575329
NM_007294.3(BRCA1):c.5333-279G>A
NM_007294.3(BRCA1):c.5333-283C>G rs1555575333
NM_007294.3(BRCA1):c.5333-286G>A rs1555575335
NM_007294.3(BRCA1):c.5333-297_5333-285delAATGGAAATTAGA
NM_007294.3(BRCA1):c.5333-298_5333-287delTAATGGAAATTA
NM_007294.3(BRCA1):c.5333-2A>T rs397509264
NM_007294.3(BRCA1):c.5333-300A>G
NM_007294.3(BRCA1):c.5333-302A>C
NM_007294.3(BRCA1):c.5333-304G>A rs55633264
NM_007294.3(BRCA1):c.5333-310_5333-308delAAT
NM_007294.3(BRCA1):c.5333-312_5333-311insTGT
NM_007294.3(BRCA1):c.5333-314C>G
NM_007294.3(BRCA1):c.5333-314_5333-311delCAGC rs1292180290
NM_007294.3(BRCA1):c.5333-320C>T
NM_007294.3(BRCA1):c.5333-326_5333-325delCA rs1161578161
NM_007294.3(BRCA1):c.5333-356G>T
NM_007294.3(BRCA1):c.5333-358_5333-342dup rs1555575338
NM_007294.3(BRCA1):c.5333-359_5333-352delAAGGGAGG rs1555575339
NM_007294.3(BRCA1):c.5333-359_5333-356dup rs1471819001
NM_007294.3(BRCA1):c.5333-35A>C rs775618857
NM_007294.3(BRCA1):c.5333-376A>G
NM_007294.3(BRCA1):c.5333-378_5333-367del
NM_007294.3(BRCA1):c.5333-385delC rs1555575342
NM_007294.3(BRCA1):c.5333-386C>G rs971560197
NM_007294.3(BRCA1):c.5333-397A>T rs1555575345
NM_007294.3(BRCA1):c.5333-400G>A rs191000183
NM_007294.3(BRCA1):c.5333-401C>T rs913600265
NM_007294.3(BRCA1):c.5333-406G>A
NM_007294.3(BRCA1):c.5333-409T>C
NM_007294.3(BRCA1):c.5333-40A>C rs369978584
NM_007294.3(BRCA1):c.5333-415G>A rs1555575352
NM_007294.3(BRCA1):c.5333-421A>C
NM_007294.3(BRCA1):c.5333-423C>A
NM_007294.3(BRCA1):c.5333-423C>T rs1555575355
NM_007294.3(BRCA1):c.5333-425A>G
NM_007294.3(BRCA1):c.5333-426C>T rs554307369
NM_007294.3(BRCA1):c.5333-427C>T rs1555575359
NM_007294.3(BRCA1):c.5333-440T>C rs1555575360
NM_007294.3(BRCA1):c.5333-442C>T rs750964493
NM_007294.3(BRCA1):c.5333-444_5333-442delGAC rs1555575361
NM_007294.3(BRCA1):c.5333-445delT
NM_007294.3(BRCA1):c.5333-447C>T rs1555575364
NM_007294.3(BRCA1):c.5333-447_5333-442delinsT rs1555575362
NM_007294.3(BRCA1):c.5333-447_5333-446delCT rs1555575363
NM_007294.3(BRCA1):c.5333-449C>T
NM_007294.3(BRCA1):c.5333-468G>C rs889346691
NM_007294.3(BRCA1):c.5333-469T>A
NM_007294.3(BRCA1):c.5333-469T>C rs1008149175
NM_007294.3(BRCA1):c.5333-471A>G
NM_007294.3(BRCA1):c.5333-483T>G
NM_007294.3(BRCA1):c.5333-484A>G
NM_007294.3(BRCA1):c.5333-490delG rs1200649620
NM_007294.3(BRCA1):c.5333-491G>A rs3092988
NM_007294.3(BRCA1):c.5333-493C>A rs1198727747
NM_007294.3(BRCA1):c.5333-493_5333-491delCAGinsAA
NM_007294.3(BRCA1):c.5333-498C>G rs993629945
NM_007294.3(BRCA1):c.5333-49T>C rs1247333490
NM_007294.3(BRCA1):c.5333-508delT
NM_007294.3(BRCA1):c.5333-511C>T rs1555575384
NM_007294.3(BRCA1):c.5333-514T>G rs912297547
NM_007294.3(BRCA1):c.5333-520G>C
NM_007294.3(BRCA1):c.5333-521T>A rs182657324
