ClinVar Miner

List of variants in gene BRCA1 reported as pathogenic

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2941
Download table as spreadsheet
HGVS dbSNP
BRCA1, 59-BP INS
BRCA1, 6-KB DUP, EX13
L824X
LRG_292:g.116321_140085del
LRG_292:g.133626_139705dup
LRG_292:g.61068_98138del
LRG_292t1:c.(671_4096)ins(300)
LRG_292t1:c.(?_-233)_(134+1_135-1)del
LRG_292t1:c.(?_-233)_(441+1_442-1)del
LRG_292t1:c.(?_-233)_(5074+1_5075-1)del
LRG_292t1:c.1363insT
LRG_292t1:c.3764insA
NC_000017.10:g.(41215969_?)_(41277341_?)del
NC_000017.10:g.(?_41197694)_(41197818_?)del
NC_000017.10:g.(?_41276034)_(41276113_?)del
NC_000017.11:g.(43076615_43082403)_(43099881_43104121)del
NC_000017.11:g.(?_43044295)_(43045802_?)del
NC_000017.11:g.(?_43044295)_(43057135_?)del
NC_000017.11:g.(?_43044295)_(43099880_?)del
NC_000017.11:g.(?_43045658)_(43045822_?)del
NC_000017.11:g.(?_43045658)_(43047723_?)del
NC_000017.11:g.(?_43045658)_(43051137_?)del
NC_000017.11:g.(?_43045672)_(43047709_?)del
NC_000017.11:g.(?_43045672)_(43106539_?)del
NC_000017.11:g.(?_43045672)_(43115785_?)del
NC_000017.11:g.(?_43045678)_(43051117_?)del
NC_000017.11:g.(?_43047637)_(43099886_?)del
NC_000017.11:g.(?_43049184)_(43057059_?)del
NC_000017.11:g.(?_43051057)_(43051123_?)del
NC_000017.11:g.(?_43057032)_(43057155_?)del
NC_000017.11:g.(?_43057046)_(43057141_?)del
NC_000017.11:g.(?_43057046)_(43074527_?)del
NC_000017.11:g.(?_43063313)_(43063971_?)dup
NC_000017.11:g.(?_43063327)_(43063379_?)del
NC_000017.11:g.(?_43070922)_(43076620_?)del
NC_000017.11:g.(?_43070991)_(43082575_?)del
NC_000017.11:g.(?_43074325)_(43094866_?)del
NC_000017.11:g.(?_43074325)_(43115785_?)del
NC_000017.11:g.(?_43082384)_(43082595_?)del
NC_000017.11:g.(?_43082384)_(43082595_?)dup
NC_000017.11:g.(?_43090924)_(43106553_?)del
NC_000017.11:g.(?_43090938)_(43106539_?)del
NC_000017.11:g.(?_43095840)_(43106539_?)del
NC_000017.11:g.(?_43104116)_(43115785_?)del
NG_005905.2:g.(102259_111450)_(113786_118149)del
NG_005905.2:g.(102259_111450)_(172307_?)del
NG_005905.2:g.(113863_118103)_(118210_120694)del
NG_005905.2:g.(113863_118103)_(172307_?)del
NG_005905.2:g.(122139_123344)_(126550_126951)dup
NG_005905.2:g.(147057_150288)_(172307_?)del
NG_005905.2:g.(150290_154032)_(172307_?)del
NG_005905.2:g.(154652_160848)_(172307_?)del
NG_005905.2:g.(160933_166866)_(172307_?)del
NG_005905.2:g.(166922_168789)_(168864_170280)del
NG_005905.2:g.(168864_170280)_(172307_?)del
NG_005905.2:g.(170342_172181)_(172307_?)del
NG_005905.2:g.110245_115469del5225
NG_005905.2:g.110447_115471del5025
NG_005905.2:g.110966_142550del
NG_005905.2:g.116869_123429del6561
NG_005905.2:g.117282_121246del3965
NG_005905.2:g.118449_154829del
NG_005905.2:g.123838_133133del9296
NG_005905.2:g.124095_124103delATTACTAATins2
NG_005905.2:g.125407_125411delCCATCins3
NG_005905.2:g.125502_125503ins7
NG_005905.2:g.126374_136783del10410
NG_005905.2:g.137094_142043del
NG_005905.2:g.139641_147792dup8152
NG_005905.2:g.139830_166277del
NG_005905.2:g.141479_141480ins5
NG_005905.2:g.142345_165745del23401
NG_005905.2:g.145185_151339del6155
NG_005905.2:g.147946_153049del5104
NG_005905.2:g.148011_151127del3117
NG_005905.2:g.151367_156192del4826
NG_005905.2:g.152586_159830del7245ins27
NG_005905.2:g.152940_163021dup
NG_005905.2:g.154259_156851del2593insTTTTTTTTTTTT
NG_005905.2:g.157279_161602del4324
NG_005905.2:g.158009_169399del11391
NG_005905.2:g.160396_164568del4173
NG_005905.2:g.160911_164110del3200
NG_005905.2:g.163032_170685dup
NG_005905.2:g.163181_169408del6228
NG_005905.2:g.169527_180579del11053
NM_007294.3(BRCA1):c.(134+1_135-1)_(547+1_548-1)del
NM_007294.3(BRCA1):c.(441+1_442-1)_(547+1_548-1)del
NM_007294.3(BRCA1):c.(5074+1-5075-1)_(5193+1_5194-1)del
NM_007294.3(BRCA1):c.(5074+1_5075-1)_(5193+1_5194-1)del
NM_007294.3(BRCA1):c.(5467+1_5468-1)_(*1_?)del
NM_007294.3(BRCA1):c.(547+1_548+1)_(4185+1_4186-1)del
NM_007294.3(BRCA1):c.(80+1_81-1)_(134+1_135-1)del
NM_007294.3(BRCA1):c.(80+1_81-1)_(5193+1_5194-1)del
NM_007294.3(BRCA1):c.(?_-1)_(80+1_81-1)del
NM_007294.3(BRCA1):c.(?_-1)_80+?del
NM_007294.3(BRCA1):c.*102_*105delCTGT rs431825382
NM_007294.3(BRCA1):c.-19-2A>G rs886040902
NM_007294.3(BRCA1):c.-19-48_80+248delinsU77841.1:g.2145_2536
NM_007294.3(BRCA1):c.-19-?_80+?del
NM_007294.3(BRCA1):c.-19-?_80+?dup
NM_007294.3(BRCA1):c.1002delC (p.Ser335Alafs) rs876658404
NM_007294.3(BRCA1):c.1008dupA (p.Glu337Argfs) rs67284603
NM_007294.3(BRCA1):c.1009_1010delGA (p.Glu337Lysfs) rs1555592671
NM_007294.3(BRCA1):c.1011dupA (p.Val340Glyfs) rs80357569
NM_007294.3(BRCA1):c.1012A>T (p.Lys338Ter) rs397508826
NM_007294.3(BRCA1):c.1016_1017insC (p.Lys339Asnfs) rs1555592653
NM_007294.3(BRCA1):c.1016delA (p.Lys339Argfs) rs80357569
NM_007294.3(BRCA1):c.1017_1018insA (p.Val340Serfs) rs886039921
NM_007294.3(BRCA1):c.1017_1018insC (p.Val340Argfs) rs886039921
NM_007294.3(BRCA1):c.1018_1019insA (p.Val340Aspfs) rs1555592640
NM_007294.3(BRCA1):c.1018delG (p.Val340Terfs) rs80357774
NM_007294.3(BRCA1):c.1018dupG (p.Val340Glyfs) rs80357774
NM_007294.3(BRCA1):c.101_105del (p.Pro34Leufs) rs886039920
NM_007294.3(BRCA1):c.101delC (p.Pro34Leufs) rs80357750
NM_007294.3(BRCA1):c.102delT (p.Val35Serfs) rs886039922
NM_007294.3(BRCA1):c.1039_1040delCT (p.Leu347Valfs) rs397508827
NM_007294.3(BRCA1):c.1039delC (p.Leu347Cysfs) rs749508254
NM_007294.3(BRCA1):c.1040delT (p.Leu347Argfs) rs397508828
NM_007294.3(BRCA1):c.1044T>A (p.Cys348Ter) rs886037985
NM_007294.3(BRCA1):c.1044_1045delTG (p.Cys348Terfs) rs1555592601
NM_007294.3(BRCA1):c.1044_1045insTCAC (p.Glu349Serfs) rs886039923
NM_007294.3(BRCA1):c.1044_1047del (p.Cys348Terfs) rs886039924
NM_007294.3(BRCA1):c.1045G>T (p.Glu349Ter) rs80357338
NM_007294.3(BRCA1):c.1045_1046insTCAC (p.Glu349Valfs) rs1555592590
NM_007294.3(BRCA1):c.1049_1050del (p.Arg350Lysfs) rs886039925
NM_007294.3(BRCA1):c.1054G>T (p.Glu352Ter) rs80357472
NM_007294.3(BRCA1):c.1054delG (p.Glu352Asnfs) rs886039926
NM_007294.3(BRCA1):c.1058G>A (p.Trp353Ter) rs80356908
NM_007294.3(BRCA1):c.1058_1062delGGAAT (p.Trp353Terfs) rs1555592576
NM_007294.3(BRCA1):c.1059G>A (p.Trp353Ter) rs80356935
NM_007294.3(BRCA1):c.105_134+1007del
NM_007294.3(BRCA1):c.1063A>T (p.Lys355Ter) rs397508829
NM_007294.3(BRCA1):c.1066C>T (p.Gln356Ter) rs80357215
NM_007294.3(BRCA1):c.1067delA (p.Gln356Argfs) rs80357796
NM_007294.3(BRCA1):c.1068_1077delGAAACTGCCA (p.Gln356Hisfs) rs397508830