NM_007294.3(BRCA1):c.5333-521T>C rs182657324
NM_007294.3(BRCA1):c.5333-52G>C
NM_007294.3(BRCA1):c.5333-532C>G
NM_007294.3(BRCA1):c.5333-542T>A rs577189905
NM_007294.3(BRCA1):c.5333-65G>A rs1555575250
NM_007294.3(BRCA1):c.5333-68T>C
NM_007294.3(BRCA1):c.5333-6T>G rs397509266
NM_007294.3(BRCA1):c.5333-72_5333-71delAG rs1418295859
NM_007294.3(BRCA1):c.5333-76G>A rs993908386
NM_007294.3(BRCA1):c.5333-77C>T rs1026311651
NM_007294.3(BRCA1):c.5333-786G>A rs546185232
NM_007294.3(BRCA1):c.5333-7A>G rs538969920
NM_007294.3(BRCA1):c.5333-832T>C rs869312514
NM_007294.3(BRCA1):c.5333-88A>G
NM_007294.3(BRCA1):c.5333-8C>T rs80358084
NM_007294.3(BRCA1):c.5333-93dup
NM_007294.3(BRCA1):c.5333A>G (p.Asp1778Gly) rs80357041
NM_007294.3(BRCA1):c.5334T>C (p.Asp1778=) rs754152768
NM_007294.3(BRCA1):c.5335C>T (p.Gln1779Ter) rs397509267
NM_007294.3(BRCA1):c.5335delC (p.Gln1779Asnfs) rs80357590
NM_007294.3(BRCA1):c.5337A>G (p.Gln1779=) rs876659718
NM_007294.3(BRCA1):c.5339T>C (p.Leu1780Pro) rs80357474
NM_007294.3(BRCA1):c.5339T>G (p.Leu1780Arg) rs80357474
NM_007294.3(BRCA1):c.533T>A (p.Val178Asp) rs876660085
NM_007294.3(BRCA1):c.5343A>C (p.Glu1781Asp) rs1555575182
NM_007294.3(BRCA1):c.5345G>A (p.Trp1782Ter) rs80357219
NM_007294.3(BRCA1):c.5346G>A (p.Trp1782Ter) rs80357284
NM_007294.3(BRCA1):c.5347A>C (p.Met1783Leu) rs80357012
NM_007294.3(BRCA1):c.5348T>C (p.Met1783Thr) rs55808233
NM_007294.3(BRCA1):c.5349G>A (p.Met1783Ile) rs587782019
NM_007294.3(BRCA1):c.5352A>T (p.Val1784=) rs767459025
NM_007294.3(BRCA1):c.5353C>T (p.Gln1785Ter) rs80356969
NM_007294.3(BRCA1):c.5354A>C (p.Gln1785Pro) rs876660057
NM_007294.3(BRCA1):c.5357T>C (p.Leu1786Pro) rs398122697
NM_007294.3(BRCA1):c.5359T>A (p.Cys1787Ser) rs80357065
NM_007294.3(BRCA1):c.5359_5363delTGTGGinsAGTGA (p.Cys1787_Gly1788delinsSerAsp) rs786203663
NM_007294.3(BRCA1):c.535T>C (p.Tyr179His) rs587781761
NM_007294.3(BRCA1):c.5361_5362delTG (p.Cys1787Trpfs) rs886040294
NM_007294.3(BRCA1):c.5362G>T (p.Gly1788Cys) rs397509271
NM_007294.3(BRCA1):c.5363G>A (p.Gly1788Asp) rs80357069
NM_007294.3(BRCA1):c.5363G>T (p.Gly1788Val) rs80357069
NM_007294.3(BRCA1):c.5365G>A (p.Ala1789Thr) rs80357078
NM_007294.3(BRCA1):c.5365G>C (p.Ala1789Pro)
NM_007294.3(BRCA1):c.5365G>T (p.Ala1789Ser) rs80357078
NM_007294.3(BRCA1):c.5368T>C (p.Ser1790Pro)
NM_007294.3(BRCA1):c.536A>G (p.Tyr179Cys) rs56187033
NM_007294.3(BRCA1):c.5371G>A (p.Val1791Met) rs145758886
NM_007294.3(BRCA1):c.5371G>T (p.Val1791Leu) rs145758886
NM_007294.3(BRCA1):c.5374G>C (p.Val1792Leu) rs1555575131
NM_007294.3(BRCA1):c.5383C>A (p.Leu1795Ile)
NM_007294.3(BRCA1):c.5387C>A (p.Ser1796Ter) rs80357055
NM_007294.3(BRCA1):c.5388A>G (p.Ser1796=) rs373810778