NM_007294.3(BRCA1):c.1072delC (p.Leu358Cysfs) rs80357836
NM_007294.3(BRCA1):c.1080C>A (p.Cys360Ter) rs886037986
NM_007294.3(BRCA1):c.1081_1082insA (p.Ser361Tyrfs) rs1555592544
NM_007294.3(BRCA1):c.1082C>G (p.Ser361Ter) rs397508833
NM_007294.3(BRCA1):c.1082_1092delCAGAGAATCCT (p.Ser361Terfs) rs80359880
NM_007294.3(BRCA1):c.1083_1084insA (p.Glu362Argfs) rs1135401840
NM_007294.3(BRCA1):c.1085dup (p.Asn363Glufs) rs1555592537
NM_007294.3(BRCA1):c.1086_1087delGA (p.Asn363Serfs) rs80357897
NM_007294.3(BRCA1):c.1086_1141del56 (p.Asn363Serfs) rs80359875
NM_007294.3(BRCA1):c.1088delA (p.Asn363Ilefs) rs80357954
NM_007294.3(BRCA1):c.1091_1092delCT (p.Pro364Glnfs) rs1555592526
NM_007294.3(BRCA1):c.1091delC (p.Pro364Leufs) rs397508834
NM_007294.3(BRCA1):c.1093A>T (p.Arg365Ter) rs398122627
NM_007294.3(BRCA1):c.1099dupA (p.Thr367Asnfs) rs397508835
NM_007294.3(BRCA1):c.1100dupC (p.Glu368Terfs) rs397508836
NM_007294.3(BRCA1):c.1101_1102insC (p.Glu368Argfs) rs80357665
NM_007294.3(BRCA1):c.1102G>T (p.Glu368Ter) rs80357139
NM_007294.3(BRCA1):c.1102_1103insC (p.Glu368Alafs) rs1555592500
NM_007294.3(BRCA1):c.1104del (p.Asp369Metfs) rs886039927
NM_007294.3(BRCA1):c.1105G>A (p.Asp369Asn) rs56056711
NM_007294.3(BRCA1):c.1105_1106insTC (p.Asp369Valfs) rs876659396
NM_007294.3(BRCA1):c.1105dupG (p.Asp369Glyfs) rs1555592498
NM_007294.3(BRCA1):c.1107_1108insCT (p.Val370Leufs) rs1555592487
NM_007294.3(BRCA1):c.110C>A (p.Thr37Lys) rs80356880
NM_007294.3(BRCA1):c.1112delC (p.Pro371Leufs) rs397508837
NM_007294.3(BRCA1):c.1115G>A (p.Trp372Ter) rs397508838
NM_007294.3(BRCA1):c.1116G>A (p.Trp372Ter) rs80357468
NM_007294.3(BRCA1):c.1121_1123delCACinsT (p.Thr374Ilefs) rs273897652
NM_007294.3(BRCA1):c.1121delC (p.Thr374Asnfs) rs80357612
NM_007294.3(BRCA1):c.1122_1123delAC (p.Leu375Lysfs) rs397508839
NM_007294.3(BRCA1):c.1123delC (p.Leu375Terfs) rs886037987
NM_007294.3(BRCA1):c.1125_1132del (p.Asn376Hisfs) rs886039928
NM_007294.3(BRCA1):c.1127delA (p.Asn376Ilefs) rs80357821
NM_007294.3(BRCA1):c.1129dupA (p.Ser377Lysfs) rs80357776
NM_007294.3(BRCA1):c.112_113delAA (p.Lys38Valfs) rs80357949
NM_007294.3(BRCA1):c.1132_1135delAGCA (p.Ser378Phefs) rs1135401841
NM_007294.3(BRCA1):c.1138C>T (p.Gln380Ter) rs397508840
NM_007294.3(BRCA1):c.1140del (p.Val382Leufs) rs886039929
NM_007294.3(BRCA1):c.1140dupG (p.Lys381Glufs) rs876659327
NM_007294.3(BRCA1):c.1141A>T (p.Lys381Ter) rs80357385
NM_007294.3(BRCA1):c.1142_1143delAA (p.Lys381Serfs) rs879255313
NM_007294.3(BRCA1):c.1148_1149delAT (p.Asn383Argfs) rs431825384
NM_007294.3(BRCA1):c.1148delA (p.Asn383Metfs) rs878854930
NM_007294.3(BRCA1):c.1150G>T (p.Glu384Ter) rs878853288
NM_007294.3(BRCA1):c.1152dupG (p.Trp385Valfs) rs397508841
NM_007294.3(BRCA1):c.1154G>A (p.Trp385Ter) rs1555592354
NM_007294.3(BRCA1):c.1155G>A (p.Trp385Ter) rs876660558
NM_007294.3(BRCA1):c.1158_1159delTT (p.Ser387Glnfs) rs397508842
NM_007294.3(BRCA1):c.1159dupT (p.Ser387Phefs) rs397508842
NM_007294.3(BRCA1):c.115T>A (p.Cys39Ser) rs80357164
NM_007294.3(BRCA1):c.115T>C (p.Cys39Arg) rs80357164
NM_007294.3(BRCA1):c.115T>G (p.Cys39Gly) rs80357164
NM_007294.3(BRCA1):c.1162A>T (p.Arg388Ter) rs111312760
NM_007294.3(BRCA1):c.1165delA (p.Ser389Valfs) rs80357985
NM_007294.3(BRCA1):c.1166delG (p.Ser389Metfs) rs273897653
NM_007294.3(BRCA1):c.116G>A (p.Cys39Tyr) rs80357498
NM_007294.3(BRCA1):c.116G>T (p.Cys39Phe) rs80357498
NM_007294.3(BRCA1):c.1171G>T (p.Glu391Ter) rs562553169
NM_007294.3(BRCA1):c.1174del (p.Leu392Cysfs) rs886039930
NM_007294.3(BRCA1):c.1175_1178delTGTT (p.Leu392Glnfs) rs397508844
NM_007294.3(BRCA1):c.1175_1214del40 (p.Leu392Glnfs) rs80359874
NM_007294.3(BRCA1):c.1175_1215del41 (p.Leu392Glnfs) rs397507180
NM_007294.3(BRCA1):c.1175_1216del42 (p.Leu392_Asn406delinsHis) rs397507181
NM_007294.3(BRCA1):c.1175_1217del43 (p.Leu393Profs) rs397507182
NM_007294.3(BRCA1):c.1175_1218del44 (p.Leu392Argfs) rs397507183
NM_007294.3(BRCA1):c.1176_1215del (p.Leu393Metfs) rs1555592157
NM_007294.3(BRCA1):c.1179_1180dup (p.Gly394Glufs) rs1555592304
NM_007294.3(BRCA1):c.1179_1180insT (p.Gly394Trpfs) rs886039931
NM_007294.3(BRCA1):c.117T>A (p.Cys39Ter) rs886040898
NM_007294.3(BRCA1):c.117T>G (p.Cys39Trp) rs886040898
NM_007294.3(BRCA1):c.117_118delTG (p.Cys39Terfs) rs80357972
NM_007294.3(BRCA1):c.1180_1181insT (p.Gly394Valfs) rs1555592299
NM_007294.3(BRCA1):c.1188delT (p.Asp396Glufs) rs397508845
NM_007294.3(BRCA1):c.1190delA (p.Asp397Alafs) rs748714307
NM_007294.3(BRCA1):c.1193C>A (p.Ser398Ter) rs80357068
NM_007294.3(BRCA1):c.1193C>G (p.Ser398Ter) rs80357068
NM_007294.3(BRCA1):c.1194dup (p.His399Thrfs) rs1555592264
NM_007294.3(BRCA1):c.1204G>T (p.Glu402Ter) rs273897655
NM_007294.3(BRCA1):c.1204delG (p.Glu402Serfs) rs80357859
NM_007294.3(BRCA1):c.1205dup (p.Ser403Valfs) rs1555592219
NM_007294.3(BRCA1):c.1209_1210del (p.Glu404Ilefs) rs886039932
NM_007294.3(BRCA1):c.1209dup (p.Glu404Terfs) rs886039933
NM_007294.3(BRCA1):c.1210_1211insCT (p.Glu404Alafs) rs886039934
NM_007294.3(BRCA1):c.1211_1212insCT (p.Glu404Aspfs) rs1555592174
NM_007294.3(BRCA1):c.1214C>A (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1214C>G (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1217_1218insA (p.Asn406Lysfs) rs397508846
NM_007294.3(BRCA1):c.1217delA (p.Asn406Metfs) rs397508846
NM_007294.3(BRCA1):c.1218_1219insA (p.Ala407Serfs) rs1555592129
NM_007294.3(BRCA1):c.121delC (p.His41Thrfs) rs1555599226
NM_007294.3(BRCA1):c.1222A>T (p.Lys408Ter) rs80357253
NM_007294.3(BRCA1):c.1224delA (p.Val409Terfs) rs879255320
NM_007294.3(BRCA1):c.1227_1230dup (p.Asp411Serfs) rs886039935
NM_007294.3(BRCA1):c.122A>G (p.His41Arg) rs80357276
NM_007294.3(BRCA1):c.122delA (p.His41Profs) rs397508847
NM_007294.3(BRCA1):c.1230delT (p.Asp411Metfs) rs1555592108
NM_007294.3(BRCA1):c.1232_1233delAT (p.Asp411Glyfs) rs397508848
NM_007294.3(BRCA1):c.1232_1235delATGTinsCA (p.Asp411Alafs) rs876659253
NM_007294.3(BRCA1):c.1240_1246delGACGTTC (p.Asp414Terfs) rs80357964
NM_007294.3(BRCA1):c.1240delG (p.Asp414Thrfs) rs786204260
NM_007294.3(BRCA1):c.1240dupG (p.Asp414Glyfs) rs786204260
NM_007294.3(BRCA1):c.1241dupA (p.Asp414Glufs) rs80357514
NM_007294.3(BRCA1):c.124delA (p.Ile42Tyrfs) rs80357943
NM_007294.3(BRCA1):c.1251_1252delTGinsA (p.Asn417Lysfs) rs886040899
NM_007294.3(BRCA1):c.1252G>T (p.Glu418Ter) rs80357083
NM_007294.3(BRCA1):c.1252delG (p.Glu418Argfs) rs876660623
NM_007294.3(BRCA1):c.1252dupG (p.Glu418Glyfs) rs886039936
NM_007294.3(BRCA1):c.1253del (p.Glu418Glyfs) rs886039937
NM_007294.3(BRCA1):c.1255delG (p.Val419Terfs) rs80357535
NM_007294.3(BRCA1):c.1256dupT (p.Asp420Argfs) rs786203103
NM_007294.3(BRCA1):c.1257delA (p.Asp420Metfs) rs886037988
NM_007294.3(BRCA1):c.1261G>T (p.Glu421Ter) rs80357046
NM_007294.3(BRCA1):c.1265_1266dupAT (p.Ser423Ilefs) rs397508850
NM_007294.3(BRCA1):c.1265dupA (p.Tyr422Terfs) rs80357809
NM_007294.3(BRCA1):c.1266T>G (p.Tyr422Ter) rs80357417
NM_007294.3(BRCA1):c.1270_1300dup (p.Ser434Argfs)
NM_007294.3(BRCA1):c.1273dup (p.Ser425Phefs) rs886039938
NM_007294.3(BRCA1):c.1276delT (p.Ser426Glnfs) rs80357766
NM_007294.3(BRCA1):c.1277C>A (p.Ser426Ter) rs886039939
NM_007294.3(BRCA1):c.1277C>G (p.Ser426Ter) rs886039939
NM_007294.3(BRCA1):c.1277delC (p.Ser426Terfs) rs1064795775
NM_007294.3(BRCA1):c.1279G>T (p.Glu427Ter) rs397508851
NM_007294.3(BRCA1):c.1285delA (p.Ile429Terfs)
NM_007294.3(BRCA1):c.1287_1288insC (p.Asp430Argfs) rs1555592003
NM_007294.3(BRCA1):c.1287delA (p.Ile429Metfs) rs1060505045
NM_007294.3(BRCA1):c.1287dupA (p.Asp430Argfs) rs80357576
NM_007294.3(BRCA1):c.1288_1289insC (p.Asp430Alafs) rs1555591993
NM_007294.3(BRCA1):c.1288dup (p.Asp430Glyfs) rs886039940
NM_007294.3(BRCA1):c.1292T>G (p.Leu431Ter) rs80357346
NM_007294.3(BRCA1):c.1292_1295delTACT (p.Leu431Trpfs) rs1555591984
NM_007294.3(BRCA1):c.1292delT (p.Leu431Tyrfs) rs80357528
NM_007294.3(BRCA1):c.1292dupT (p.Leu431Phefs) rs80357528
NM_007294.3(BRCA1):c.1293_1295delACTinsGA (p.Leu432Argfs) rs397508852
NM_007294.3(BRCA1):c.1297delG (p.Ala433Profs) rs80357794
NM_007294.3(BRCA1):c.1298_1299ins4
NM_007294.3(BRCA1):c.1299dupC (p.Ser434Glnfs) rs886037786
NM_007294.3(BRCA1):c.1303_1309delGATCCTCinsAAAGT (p.Asp435Lysfs) rs886039941
NM_007294.3(BRCA1):c.130T>A (p.Cys44Ser) rs80357327
NM_007294.3(BRCA1):c.130delT (p.Cys44Alafs) rs80357951
NM_007294.3(BRCA1):c.130dupT (p.Cys44Leufs) rs80357951
NM_007294.3(BRCA1):c.1310_1313delATGA (p.His437Argfs) rs1555591959
NM_007294.3(BRCA1):c.1315dup (p.Ala439Glyfs) rs1555591956
NM_007294.3(BRCA1):c.1319T>G (p.Leu440Ter) rs273897656
NM_007294.3(BRCA1):c.1319delT (p.Leu440Terfs) rs80357683
NM_007294.3(BRCA1):c.1319dupT (p.Leu440Phefs) rs80357683
NM_007294.3(BRCA1):c.131G>A (p.Cys44Tyr) rs80357446
NM_007294.3(BRCA1):c.131G>T (p.Cys44Phe) rs80357446
NM_007294.3(BRCA1):c.1321_1322insA (p.Ile441Asnfs) rs1135401843
NM_007294.3(BRCA1):c.1323_1324delAT (p.Ile441Metfs) rs80357570
NM_007294.3(BRCA1):c.1323dup (p.Cys442Metfs) rs1555591939
NM_007294.3(BRCA1):c.1326T>A (p.Cys442Ter) rs397508854
NM_007294.3(BRCA1):c.1326_1327insGT (p.Lys443Valfs) rs80357543
NM_007294.3(BRCA1):c.1327A>T (p.Lys443Ter) rs398122630
NM_007294.3(BRCA1):c.1327_1345del (p.Lys443Profs) rs886039942
NM_007294.3(BRCA1):c.132C>T (p.Cys44=) rs876658362
NM_007294.3(BRCA1):c.1333G>T (p.Glu445Ter) rs80356915
NM_007294.3(BRCA1):c.1333del (p.Glu445Lysfs) rs886039943
NM_007294.3(BRCA1):c.1335_1336delAA (p.Arg446Serfs) rs80357978
NM_007294.3(BRCA1):c.1336del (p.Arg446Glufs) rs80357978
NM_007294.3(BRCA1):c.1336dupA (p.Arg446Lysfs) rs80357978
NM_007294.3(BRCA1):c.1339dupG (p.Val447Glyfs) rs397508855
NM_007294.3(BRCA1):c.133_134+3delAAGTAinsT rs397508856
NM_007294.3(BRCA1):c.133_134delAA (p.Lys45Ilefs) rs397508857
NM_007294.3(BRCA1):c.134+1G>A rs80358043
NM_007294.3(BRCA1):c.134+1G>C rs80358043
NM_007294.3(BRCA1):c.134+1G>T rs80358043
NM_007294.3(BRCA1):c.134+2T>C rs80358131
NM_007294.3(BRCA1):c.134+2T>G rs80358131
NM_007294.3(BRCA1):c.134+2delT rs273897657
NM_007294.3(BRCA1):c.134+3A>C rs80358064
NM_007294.3(BRCA1):c.134+3_134+4insT rs886041002
NM_007294.3(BRCA1):c.134+3_134+6delAAGT rs397508858
NM_007294.3(BRCA1):c.1340_1341delTT (p.Val447Alafs) rs730881458
NM_007294.3(BRCA1):c.1340_1341insG (p.His448Serfs) rs80357597
NM_007294.3(BRCA1):c.1341_1342insG (p.His448Alafs) rs1555591909
NM_007294.3(BRCA1):c.1347del (p.Lys450Asnfs) rs886039945
NM_007294.3(BRCA1):c.135-1G>A rs80358158
NM_007294.3(BRCA1):c.135-1G>C rs80358158
NM_007294.3(BRCA1):c.135-1G>T rs80358158
NM_007294.3(BRCA1):c.135-2A>G rs80358065
NM_007294.3(BRCA1):c.135-?_212+?del
NM_007294.3(BRCA1):c.135-?_301+?del
NM_007294.3(BRCA1):c.135-?_4185+?del
NM_007294.3(BRCA1):c.135-?_441+?del
NM_007294.3(BRCA1):c.135-?_441+?dup
NM_007294.3(BRCA1):c.135-?_4484+?del
NM_007294.3(BRCA1):c.135-?_5193+?del
NM_007294.3(BRCA1):c.135-?_547+?del
NM_007294.3(BRCA1):c.135-?_547+?dup
NM_007294.3(BRCA1):c.135-?_670+?del
NM_007294.3(BRCA1):c.1352C>A (p.Ser451Ter) rs80356891
NM_007294.3(BRCA1):c.1352C>G (p.Ser451Ter) rs80356891
NM_007294.3(BRCA1):c.1354delG (p.Val452Terfs) rs886039946
NM_007294.3(BRCA1):c.1356delA (p.Glu453Argfs) rs80357939
NM_007294.3(BRCA1):c.1360_1361delAG (p.Ser454Terfs) rs80357969
NM_007294.3(BRCA1):c.1361delG (p.Ser454Ilefs) rs398122632
NM_007294.3(BRCA1):c.1363_1364insT (p.Asn455Ilefs) rs1555591850
NM_007294.3(BRCA1):c.1364_1365insGA (p.Asn455Lysfs) rs1555591846
NM_007294.3(BRCA1):c.1371delA (p.Asp458Thrfs) rs397508861
NM_007294.3(BRCA1):c.1374delC (p.Asp458Glufs) rs397508862
NM_007294.3(BRCA1):c.1375A>T (p.Lys459Ter) rs886039947
NM_007294.3(BRCA1):c.1377_1378delAA (p.Lys459Asnfs) rs398122633
NM_007294.3(BRCA1):c.1378dup (p.Ile460Asnfs) rs398122633
NM_007294.3(BRCA1):c.1379del (p.Ile460Asnfs) rs886039949
NM_007294.3(BRCA1):c.1380_1381insT (p.Gly462Trpfs)
NM_007294.3(BRCA1):c.1380delA (p.Phe461Leufs) rs397508863
NM_007294.3(BRCA1):c.1380dupA (p.Phe461Ilefs) rs80357714
NM_007294.3(BRCA1):c.1383delT (p.Phe461Leufs) rs80357879
NM_007294.3(BRCA1):c.1384_1393dupGGGAAAACCT (p.Tyr465Trpfs) rs397508864
NM_007294.3(BRCA1):c.1386delG (p.Thr464Profs) rs80357722
NM_007294.3(BRCA1):c.1386dupG (p.Lys463Glufs) rs80357722
NM_007294.3(BRCA1):c.1387_1390delAAAAins5
NM_007294.3(BRCA1):c.1387_1390delAAAAinsGAAAG (p.Lys463Glufs) rs80357770
NM_007294.3(BRCA1):c.1387delAinsGG (p.Lys463Glyfs)
NM_007294.3(BRCA1):c.1389_1390delAAinsG (p.Thr464Profs) rs273897659
NM_007294.3(BRCA1):c.1390_1391insG (p.Thr464Serfs) rs397508867
NM_007294.3(BRCA1):c.1390delA (p.Thr464Profs) rs80357770
NM_007294.3(BRCA1):c.1390dup (p.Thr464Asnfs) rs80357770
NM_007294.3(BRCA1):c.1391_1392insG (p.Tyr465Leufs) rs1135401845
NM_007294.3(BRCA1):c.1392_1393insG (p.Tyr465Valfs) rs1555591814
NM_007294.3(BRCA1):c.1392delC (p.Tyr465Ilefs) rs80357592
NM_007294.3(BRCA1):c.1392dupC (p.Tyr465Leufs) rs80357592
NM_007294.3(BRCA1):c.1393_1394ins10 (p.?)