NM_007294.3(BRCA1):c.538A>C (p.Ile180Leu) rs1555594803
NM_007294.3(BRCA1):c.5390C>A (p.Ser1797Ter) rs879255492
NM_007294.3(BRCA1):c.5396C>T (p.Thr1799Ile) rs786201945
NM_007294.3(BRCA1):c.539T>C (p.Ile180Thr)
NM_007294.3(BRCA1):c.53T>C (p.Met18Thr) rs80356929
NM_007294.3(BRCA1):c.5402G>A (p.Gly1801Asp) rs531210457
NM_007294.3(BRCA1):c.5404A>C (p.Thr1802Pro) rs1555575080
NM_007294.3(BRCA1):c.5406+11G>T rs892136580
NM_007294.3(BRCA1):c.5406+12G>A rs1555575069
NM_007294.3(BRCA1):c.5406+12G>T
NM_007294.3(BRCA1):c.5406+33A>T rs80358092
NM_007294.3(BRCA1):c.5406+5G>C rs80358073
NM_007294.3(BRCA1):c.5406+5G>T rs80358073
NM_007294.3(BRCA1):c.5406+8T>C rs55946644
NM_007294.3(BRCA1):c.5406A>C (p.Thr1802=) rs879255493
NM_007294.3(BRCA1):c.5407-4C>G rs876660347
NM_007294.3(BRCA1):c.5407G>A (p.Gly1803Ser) rs876659510
NM_007294.3(BRCA1):c.5408G>T (p.Gly1803Val)
NM_007294.3(BRCA1):c.5411T>A (p.Val1804Asp) rs80356920
NM_007294.3(BRCA1):c.5412C>T (p.Val1804=) rs730881456
NM_007294.3(BRCA1):c.5413C>T (p.His1805Tyr) rs587782873
NM_007294.3(BRCA1):c.5415C>T (p.His1805=) rs1060504559
NM_007294.3(BRCA1):c.5416C>G (p.Pro1806Ala) rs80357241
NM_007294.3(BRCA1):c.5417delC (p.Pro1806Glnfs) rs80357558
NM_007294.3(BRCA1):c.5418A>C (p.Pro1806=) rs1555574766
NM_007294.3(BRCA1):c.5419A>G (p.Ile1807Val) rs786202721
NM_007294.3(BRCA1):c.5422G>T (p.Val1808Leu) rs1555574756
NM_007294.3(BRCA1):c.5423T>G (p.Val1808Gly) rs80357358
NM_007294.3(BRCA1):c.5424G>C (p.Val1808=) rs1555574748
NM_007294.3(BRCA1):c.5429T>C (p.Val1810Ala) rs80357451
NM_007294.3(BRCA1):c.5430G>A (p.Val1810=) rs786201582
NM_007294.3(BRCA1):c.5432A>G (p.Gln1811Arg) rs80357040
NM_007294.3(BRCA1):c.5433G>C (p.Gln1811His) rs4438367
NM_007294.3(BRCA1):c.5434C>G (p.Pro1812Ala) rs1800751
NM_007294.3(BRCA1):c.5437G>T (p.Asp1813Tyr) rs1303996018
NM_007294.3(BRCA1):c.5438A>T (p.Asp1813Val) rs1555574715
NM_007294.3(BRCA1):c.5439T>C (p.Asp1813=) rs760396669
NM_007294.3(BRCA1):c.543A>G (p.Glu181=) rs397507250
NM_007294.3(BRCA1):c.5444G>A (p.Trp1815Ter) rs80356962
NM_007294.3(BRCA1):c.5444G>C (p.Trp1815Ser)
NM_007294.3(BRCA1):c.5445G>A (p.Trp1815Ter) rs397509284
NM_007294.3(BRCA1):c.5447C>A (p.Thr1816Lys)
NM_007294.3(BRCA1):c.5450_5451delAG (p.Glu1817Glyfs) rs397509286
NM_007294.3(BRCA1):c.5453A>G (p.Asp1818Gly) rs80357477
NM_007294.3(BRCA1):c.5454C>T (p.Asp1818=) rs1555574705
NM_007294.3(BRCA1):c.5456A>G (p.Asn1819Ser) rs80357286
NM_007294.3(BRCA1):c.5458G>A (p.Gly1820Ser) rs398122698
NM_007294.3(BRCA1):c.5463_5464insT (p.His1822Serfs) rs1057518636
NM_007294.3(BRCA1):c.5466T>C (p.His1822=) rs886052975
NM_007294.3(BRCA1):c.5467+12G>A rs991060806
NM_007294.3(BRCA1):c.5467+15T>C
NM_007294.3(BRCA1):c.5467+1G>A rs80358145