NM_007294.3(BRCA1):c.1393_1394insT (p.Tyr465Leufs) rs1555591812
NM_007294.3(BRCA1):c.1395dup (p.Arg466Serfs) rs1555591796
NM_007294.3(BRCA1):c.1399A>T (p.Lys467Ter) rs80357279
NM_007294.3(BRCA1):c.139T>A (p.Cys47Ser) rs80357370
NM_007294.3(BRCA1):c.139dupT (p.Cys47Leufs) rs80357734
NM_007294.3(BRCA1):c.1403delA (p.Lys468Argfs) rs397508870
NM_007294.3(BRCA1):c.1405delG (p.Ala469Glnfs) rs397508871
NM_007294.3(BRCA1):c.1407_1408delAA (p.Ser470Profs) rs879255476
NM_007294.3(BRCA1):c.140G>A (p.Cys47Tyr) rs80357150
NM_007294.3(BRCA1):c.140G>T (p.Cys47Phe) rs80357150
NM_007294.3(BRCA1):c.140_141insT (p.Met48Hisfs) rs886039950
NM_007294.3(BRCA1):c.1412dup (p.Asn473Glnfs) rs886039951
NM_007294.3(BRCA1):c.1416delC (p.Asn473Thrfs) rs1555591774
NM_007294.3(BRCA1):c.1419_1422delCTTA (p.Asn473Lysfs) rs886039952
NM_007294.3(BRCA1):c.141C>A (p.Cys47Ter) rs398122635
NM_007294.3(BRCA1):c.141_142insT (p.Met48Tyrfs) rs1555597309
NM_007294.3(BRCA1):c.1421T>G (p.Leu474Ter) rs80357490
NM_007294.3(BRCA1):c.1428_1437del (p.His476Glnfs) rs886039953
NM_007294.3(BRCA1):c.1434_1435delTG (p.Glu479Lysfs) rs1060505050
NM_007294.3(BRCA1):c.1434delT (p.Glu479Lysfs) rs431825386
NM_007294.3(BRCA1):c.1439dupA (p.Asn480Lysfs) rs80357505
NM_007294.3(BRCA1):c.143delT (p.Met48Serfs) rs80357637
NM_007294.3(BRCA1):c.1440_1441insA (p.Leu481Thrfs) rs80357778
NM_007294.3(BRCA1):c.1441_1442insA (p.Leu481Hisfs) rs1555591749
NM_007294.3(BRCA1):c.1444_1447delATTA (p.Ile482Terfs) rs80357801
NM_007294.3(BRCA1):c.1444delA (p.Ile482Leufs) rs80357648
NM_007294.3(BRCA1):c.144delG (p.Met48Ilefs) rs80357682
NM_007294.3(BRCA1):c.1450G>T (p.Gly484Ter) rs80357304
NM_007294.3(BRCA1):c.1462dupA (p.Thr488Asnfs) rs80357599
NM_007294.3(BRCA1):c.1465G>T (p.Glu489Ter) rs80357167
NM_007294.3(BRCA1):c.1471C>T (p.Gln491Ter) rs62625303
NM_007294.3(BRCA1):c.1477delA (p.Ile493Tyrfs) rs786203982
NM_007294.3(BRCA1):c.1480C>T (p.Gln494Ter) rs80357010
NM_007294.3(BRCA1):c.1480dup (p.Gln494Profs) rs1555591706
NM_007294.3(BRCA1):c.1483_1498del16 (p.Glu495Ilefs) rs397508872
NM_007294.3(BRCA1):c.1488delT (p.Leu498Serfs) rs587782251
NM_007294.3(BRCA1):c.1492delC (p.Leu498Serfs) rs80357527
NM_007294.3(BRCA1):c.1497_1509del (p.Asn500Valfs) rs886039954
NM_007294.3(BRCA1):c.1499_1508dupATAAATTAAA (p.Arg504Terfs) rs397508873
NM_007294.3(BRCA1):c.1499delA (p.Asn500Ilefs) rs397508874
NM_007294.3(BRCA1):c.1501_1504delAAAT (p.Lys501Terfs) rs80357632
NM_007294.3(BRCA1):c.1504_1507delTTAA (p.Leu502Serfs) rs886039955
NM_007294.3(BRCA1):c.1504_1508delTTAAA (p.Leu502Alafs) rs80357888
NM_007294.3(BRCA1):c.1505T>G (p.Leu502Ter) rs886039957
NM_007294.3(BRCA1):c.1505_1509delTAAAG (p.Leu502Serfs) rs876659139
NM_007294.3(BRCA1):c.1505del (p.Leu502Terfs) rs886039956
NM_007294.3(BRCA1):c.1506_1510delAAAGC (p.Lys503Terfs) rs397508876
NM_007294.3(BRCA1):c.1508delA (p.Lys503Serfs) rs80357506
NM_007294.3(BRCA1):c.150delA (p.Lys50Asnfs) rs273897662
NM_007294.3(BRCA1):c.1510delC (p.Arg504Valfs) rs80357908
NM_007294.3(BRCA1):c.1511dupG (p.Lys505Terfs) rs80357817
NM_007294.3(BRCA1):c.1512dupT (p.Lys505Terfs) rs398122636
NM_007294.3(BRCA1):c.1513A>T (p.Lys505Ter) rs397508877
NM_007294.3(BRCA1):c.1513_1514insT (p.Lys505Ilefs) rs397508878
NM_007294.3(BRCA1):c.1514_1515insT (p.Lys505Asnfs) rs1555591635
NM_007294.3(BRCA1):c.1517_1521delGGAGA (p.Arg506Thrfs) rs397508879
NM_007294.3(BRCA1):c.1518delG (p.Arg507Aspfs) rs80357947
NM_007294.3(BRCA1):c.1519A>T (p.Arg507Ter) rs397508880
NM_007294.3(BRCA1):c.1521_1531delACCTACATCAG (p.Thr509Serfs) rs1555591596
NM_007294.3(BRCA1):c.1523delC (p.Pro508Leufs) rs80357782
NM_007294.3(BRCA1):c.1529C>A (p.Ser510Ter) rs80357427
NM_007294.3(BRCA1):c.1529C>G (p.Ser510Ter) rs80357427
NM_007294.3(BRCA1):c.1530delA (p.Gly511Alafs) rs80357735
NM_007294.3(BRCA1):c.1542_1550delTGAGGATTTinsCG (p.Glu515Valfs) rs876659591
NM_007294.3(BRCA1):c.1543G>T (p.Glu515Ter) rs886037990
NM_007294.3(BRCA1):c.1551delT (p.Phe517Leufs) rs80357630
NM_007294.3(BRCA1):c.1556delA (p.Lys519Argfs) rs80357662
NM_007294.3(BRCA1):c.1561_1562delGCinsTA (p.Ala521Ter) rs273897663
NM_007294.3(BRCA1):c.1561_1564delGCAGinsTAAA (p.Ala521Ter) rs397508883
NM_007294.3(BRCA1):c.1566_1567insC (p.Ala524Glyfs) rs1555591551
NM_007294.3(BRCA1):c.1568delT (p.Leu523Trpfs) rs1555591543
NM_007294.3(BRCA1):c.1570delG (p.Ala524Glnfs) rs397508886
NM_007294.3(BRCA1):c.1575_1576insT (p.Gln526Serfs) rs879255478
NM_007294.3(BRCA1):c.1575del (p.Gln526Lysfs) rs879255478
NM_007294.3(BRCA1):c.1576C>T (p.Gln526Ter) rs80356984
NM_007294.3(BRCA1):c.1576_1577delCA (p.Gln526Lysfs)
NM_007294.3(BRCA1):c.1579_1580delAA (p.Lys527Aspfs) rs431825387
NM_007294.3(BRCA1):c.1583_1589delCTCCTGA (p.Thr528Lysfs) rs80357613
NM_007294.3(BRCA1):c.1595_1601delTAAATCA (p.Ile532Argfs) rs397508888
NM_007294.3(BRCA1):c.1600C>T (p.Gln534Ter) rs142074233
NM_007294.3(BRCA1):c.1600delC (p.Gln534Argfs) rs869320776
NM_007294.3(BRCA1):c.1601_1602delAG (p.Gln534Argfs) rs878854933
NM_007294.3(BRCA1):c.1601dupA (p.Thr536Asnfs) rs397508889
NM_007294.3(BRCA1):c.1604_1612delGAACTAACCins13 (p.?)
NM_007294.3(BRCA1):c.1608_1611delTAAC (p.Asn537Lysfs) rs80357698
NM_007294.3(BRCA1):c.160C>T (p.Gln54Ter) rs80356864
NM_007294.3(BRCA1):c.160delC (p.Gln54Argfs) rs397508890
NM_007294.3(BRCA1):c.1612C>T (p.Gln538Ter) rs80356893
NM_007294.3(BRCA1):c.1612_1616delCAAAC (p.Gln538Glyfs) rs587776480
NM_007294.3(BRCA1):c.1616_1625del (p.Thr539Metfs) rs886039959
NM_007294.3(BRCA1):c.1618G>T (p.Glu540Ter) rs730881471
NM_007294.3(BRCA1):c.1618delG (p.Glu540Serfs) rs1555591470
NM_007294.3(BRCA1):c.1621C>T (p.Gln541Ter) rs80356904
NM_007294.3(BRCA1):c.1622_1626delAGAAT (p.Gln541Argfs) rs879255314
NM_007294.3(BRCA1):c.1623dupG (p.Asn542Glufs) rs397508891
NM_007294.3(BRCA1):c.1628delG (p.Gly543Valfs) rs398122640
NM_007294.3(BRCA1):c.1630C>T (p.Gln544Ter) rs80356952
NM_007294.3(BRCA1):c.1636_1654del19 (p.Met546Valfs) rs80359881
NM_007294.3(BRCA1):c.1637_1685del49ins5
NM_007294.3(BRCA1):c.1637_1685del49insGAAAG (p.Met546Argfs) rs483353085
NM_007294.3(BRCA1):c.1638_1646delGAATATTACinsA (p.Met546Ilefs) rs1135401846
NM_007294.3(BRCA1):c.1642_1643del (p.Ile548Tyrfs) rs886039960
NM_007294.3(BRCA1):c.1649delA (p.Asn550Ilefs) rs80357619
NM_007294.3(BRCA1):c.1650dupT (p.Ser551Terfs) rs753524038
NM_007294.3(BRCA1):c.1651_1652insC (p.Ser551Thrfs) rs886039961
NM_007294.3(BRCA1):c.1652_1653insC (p.Gly552Trpfs) rs1555591420
NM_007294.3(BRCA1):c.165_166dupGA (p.Lys56Argfs) rs80357550
NM_007294.3(BRCA1):c.1660G>T (p.Glu554Ter) rs397508894
NM_007294.3(BRCA1):c.1669del (p.Thr557Glnfs) rs886039962
NM_007294.3(BRCA1):c.1670_1673delCAAA (p.Thr557Lysfs) rs1555591390
NM_007294.3(BRCA1):c.1673_1674delAA (p.Lys558Argfs) rs80357600
NM_007294.3(BRCA1):c.1674delA (p.Gly559Valfs) rs80357600
NM_007294.3(BRCA1):c.1674dupA (p.Gly559Argfs) rs80357600
NM_007294.3(BRCA1):c.1676delG (p.Gly559Valfs) rs1555591383
NM_007294.3(BRCA1):c.1685_1686insGAAAG (p.Ile562Metfs) rs1555591372
NM_007294.3(BRCA1):c.1687C>T (p.Gln563Ter) rs80356898
NM_007294.3(BRCA1):c.1693G>T (p.Glu565Ter) rs886039963
NM_007294.3(BRCA1):c.1695dupG (p.Lys566Glufs) rs273897664
NM_007294.3(BRCA1):c.1700delA (p.Asn567Ilefs) rs80357784
NM_007294.3(BRCA1):c.1700dupA (p.Asn567Lysfs) rs80357784
NM_007294.3(BRCA1):c.1713_1717delAGAAT (p.Glu572Thrfs) rs80357640
NM_007294.3(BRCA1):c.1714G>T (p.Glu572Ter) rs730881473
NM_007294.3(BRCA1):c.1716delA (p.Glu572Aspfs) rs397508900
NM_007294.3(BRCA1):c.1716dupA (p.Ser573Ilefs) rs397508900
NM_007294.3(BRCA1):c.171delG (p.Pro58Leufs) rs80357660
NM_007294.3(BRCA1):c.171dupG (p.Pro58Alafs) rs80357660
NM_007294.3(BRCA1):c.1723G>T (p.Glu575Ter) rs397508902
NM_007294.3(BRCA1):c.1723dup (p.Glu575Glyfs) rs1555591335
NM_007294.3(BRCA1):c.1725_1726insG (p.Lys576Glufs) rs1135401847
NM_007294.3(BRCA1):c.1726_1727insG (p.Lys576Argfs) rs1555591326
NM_007294.3(BRCA1):c.1728dupA (p.Glu577Argfs) rs397507192
NM_007294.3(BRCA1):c.1729G>T (p.Glu577Ter) rs397508903
NM_007294.3(BRCA1):c.1729_1730delGA (p.Glu577Ilefs) rs80357834
NM_007294.3(BRCA1):c.1733_1734delCT (p.Ser578Cysfs) rs886037991
NM_007294.3(BRCA1):c.1741A>T (p.Lys581Ter) rs397508905
NM_007294.3(BRCA1):c.1744delA (p.Thr582Argfs) rs398122641
NM_007294.3(BRCA1):c.1747A>T (p.Lys583Ter) rs80356928
NM_007294.3(BRCA1):c.1749_1755del (p.Lys583Asnfs) rs886039965
NM_007294.3(BRCA1):c.1757_1760delCTATinsGA (p.Pro586Argfs) rs1555591287
NM_007294.3(BRCA1):c.1757delC (p.Pro586Leufs) rs80357723
NM_007294.3(BRCA1):c.1759_1762delATAA (p.Ile587Alafs) rs879255479
NM_007294.3(BRCA1):c.1759delA (p.Ile587Terfs) rs398122642
NM_007294.3(BRCA1):c.1760dup (p.Ser588Lysfs) rs1555591286
NM_007294.3(BRCA1):c.1762dup (p.Ser588Lysfs) rs886039966
NM_007294.3(BRCA1):c.1763_1764delGC (p.Ser588Lysfs) rs879254237
NM_007294.3(BRCA1):c.1765delA (p.Ser589Alafs) rs1555591273
NM_007294.3(BRCA1):c.1768_1770delAGTinsC (p.Ser590Hisfs) rs876659196
NM_007294.3(BRCA1):c.176C>A (p.Ser59Ter) rs199522616
NM_007294.3(BRCA1):c.1772delT (p.Ile591Lysfs) rs80357901
NM_007294.3(BRCA1):c.1779_1785del (p.Met594Serfs) rs886039967
NM_007294.3(BRCA1):c.1780delA (p.Met594Trpfs) rs1135401848
NM_007294.3(BRCA1):c.1785delA (p.Glu595Aspfs)
NM_007294.3(BRCA1):c.1789G>T (p.Glu597Ter) rs55650082
NM_007294.3(BRCA1):c.178C>T (p.Gln60Ter) rs80357471
NM_007294.3(BRCA1):c.178_179delCA (p.Gln60Valfs) rs397508907
NM_007294.3(BRCA1):c.1793T>A (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1793T>G (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1795_1798del (p.Asn599Serfs) rs886039968
NM_007294.3(BRCA1):c.1799delT (p.Ile600Thrfs) rs878854934
NM_007294.3(BRCA1):c.179delA (p.Gln60Argfs) rs80357591
NM_007294.3(BRCA1):c.179dup (p.Cys61Valfs) rs886039969
NM_007294.3(BRCA1):c.1803del (p.His601Glnfs) rs886039970
NM_007294.3(BRCA1):c.1805delA (p.Asn602Ilefs) rs397508908
NM_007294.3(BRCA1):c.1808C>G (p.Ser603Ter) rs397508909
NM_007294.3(BRCA1):c.1812delA (p.Ala605Hisfs) rs80357927
NM_007294.3(BRCA1):c.1817delC (p.Pro606Leufs) rs397508910
NM_007294.3(BRCA1):c.1819A>T (p.Lys607Ter) rs80357220
NM_007294.3(BRCA1):c.181T>A (p.Cys61Ser) rs28897672
NM_007294.3(BRCA1):c.181T>C (p.Cys61Arg) rs28897672
NM_007294.3(BRCA1):c.181T>G (p.Cys61Gly) rs28897672
NM_007294.3(BRCA1):c.1820_1823del (p.Lys607Argfs) rs397508911
NM_007294.3(BRCA1):c.1823_1826delAGAA (p.Lys608Ilefs) rs80357585
NM_007294.3(BRCA1):c.1823delA (p.Lys608Argfs) rs397508911
NM_007294.3(BRCA1):c.1826delA (p.Asn609Ilefs) rs80357736
NM_007294.3(BRCA1):c.182G>A (p.Cys61Tyr) rs80357093
NM_007294.3(BRCA1):c.182_183delGT (p.Cys61Serfs) rs397508912
NM_007294.3(BRCA1):c.182_183insGCGC (p.Cys61Trpfs) rs886039971
NM_007294.3(BRCA1):c.1831delC (p.Leu611Terfs) rs397508913
NM_007294.3(BRCA1):c.1836dupG (p.Arg613Glufs) rs876660523
NM_007294.3(BRCA1):c.1837delA (p.Arg613Glyfs) rs80357652
NM_007294.3(BRCA1):c.1839_1840delGA (p.Lys614Valfs) rs752474843
NM_007294.3(BRCA1):c.183_184insGCGC (p.Pro62Alafs) rs1555597239
NM_007294.3(BRCA1):c.1840A>T (p.Lys614Ter) rs80357282
NM_007294.3(BRCA1):c.1842_1843dupGT (p.Ser615Cysfs) rs767595162
NM_007294.3(BRCA1):c.1844_1845insG (p.Ser616Phefs) rs886039973
NM_007294.3(BRCA1):c.1845_1846insG (p.Ser616Valfs) rs1555591112
NM_007294.3(BRCA1):c.1846dupT (p.Ser616Phefs) rs397508914
NM_007294.3(BRCA1):c.1847del (p.Ser616Leufs) rs886039974
NM_007294.3(BRCA1):c.1854delG (p.Arg618Serfs) rs397507193
NM_007294.3(BRCA1):c.1860delT (p.His621Metfs) rs730881459
NM_007294.3(BRCA1):c.1870G>T (p.Glu624Ter) rs80356950
NM_007294.3(BRCA1):c.1874_1877dupTAGT (p.Val627Serfs) rs80357516
NM_007294.3(BRCA1):c.1875delA (p.Val626Terfs) rs398122646
NM_007294.3(BRCA1):c.1877_1878ins4
NM_007294.3(BRCA1):c.1878_1879insTAGT (p.Val627Terfs) rs886039975
NM_007294.3(BRCA1):c.187_188delTT (p.Leu63Metfs) rs1555597235
NM_007294.3(BRCA1):c.1880_1881insAGTT (p.Ser628Valfs) rs1555591019
NM_007294.3(BRCA1):c.1881_1882insCC (p.Ser628Profs) rs878853289
NM_007294.3(BRCA1):c.1881_1884delCAGT (p.Ser628Glufs) rs80357567
NM_007294.3(BRCA1):c.1882_1883insCC (p.Ser628Thrfs) rs1555590997
NM_007294.3(BRCA1):c.1885A>T (p.Arg629Ter) rs1555590987
NM_007294.3(BRCA1):c.1885del (p.Arg629Glufs) rs886039976
NM_007294.3(BRCA1):c.1887_1900dup (p.Pro634Glnfs) rs886039977
NM_007294.3(BRCA1):c.188T>A (p.Leu63Ter) rs80357086
NM_007294.3(BRCA1):c.1892dupT (p.Ser632Lysfs) rs80357932
NM_007294.3(BRCA1):c.1893_1894insT (p.Ser632Terfs) rs80357768
NM_007294.3(BRCA1):c.1894_1895insT (p.Ser632Metfs) rs1555590964
NM_007294.3(BRCA1):c.1898delC (p.Pro633Hisfs) rs80357851
NM_007294.3(BRCA1):c.189dupA (p.Cys64Metfs) rs273897665
NM_007294.3(BRCA1):c.18_19insG (p.Arg7Alafs) rs398122648
NM_007294.3(BRCA1):c.1902dup (p.Asn635Terfs)
NM_007294.3(BRCA1):c.1905_1909del (p.Cys636Terfs) rs886039979
NM_007294.3(BRCA1):c.1906delT (p.Cys636Valfs) rs397508916
NM_007294.3(BRCA1):c.1908_1911del (p.Cys636Trpfs) rs886039980
NM_007294.3(BRCA1):c.190T>C (p.Cys64Arg) rs80357064
NM_007294.3(BRCA1):c.190T>G (p.Cys64Gly) rs80357064
NM_007294.3(BRCA1):c.190_191insAATGTAAGGATGATATAAA (p.Cys64Terfs) rs1555597215
NM_007294.3(BRCA1):c.190_193delTGTA (p.Cys64Argfs) rs397508917
NM_007294.3(BRCA1):c.190_211del (p.Cys64Glyfs) rs886039978
NM_007294.3(BRCA1):c.1912G>T (p.Glu638Ter) rs80357005
NM_007294.3(BRCA1):c.1912delG (p.Glu638Asnfs) rs80357933
NM_007294.3(BRCA1):c.1916T>A (p.Leu639Ter) rs80357267
NM_007294.3(BRCA1):c.1917_1936del (p.Ile641Terfs)
NM_007294.3(BRCA1):c.1918C>T (p.Gln640Ter) rs886039981
NM_007294.3(BRCA1):c.191G>A (p.Cys64Tyr) rs55851803
NM_007294.3(BRCA1):c.1921delA (p.Ile641Leufs) rs397507194
NM_007294.3(BRCA1):c.1921dupA (p.Ile641Asnfs) rs397507194
NM_007294.3(BRCA1):c.1923dupT (p.Asp642Terfs) rs878854935
NM_007294.3(BRCA1):c.1929_1930delTTinsA (p.Ser643Argfs) rs886039982
NM_007294.3(BRCA1):c.192T>A (p.Cys64Ter) rs587781632
NM_007294.3(BRCA1):c.192T>G (p.Cys64Trp) rs587781632
NM_007294.3(BRCA1):c.1930del (p.Cys644Valfs) rs886039982
NM_007294.3(BRCA1):c.1936delA (p.Ser646Alafs) rs397508919
NM_007294.3(BRCA1):c.1938_1945del (p.Ser646Argfs) rs886039983
NM_007294.3(BRCA1):c.1938_1947delCAGTGAAGAG (p.Ser646Argfs) rs397508920
NM_007294.3(BRCA1):c.1942G>T (p.Glu648Ter) rs886039984
NM_007294.3(BRCA1):c.1945G>T (p.Glu649Ter) rs80356907
NM_007294.3(BRCA1):c.1949_1950delTA (p.Ile650Lysfs) rs397508921
NM_007294.3(BRCA1):c.1949_1950insCA (p.Lys652Argfs) rs1555590829
NM_007294.3(BRCA1):c.1949_1952del (p.Ile650Argfs) rs886039985
NM_007294.3(BRCA1):c.1949dupT (p.Lys652Glufs) rs879255480
NM_007294.3(BRCA1):c.1950_1951insCA (p.Lys651Glnfs) rs1555590811
NM_007294.3(BRCA1):c.1952delA (p.Lys651Argfs) rs80357885
NM_007294.3(BRCA1):c.1952dupA (p.Lys652Glufs) rs80357885
NM_007294.3(BRCA1):c.1953_1956delGAAA (p.Lys653Serfs) rs80357526
NM_007294.3(BRCA1):c.1953del (p.Lys654Serfs) rs886039986
NM_007294.3(BRCA1):c.1953dupG (p.Lys652Glufs) rs80357753
NM_007294.3(BRCA1):c.1958_1961delAAAA (p.Lys653Serfs) rs80357522