NM_007294.3(BRCA1):c.5467+2T>C rs80358009
NM_007294.3(BRCA1):c.5467+4A>G rs1555574692
NM_007294.3(BRCA1):c.5467+741C>A rs76558677
NM_007294.3(BRCA1):c.5467+8G>A rs80358062
NM_007294.3(BRCA1):c.5467+9C>A
NM_007294.3(BRCA1):c.5468-10C>A rs8176316
NM_007294.3(BRCA1):c.5468-10_5468-9delCT rs273902770
NM_007294.3(BRCA1):c.5468-17G>A rs80358176
NM_007294.3(BRCA1):c.5468-20C>T
NM_007294.3(BRCA1):c.546G>T (p.Leu182Phe) rs1464752950
NM_007294.3(BRCA1):c.547+14delG rs273902771
NM_007294.3(BRCA1):c.547+1G>A rs80358030
NM_007294.3(BRCA1):c.547+1G>T rs80358030
NM_007294.3(BRCA1):c.547+2T>A rs80358047
NM_007294.3(BRCA1):c.547+594A>G rs552681627
NM_007294.3(BRCA1):c.547+7G>A rs772583635
NM_007294.3(BRCA1):c.5470A>G (p.Ile1824Val) rs587782026
NM_007294.3(BRCA1):c.5470_5477delATTGGGCA (p.Ile1824Aspfs) rs80357973
NM_007294.3(BRCA1):c.5474_5481delGGCAGATG (p.Gly1825Valfs) rs730881441
NM_007294.3(BRCA1):c.5476C>A (p.Gln1826Lys) rs587782887
NM_007294.3(BRCA1):c.5478G>A (p.Gln1826=)
NM_007294.3(BRCA1):c.548-15G>A rs755221482
NM_007294.3(BRCA1):c.548-17G>T rs80358014
NM_007294.3(BRCA1):c.548-18T>G rs397507251
NM_007294.3(BRCA1):c.548-24A>C rs758221694
NM_007294.3(BRCA1):c.548-34T>C rs1442560766
NM_007294.3(BRCA1):c.548-34T>G
NM_007294.3(BRCA1):c.548-3T>C rs397507252
NM_007294.3(BRCA1):c.548-3delT rs398122353
NM_007294.3(BRCA1):c.548-54C>G
NM_007294.3(BRCA1):c.548-54C>T
NM_007294.3(BRCA1):c.548-565A>G rs143496131
NM_007294.3(BRCA1):c.548-58delT rs8176144
NM_007294.3(BRCA1):c.548-80T>C rs8176143
NM_007294.3(BRCA1):c.548-9delA rs273902774
NM_007294.3(BRCA1):c.5481G>A (p.Met1827Ile) rs587782432
NM_007294.3(BRCA1):c.5485G>A (p.Glu1829Lys) rs869320789
NM_007294.3(BRCA1):c.548G>T (p.Gly183Val) rs1555594081
NM_007294.3(BRCA1):c.5492C>G (p.Pro1831Arg) rs587782778
NM_007294.3(BRCA1):c.5496_5506delGGTGACCCGAGinsA (p.Val1833Serfs) rs273902775
NM_007294.3(BRCA1):c.5497G>A (p.Val1833Met) rs80357268
NM_007294.3(BRCA1):c.5498T>C (p.Val1833Ala) rs587782340
NM_007294.3(BRCA1):c.5501C>T (p.Thr1834Ile) rs730881500
NM_007294.3(BRCA1):c.5503C>T (p.Arg1835Ter) rs41293465
NM_007294.3(BRCA1):c.5504G>A (p.Arg1835Gln) rs273902776
NM_007294.3(BRCA1):c.5504G>C (p.Arg1835Pro) rs273902776
NM_007294.3(BRCA1):c.5506G>A (p.Glu1836Lys) rs80356942
NM_007294.3(BRCA1):c.5509T>C (p.Trp1837Arg) rs80356959
NM_007294.3(BRCA1):c.5509T>G (p.Trp1837Gly) rs80356959
NM_007294.3(BRCA1):c.550T>A (p.Ser184Thr) rs1064795269
NM_007294.3(BRCA1):c.5510G>A (p.Trp1837Ter) rs80357307
NM_007294.3(BRCA1):c.5511G>T (p.Trp1837Cys) rs80356914
NM_007294.3(BRCA1):c.5512G>T (p.Val1838Leu) rs730881501
NM_007294.3(BRCA1):c.5514G>T (p.Val1838=) rs786201248
NM_007294.3(BRCA1):c.5516T>C (p.Leu1839Ser)