NM_007294.3(BRCA1):c.195delG (p.Asn66Metfs) rs80357869
NM_007294.3(BRCA1):c.1960A>T (p.Lys654Ter) rs80357355
NM_007294.3(BRCA1):c.1960_1961delAA (p.Lys654Valfs) rs80357522
NM_007294.3(BRCA1):c.1961_1962delAG (p.Lys654Ilefs) rs886037993
NM_007294.3(BRCA1):c.1961delA (p.Lys654Serfs) rs80357522
NM_007294.3(BRCA1):c.1961dupA (p.Tyr655Valfs) rs80357522
NM_007294.3(BRCA1):c.1962_1968delGTACAAC (p.Lys654Asnfs) rs1135401849
NM_007294.3(BRCA1):c.1962dup (p.Tyr655Valfs)
NM_007294.3(BRCA1):c.1963_1964insG (p.Tyr655Terfs) rs1555590789
NM_007294.3(BRCA1):c.1963dupT (p.Tyr655Leufs) rs397508924
NM_007294.3(BRCA1):c.1964_1965insG (p.Tyr655Terfs) rs1555590775
NM_007294.3(BRCA1):c.1964delA (p.Tyr655Serfs) rs786203594
NM_007294.3(BRCA1):c.1965C>A (p.Tyr655Ter) rs886039987
NM_007294.3(BRCA1):c.1969C>T (p.Gln657Ter) rs397508926
NM_007294.3(BRCA1):c.1972delA (p.Met658Cysfs) rs397507195
NM_007294.3(BRCA1):c.1977_1978delAG (p.Val660Glnfs) rs773413634
NM_007294.3(BRCA1):c.1978delG (p.Val660Serfs) rs886039988
NM_007294.3(BRCA1):c.1994delA (p.Asn665Thrfs) rs1555590714
NM_007294.3(BRCA1):c.1996delC (p.Leu666Tyrfs) rs80357922
NM_007294.3(BRCA1):c.1999C>T (p.Gln667Ter) rs80356889
NM_007294.3(BRCA1):c.19_47del29 (p.Arg7Cysfs) rs80359871
NM_007294.3(BRCA1):c.1A>G (p.Met1Val) rs80357287
NM_007294.3(BRCA1):c.2001dupA (p.Leu668Thrfs) rs80357521
NM_007294.3(BRCA1):c.2012_2013dupGT (p.Lys672Valfs) rs397508928
NM_007294.3(BRCA1):c.2012dup (p.Lys672Terfs) rs886039989
NM_007294.3(BRCA1):c.2014A>T (p.Lys672Ter) rs397508929
NM_007294.3(BRCA1):c.2017G>T (p.Glu673Ter) rs80357391
NM_007294.3(BRCA1):c.2017delG (p.Glu673Asnfs) rs80357638
NM_007294.3(BRCA1):c.2019delA (p.Glu673Aspfs) rs80357626
NM_007294.3(BRCA1):c.2021delC (p.Pro674Leufs) rs397508930
NM_007294.3(BRCA1):c.2028_2029delTG (p.Gly677Serfs) rs397508931
NM_007294.3(BRCA1):c.202dupA (p.Ile68Asnfs) rs886039990
NM_007294.3(BRCA1):c.2035A>T (p.Lys679Ter) rs80357082
NM_007294.3(BRCA1):c.2037delGinsCC (p.Lys679Asnfs) rs397508932
NM_007294.3(BRCA1):c.2038A>T (p.Lys680Ter) rs1135401850
NM_007294.3(BRCA1):c.2038_2039insCC (p.Lys680Thrfs) rs80357940
NM_007294.3(BRCA1):c.2039_2040insCC (p.Lys680Asnfs) rs1555590620
NM_007294.3(BRCA1):c.203_204delTA (p.Ile68Asnfs) rs398122651
NM_007294.3(BRCA1):c.2043dupT (p.Asn682Terfs) rs863224510
NM_007294.3(BRCA1):c.2048delA (p.Lys683Serfs) rs397508933
NM_007294.3(BRCA1):c.2056G>T (p.Glu686Ter) rs587782709
NM_007294.3(BRCA1):c.2059C>T (p.Gln687Ter) rs273898674
NM_007294.3(BRCA1):c.205dupA (p.Thr69Asnfs) rs273898673
NM_007294.3(BRCA1):c.2063_2066delCAAG (p.Thr688Ilefs) rs397508935
NM_007294.3(BRCA1):c.2066_2069delGTAA (p.Ser689Lysfs) rs886037994
NM_007294.3(BRCA1):c.2066dup (p.Ser689Argfs)
NM_007294.3(BRCA1):c.2068A>T (p.Lys690Ter) rs587781448
NM_007294.3(BRCA1):c.2070_2071delAA (p.Arg691Thrfs) rs80357688
NM_007294.3(BRCA1):c.2071delA (p.Arg691Aspfs) rs80357688
NM_007294.3(BRCA1):c.2074_2075delCA (p.His692Terfs) rs886037995
NM_007294.3(BRCA1):c.2074delC (p.His692Metfs) rs80357554
NM_007294.3(BRCA1):c.2075_2076delAT (p.His692Argfs) rs397508936
NM_007294.3(BRCA1):c.2077_2078insTA (p.Asp693Valfs) rs80357595
NM_007294.3(BRCA1):c.2077delGinsATA (p.Asp693Ilefs) rs886039991
NM_007294.3(BRCA1):c.2078_2079insTA (p.Ser694Thrfs) rs886039992
NM_007294.3(BRCA1):c.2079_2080delCA (p.Asp693Glufs) rs80357773
NM_007294.3(BRCA1):c.2079_2080insTA (p.Ser694Terfs) rs1555590520
NM_007294.3(BRCA1):c.2080dup (p.Ser694Lysfs) rs886039993
NM_007294.3(BRCA1):c.2083delG (p.Asp695Ilefs) rs1555590505
NM_007294.3(BRCA1):c.2086_2089del (p.Thr696Serfs) rs886039994
NM_007294.3(BRCA1):c.2086delA (p.Thr696Leufs) rs397508937
NM_007294.3(BRCA1):c.2086dup (p.Thr696Asnfs) rs886039995
NM_007294.3(BRCA1):c.2090delT (p.Phe697Serfs) rs886039996
NM_007294.3(BRCA1):c.2090dupT (p.Glu699Argfs) rs886039996
NM_007294.3(BRCA1):c.2095G>T (p.Glu699Ter) rs876658306
NM_007294.3(BRCA1):c.2098_2099insA (p.Leu700Hisfs) rs483353086
NM_007294.3(BRCA1):c.2099_2100insA (p.Lys701Glufs) rs1555590461
NM_007294.3(BRCA1):c.20dup (p.Val8Argfs) rs1555601027
NM_007294.3(BRCA1):c.2101A>T (p.Lys701Ter) rs876660282
NM_007294.3(BRCA1):c.2101_2102delAA (p.Lys701Valfs) rs431825389
NM_007294.3(BRCA1):c.2105T>G (p.Leu702Ter) rs80357298
NM_007294.3(BRCA1):c.2105del (p.Leu702Terfs) rs80357880
NM_007294.3(BRCA1):c.2105dupT (p.Leu702Phefs) rs80357880
NM_007294.3(BRCA1):c.2110_2111delAA (p.Asn704Cysfs) rs80357814
NM_007294.3(BRCA1):c.2112_2131dup (p.Lys711Metfs) rs886039998
NM_007294.3(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.3(BRCA1):c.211delA (p.Arg71Glyfs) rs397508938
NM_007294.3(BRCA1):c.211dupA (p.Arg71Lysfs) rs397508938
NM_007294.3(BRCA1):c.212+1G>A rs80358042
NM_007294.3(BRCA1):c.212+1G>C rs80358042
NM_007294.3(BRCA1):c.212+1G>T rs80358042
NM_007294.3(BRCA1):c.212+2T>C rs80358026
NM_007294.3(BRCA1):c.212+3A>G rs80358083
NM_007294.3(BRCA1):c.2120delG (p.Gly707Valfs) rs1555590441
NM_007294.3(BRCA1):c.2125_2126ins3
NM_007294.3(BRCA1):c.2125_2126insA (p.Phe709Tyrfs) rs80357871
NM_007294.3(BRCA1):c.2125_2126insAGT (p.Phe709_Asn1043delinsTer) rs1555590428
NM_007294.3(BRCA1):c.2126_2127delTT (p.Phe709Tyrfs) rs397508939
NM_007294.3(BRCA1):c.2126_2127insA (p.Phe709Leufs) rs1135401851
NM_007294.3(BRCA1):c.2127_2128insGA (p.Thr710Glufs) rs886039999
NM_007294.3(BRCA1):c.2127del (p.Phe709Leufs) rs397508939
NM_007294.3(BRCA1):c.2128_2129insGA (p.Thr710Argfs) rs1555590415
NM_007294.3(BRCA1):c.2128dup (p.Thr710Asnfs) rs1555590415
NM_007294.3(BRCA1):c.212G>A (p.Arg71Lys) rs80356913
NM_007294.3(BRCA1):c.212G>C (p.Arg71Thr) rs80356913
NM_007294.3(BRCA1):c.212G>T (p.Arg71Met) rs80356913
NM_007294.3(BRCA1):c.213-11T>G rs80358061
NM_007294.3(BRCA1):c.213-12A>G rs80358163
NM_007294.3(BRCA1):c.213-15A>G rs886040903
NM_007294.3(BRCA1):c.213-1G>A rs80358146
NM_007294.3(BRCA1):c.213-1G>T rs80358146
NM_007294.3(BRCA1):c.213-2A>C rs397508940
NM_007294.3(BRCA1):c.213-2A>G rs397508940
NM_007294.3(BRCA1):c.213-3C>G rs80358119
NM_007294.3(BRCA1):c.213-?_301+?del
NM_007294.3(BRCA1):c.213-?_441+?del
NM_007294.3(BRCA1):c.2130delTinsAA (p.Cys712Valfs) rs1060502332
NM_007294.3(BRCA1):c.2131_2132delAA (p.Lys711Valfs) rs398122653
NM_007294.3(BRCA1):c.2135_2136delGT (p.Cys712Phefs) rs886040001
NM_007294.3(BRCA1):c.2138C>A (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2138C>G (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2138_2139dup (p.Asn714Glnfs) rs886040002
NM_007294.3(BRCA1):c.2142_2144delTACinsAG (p.Asn714Lysfs) rs886040003
NM_007294.3(BRCA1):c.2142delT (p.Asn714Lysfs) rs273898679
NM_007294.3(BRCA1):c.2143_2155delACCAGTGAACTTAinsTCTTT (p.Thr715Serfs)
NM_007294.3(BRCA1):c.2145delC (p.Ser716Valfs) rs886037996
NM_007294.3(BRCA1):c.2149G>T (p.Glu717Ter) rs886040004
NM_007294.3(BRCA1):c.2155A>T (p.Lys719Ter) rs80357147
NM_007294.3(BRCA1):c.2155_2168delAAAGAATTTGTCAA (p.Lys719Serfs) rs397508941
NM_007294.3(BRCA1):c.2155_2221dup67 (p.Ser741Terfs) rs1555590136
NM_007294.3(BRCA1):c.2156_2163dup (p.Val722Lysfs) rs1555590322
NM_007294.3(BRCA1):c.2157_2160del (p.Lys719Asnfs) rs886040005
NM_007294.3(BRCA1):c.2157dupA (p.Glu720Argfs) rs80357715
NM_007294.3(BRCA1):c.2158G>T (p.Glu720Ter) rs80356875
NM_007294.3(BRCA1):c.2161_2162insG (p.Phe721Cysfs) rs886040006
NM_007294.3(BRCA1):c.2162_2163delTT (p.Phe721Cysfs) rs1555590319
NM_007294.3(BRCA1):c.2162_2163insG (p.Phe721Leufs) rs1555590332
NM_007294.3(BRCA1):c.2164delG (p.Val722Serfs) rs1555590315
NM_007294.3(BRCA1):c.2166delC (p.Asn723Ilefs) rs397508943
NM_007294.3(BRCA1):c.2174delG (p.Ser725Thrfs) rs397508944
NM_007294.3(BRCA1):c.2176_2177delCT (p.Leu726Serfs) rs397508945
NM_007294.3(BRCA1):c.2176delC (p.Leu726Phefs) rs80357668
NM_007294.3(BRCA1):c.2185G>T (p.Glu729Ter) rs876659852
NM_007294.3(BRCA1):c.2185_2189del (p.Glu729Lysfs) rs886040007
NM_007294.3(BRCA1):c.2185delG (p.Glu729Lysfs) rs1064795840
NM_007294.3(BRCA1):c.2188G>T (p.Glu730Ter) rs80357058
NM_007294.3(BRCA1):c.2188_2195delGAAAAAGAinsAAAAAGG (p.Glu730Lysfs) rs886040008
NM_007294.3(BRCA1):c.2188_2201delGAAAAAGAAGAGAA (p.Glu730Thrfs) rs273898681
NM_007294.3(BRCA1):c.2188dupG (p.Glu730Glyfs) rs80357566
NM_007294.3(BRCA1):c.2192_2196delAAGAA (p.Lys731Argfs) rs397508946
NM_007294.3(BRCA1):c.2193_2196delAGAA (p.Glu732Argfs) rs397508947
NM_007294.3(BRCA1):c.2193delA (p.Glu732Lysfs) rs886040009
NM_007294.3(BRCA1):c.2194G>T (p.Glu732Ter) rs80357426
NM_007294.3(BRCA1):c.2194delGinsAA (p.Glu732Lysfs) rs886040010
NM_007294.3(BRCA1):c.2195_2196delAAinsG (p.Glu732Glyfs) rs397508948
NM_007294.3(BRCA1):c.2196delA (p.Glu733Argfs) rs397508948
NM_007294.3(BRCA1):c.2197G>T (p.Glu733Ter) rs397508949
NM_007294.3(BRCA1):c.2197_2201delGAGAA (p.Glu733Thrfs) rs80357507
NM_007294.3(BRCA1):c.2198dup (p.Lys734Glufs) rs886040012
NM_007294.3(BRCA1):c.2199delG (p.Lys734Asnfs) rs80357944
NM_007294.3(BRCA1):c.2202delA (p.Lys734Asnfs) rs80357982
NM_007294.3(BRCA1):c.2202dup (p.Leu735Thrfs) rs80357982
NM_007294.3(BRCA1):c.2203delC (p.Leu735Terfs) rs80357936
NM_007294.3(BRCA1):c.2205del (p.Glu736Lysfs) rs886040015
NM_007294.3(BRCA1):c.2206delG (p.Glu736Lysfs) rs80357860
NM_007294.3(BRCA1):c.2209delA (p.Thr737Glnfs) rs1060502333
NM_007294.3(BRCA1):c.220C>T (p.Gln74Ter) rs80357234
NM_007294.3(BRCA1):c.2210_2211delCA (p.Thr737Serfs) rs80357654
NM_007294.3(BRCA1):c.2210delC (p.Thr737Lysfs) rs80357793
NM_007294.3(BRCA1):c.2211_2212delAG (p.Val738Terfs) rs397508950
NM_007294.3(BRCA1):c.2211dup (p.Val738Serfs) rs886040016
NM_007294.3(BRCA1):c.2212_2215delGTTA (p.Val738Lysfs) rs397508951
NM_007294.3(BRCA1):c.2214_2215insTT (p.Lys739Leufs) rs80357574
NM_007294.3(BRCA1):c.2214_2218delTAAAGinsAAA (p.Lys739Asnfs) rs886040017
NM_007294.3(BRCA1):c.2214delT (p.Val740Cysfs) rs80357574
NM_007294.3(BRCA1):c.2214dupT (p.Lys739Terfs) rs80357574
NM_007294.3(BRCA1):c.2215A>T (p.Lys739Ter) rs56329598
NM_007294.3(BRCA1):c.2215_2216insCT (p.Lys739Thrfs) rs80357930
NM_007294.3(BRCA1):c.2216_2217delAA (p.Lys739Serfs) rs397508952
NM_007294.3(BRCA1):c.2216_2217insCT (p.Lys739Asnfs) rs1555590163
NM_007294.3(BRCA1):c.2217dupA (p.Val740Serfs) rs80357802
NM_007294.3(BRCA1):c.2218del (p.Val740Cysfs) rs886040018
NM_007294.3(BRCA1):c.2222_2223del (p.Ser741Terfs) rs886040019
NM_007294.3(BRCA1):c.2223dup (p.Asn742Terfs) rs886040020
NM_007294.3(BRCA1):c.2226_2227delTA (p.Asn742Lysfs) rs878854938
NM_007294.3(BRCA1):c.2228delA (p.Asn743Metfs) rs1555590121
NM_007294.3(BRCA1):c.2236dupG (p.Asp746Glyfs) rs80357909
NM_007294.3(BRCA1):c.2241delC (p.Asp749Ilefs) rs80357650
NM_007294.3(BRCA1):c.2241dupC (p.Lys748Glnfs) rs80357650
NM_007294.3(BRCA1):c.2242_2251delAAAGATCTCA (p.Lys748Cysfs) rs886037997
NM_007294.3(BRCA1):c.2246_2247insGA (p.Asp749Glufs) rs398122654
NM_007294.3(BRCA1):c.2246_2280delATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACT (p.Asp749Glyfs) rs886037998
NM_007294.3(BRCA1):c.2247_2248insGA (p.Leu750Aspfs) rs1555590055
NM_007294.3(BRCA1):c.2248_2252delCTCAT (p.Leu750Valfs) rs397508954
NM_007294.3(BRCA1):c.224_227delAAAG (p.Glu75Valfs) rs80357697
NM_007294.3(BRCA1):c.2253_2254delGT (p.Met751Ilefs) rs80357602
NM_007294.3(BRCA1):c.2255T>A (p.Leu752Ter) rs1135401852
NM_007294.3(BRCA1):c.2255_2256dupTA (p.Ser753Terfs) rs80357557
NM_007294.3(BRCA1):c.2257dupA (p.Ser753Lysfs) rs1555590033
NM_007294.3(BRCA1):c.2263G>T (p.Glu755Ter) rs41286296
NM_007294.3(BRCA1):c.2263delG (p.Glu755Lysfs) rs80357960
NM_007294.3(BRCA1):c.2269delG (p.Val757Phefs) rs80357583
NM_007294.3(BRCA1):c.2273T>A (p.Leu758Ter) rs1060502334
NM_007294.3(BRCA1):c.2273del (p.Leu758Cysfs) rs80357681
NM_007294.3(BRCA1):c.2273dupT (p.Leu758Phefs) rs80357681
NM_007294.3(BRCA1):c.2275C>T (p.Gln759Ter) rs80356999
NM_007294.3(BRCA1):c.2283_2284delAA (p.Arg762Ilefs) rs80357657
NM_007294.3(BRCA1):c.2289delT (p.Val764Terfs) rs876658791
NM_007294.3(BRCA1):c.2292_2310dup19 (p.Leu771Argfs) rs397508955
NM_007294.3(BRCA1):c.2293G>T (p.Glu765Ter) rs80357449
NM_007294.3(BRCA1):c.2296_2297delAG (p.Ser766Terfs) rs80357780
NM_007294.3(BRCA1):c.2298dupT (p.Ser767Terfs) rs786204264
NM_007294.3(BRCA1):c.2299delA (p.Ser767Alafs) rs80357786
NM_007294.3(BRCA1):c.22_50del (p.Val8Tyrfs) rs886040013
NM_007294.3(BRCA1):c.2302delA (p.Ser768Valfs) rs1555589953
NM_007294.3(BRCA1):c.2307_2313del (p.Ile769Metfs) rs886040022
NM_007294.3(BRCA1):c.2308delT (p.Ser770Hisfs) rs397508956
NM_007294.3(BRCA1):c.2309C>A (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2309C>G (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2309C>T (p.Ser770Leu) rs80357063
NM_007294.3(BRCA1):c.230delCinsGTCAACTTGTT (p.Thr77Serfs) rs397508957
NM_007294.3(BRCA1):c.2311_2312insC (p.Leu771Serfs) rs886040023
NM_007294.3(BRCA1):c.2311_2317delTTGGTAC (p.Pro773Leufs) rs1060502354
NM_007294.3(BRCA1):c.2312_2313insC (p.Leu771Phefs) rs1555589935
NM_007294.3(BRCA1):c.2314_2315del (p.Val772Thrfs) rs886040024
NM_007294.3(BRCA1):c.2314delG (p.Val772Tyrfs) rs80357957
NM_007294.3(BRCA1):c.2322del (p.Thr775Leufs) rs886040025
NM_007294.3(BRCA1):c.2327dup (p.Asp776Glufs) rs1555589901
NM_007294.3(BRCA1):c.2329delT (p.Tyr777Metfs) rs80357725
NM_007294.3(BRCA1):c.232delA (p.Arg78Aspfs) rs80357884
NM_007294.3(BRCA1):c.2331T>A (p.Tyr777Ter) rs80357444
NM_007294.3(BRCA1):c.2331T>G (p.Tyr777Ter) rs80357444
NM_007294.3(BRCA1):c.2331_2332dupTG (p.Gly778Valfs) rs431825390
NM_007294.3(BRCA1):c.2337_2338delTC (p.Gln780Glyfs) rs80357515
NM_007294.3(BRCA1):c.2338C>T (p.Gln780Ter) rs80356945
NM_007294.3(BRCA1):c.2340_2343del (p.Glu781Valfs) rs886040026
NM_007294.3(BRCA1):c.2346dupT (p.Ile783Tyrfs) rs886040027
NM_007294.3(BRCA1):c.2350_2351delTC (p.Ser784Valfs) rs397508960
NM_007294.3(BRCA1):c.2351_2357delCGTTACT (p.Ser784Trpfs) rs80357820
NM_007294.3(BRCA1):c.2354T>A (p.Leu785Ter) rs397508961
NM_007294.3(BRCA1):c.2355dupA (p.Leu786Thrfs) rs80357990
NM_007294.3(BRCA1):c.2356delC (p.Leu786Trpfs) rs397508962
NM_007294.3(BRCA1):c.2357delT (p.Leu786Argfs) rs397508963
NM_007294.3(BRCA1):c.2359delG (p.Glu787Lysfs) rs80357739
NM_007294.3(BRCA1):c.2359dupG (p.Glu787Glyfs) rs80357739
NM_007294.3(BRCA1):c.2361del (p.Val788Leufs) rs886040028
NM_007294.3(BRCA1):c.2362delG (p.Val788Leufs) rs876659136
NM_007294.3(BRCA1):c.2368_2369del (p.Thr790Serfs) rs886040029
NM_007294.3(BRCA1):c.2376delG (p.Lys793Argfs) rs80357913
NM_007294.3(BRCA1):c.2378dupA (p.Ala794Glyfs) rs864622536
NM_007294.3(BRCA1):c.237del (p.Phe79Leufs) rs886040030
NM_007294.3(BRCA1):c.2380dupG (p.Ala794Glyfs) rs886037999
NM_007294.3(BRCA1):c.2386_2387delACinsT (p.Thr796Terfs) rs876660305
NM_007294.3(BRCA1):c.2386dupA (p.Thr796Asnfs) rs398122657
NM_007294.3(BRCA1):c.2387dup (p.Glu797Argfs) rs886040031
NM_007294.3(BRCA1):c.2389G>T (p.Glu797Ter) rs62625306
NM_007294.3(BRCA1):c.2389_2390delGA (p.Glu797Thrfs) rs80357695
NM_007294.3(BRCA1):c.2389delG (p.Glu797Asnfs) rs397508965
NM_007294.3(BRCA1):c.238_239delAGins22 (p.?)
NM_007294.3(BRCA1):c.2390_2391delAA (p.Glu797Alafs) rs80357546
NM_007294.3(BRCA1):c.2392_2393delCCinsA (p.Pro798Lysfs) rs80357850
NM_007294.3(BRCA1):c.2393delC (p.Pro798Glnfs) rs80357850
NM_007294.3(BRCA1):c.2396del (p.Asn799Ilefs) rs886040033
NM_007294.3(BRCA1):c.2398_2401delAAAT (p.Lys800Valfs) rs786202684
NM_007294.3(BRCA1):c.2398_2411del (p.Lys800Valfs) rs886040034
NM_007294.3(BRCA1):c.239_241delGTCinsTT (p.Ser80Ilefs) rs886040032
NM_007294.3(BRCA1):c.2402delG (p.Cys801Leufs) rs876659447
NM_007294.3(BRCA1):c.2403T>A (p.Cys801Ter) rs80357381
NM_007294.3(BRCA1):c.2405_2406delTG (p.Val802Glufs) rs80357706
NM_007294.3(BRCA1):c.2406_2409delGAGT (p.Gln804Valfs) rs80357674
NM_007294.3(BRCA1):c.2407_2408delAG (p.Gln804Valfs) rs786202919
NM_007294.3(BRCA1):c.2409_2410del (p.Ser803Argfs) rs1555589728
NM_007294.3(BRCA1):c.2409delT (p.Gln804Serfs) rs770460699
NM_007294.3(BRCA1):c.2410C>T (p.Gln804Ter) rs80356982
NM_007294.3(BRCA1):c.2411_2412delAG (p.Gln804Leufs) rs80357664
NM_007294.3(BRCA1):c.2411del (p.Gln804Argfs) rs886040035
NM_007294.3(BRCA1):c.2416_2417delGC (p.Ala806Serfs) rs1555589706
NM_007294.3(BRCA1):c.2418delA (p.Ala807Hisfs) rs879255281
NM_007294.3(BRCA1):c.2418dupA (p.Ala807Serfs) rs886040036
NM_007294.3(BRCA1):c.241C>T (p.Gln81Ter) rs80357350
NM_007294.3(BRCA1):c.241_251delCAACTTGTTGA (p.Gln81Argfs) rs398122659
NM_007294.3(BRCA1):c.2424delT (p.Phe808Leufs) rs397507200
NM_007294.3(BRCA1):c.2429delA (p.Asn810Thrfs) rs397508967
NM_007294.3(BRCA1):c.2429dupA (p.Asn810Lysfs) rs397508967
NM_007294.3(BRCA1):c.2433delC (p.Lys812Argfs) rs80357524
NM_007294.3(BRCA1):c.2433dupC (p.Lys812Glnfs) rs80357524
NM_007294.3(BRCA1):c.2434A>T (p.Lys812Ter) rs397508968
NM_007294.3(BRCA1):c.2437G>T (p.Gly813Ter) rs80357186
NM_007294.3(BRCA1):c.2438dupG (p.Leu814Thrfs) rs80357503
NM_007294.3(BRCA1):c.243delA (p.Gln81Hisfs) rs273899684
NM_007294.3(BRCA1):c.2442_2443insT (p.Ile815Tyrfs) rs886040038
NM_007294.3(BRCA1):c.2443delA (p.Ile815Phefs) rs80357598
NM_007294.3(BRCA1):c.2443dup (p.Ile815Asnfs) rs80357598
NM_007294.3(BRCA1):c.2445_2448delTCAT (p.Ile815Metfs) rs886038000
NM_007294.3(BRCA1):c.2445dup (p.His816Serfs) rs1555589652
NM_007294.3(BRCA1):c.2450delG (p.Gly817Valfs) rs80357679
NM_007294.3(BRCA1):c.2457delC (p.Asp821Ilefs) rs80357669
NM_007294.3(BRCA1):c.2467delA (p.Arg823Glufs) rs1064795446
NM_007294.3(BRCA1):c.2468delG (p.Arg823Lysfs) rs80357799
NM_007294.3(BRCA1):c.246del (p.Val83Leufs) rs886040039
NM_007294.3(BRCA1):c.2473delG (p.Asp825Thrfs) rs886040040
NM_007294.3(BRCA1):c.2474dupA (p.Asp825Glufs) rs80357830
NM_007294.3(BRCA1):c.2475delC (p.Asp825Glufs) rs80357970
NM_007294.3(BRCA1):c.2476delA (p.Thr826Glnfs) rs80357631
NM_007294.3(BRCA1):c.2477_2478delCA (p.Thr826Argfs) rs80357800
NM_007294.3(BRCA1):c.2477_2492del16insTG (p.Thr826Metfs) rs886040041
NM_007294.3(BRCA1):c.2477delC (p.Thr826Lysfs) rs80357740
NM_007294.3(BRCA1):c.2481delA (p.Gly828Alafs) rs886040042
NM_007294.3(BRCA1):c.2486_2487delTT (p.Phe829Terfs) rs80357658
NM_007294.3(BRCA1):c.2487_2488insCCCCT (p.Lys830Profs) rs397508972
NM_007294.3(BRCA1):c.2487delT (p.Phe829Leufs) rs80357658
NM_007294.3(BRCA1):c.2487dupT (p.Lys830Terfs) rs80357658
NM_007294.3(BRCA1):c.2488A>T (p.Lys830Ter) rs1555589569
NM_007294.3(BRCA1):c.2488_2489insCCCCT (p.Lys830Thrfs) rs1555589565
NM_007294.3(BRCA1):c.2488_2497dupAAGTATCCAT (p.Leu833Terfs) rs397508973
NM_007294.3(BRCA1):c.2489_2490insAAGTATCCAT (p.Tyr831Serfs) rs1555589559
NM_007294.3(BRCA1):c.2489_2492delAGTA (p.Lys830Ilefs) rs886040043
NM_007294.3(BRCA1):c.2490_2497dup (p.Leu833Cysfs) rs1555589539
NM_007294.3(BRCA1):c.2493_2494insGT (p.Pro832Valfs) rs1555589547
NM_007294.3(BRCA1):c.2501del (p.Gly834Aspfs) rs886040044
NM_007294.3(BRCA1):c.2504_2505ins17 (p.?)
NM_007294.3(BRCA1):c.2504dup (p.His835Glnfs) rs1555589513
NM_007294.3(BRCA1):c.2506delG (p.Glu836Lysfs) rs587780798
NM_007294.3(BRCA1):c.2507_2508delAA (p.Glu836Glyfs) rs273899686
NM_007294.3(BRCA1):c.250G>T (p.Glu84Ter) rs398122661
NM_007294.3(BRCA1):c.2511delT (p.Asn838Thrfs) rs1555589501
NM_007294.3(BRCA1):c.2513delA (p.Asn838Thrfs) rs80357863
NM_007294.3(BRCA1):c.2515delC (p.His839Thrfs) rs80357607
NM_007294.3(BRCA1):c.2517_2518delCA (p.His839Glnfs) rs397508974
NM_007294.3(BRCA1):c.2518delA (p.Ser840Valfs) rs397508975
NM_007294.3(BRCA1):c.2524G>T (p.Glu842Ter) rs876658552
NM_007294.3(BRCA1):c.2524dup (p.Glu842Glyfs) rs886040045
NM_007294.3(BRCA1):c.2527delA (p.Thr843Glnfs) rs1085308034
NM_007294.3(BRCA1):c.2529_2530del (p.Ser844Hisfs) rs886040046
NM_007294.3(BRCA1):c.2532_2536del (p.Ser844Argfs) rs886040047
NM_007294.3(BRCA1):c.2536G>T (p.Glu846Ter) rs786203523
NM_007294.3(BRCA1):c.2538_2540delAATinsG (p.Met847Glyfs) rs886040048
NM_007294.3(BRCA1):c.2542_2545del (p.Glu848Lysfs) rs886040049
NM_007294.3(BRCA1):c.2545G>T (p.Glu849Ter) rs80356951
NM_007294.3(BRCA1):c.2548delA (p.Ser850Valfs) rs1555589434
NM_007294.3(BRCA1):c.2551G>T (p.Glu851Ter) rs398122662
NM_007294.3(BRCA1):c.2551delG (p.Glu851Asnfs) rs397508977
NM_007294.3(BRCA1):c.2552_2553del (p.Glu851Alafs) rs886040050
NM_007294.3(BRCA1):c.2552_2553dup (p.Leu852Asnfs) rs886040051
NM_007294.3(BRCA1):c.2556_2557insTTCACTTTTC (p.Asp853Phefs) rs397508979
NM_007294.3(BRCA1):c.2556delT (p.Asp853Metfs) rs397508978
NM_007294.3(BRCA1):c.2556dupT (p.Asp853Terfs) rs397508978
NM_007294.3(BRCA1):c.2557_2558insTTCACTTTTC (p.Asp853Valfs) rs1555589410
NM_007294.3(BRCA1):c.2558dupA (p.Asp853Glufs) rs80357835
NM_007294.3(BRCA1):c.2560_2561dupGC (p.Gln855Leufs) rs80357968
NM_007294.3(BRCA1):c.2561_2565delCTCAG (p.Ala854Valfs) rs397508981
NM_007294.3(BRCA1):c.2562_2563insGC (p.Gln855Alafs) rs878853290
NM_007294.3(BRCA1):c.2563C>T (p.Gln855Ter) rs80357131
NM_007294.3(BRCA1):c.2563_2564insGC (p.Gln855Argfs) rs1555589397
NM_007294.3(BRCA1):c.2566_2567insTGATT (p.Tyr856Leufs) rs1555589385
NM_007294.3(BRCA1):c.2568T>G (p.Tyr856Ter) rs80356832
NM_007294.3(BRCA1):c.2570T>A (p.Leu857Ter) rs886037787
NM_007294.3(BRCA1):c.2572C>T (p.Gln858Ter) rs397508983
NM_007294.3(BRCA1):c.2576delA (p.Asn859Ilefs) rs1555589351
NM_007294.3(BRCA1):c.2577_2578insTT (p.Thr860Leufs) rs886040052
NM_007294.3(BRCA1):c.2578_2579insTT (p.Thr860Ilefs) rs1555589340
NM_007294.3(BRCA1):c.2586_2593delGGTTTCAA (p.Val863Alafs) rs80357675
NM_007294.3(BRCA1):c.2587del (p.Val863Phefs) rs886040053
NM_007294.3(BRCA1):c.2589_2594delTTCAAAinsATTCTTTT (p.Ser864Phefs)
NM_007294.3(BRCA1):c.2591C>G (p.Ser864Ter) rs80357003
NM_007294.3(BRCA1):c.2593A>T (p.Lys865Ter) rs587782628
NM_007294.3(BRCA1):c.2594delA (p.Lys865Serfs) rs80357756
NM_007294.3(BRCA1):c.2599C>T (p.Gln867Ter) rs886038001
NM_007294.3(BRCA1):c.2601_2604dupGTCA (p.Phe869Valfs) rs80357603
NM_007294.3(BRCA1):c.2603C>A (p.Ser868Ter) rs80356925
NM_007294.3(BRCA1):c.2603C>G (p.Ser868Ter) rs80356925
NM_007294.3(BRCA1):c.260T>A (p.Leu87Ter) rs886040054
NM_007294.3(BRCA1):c.2611_2612delCC (p.Pro871Valfs) rs80357962
NM_007294.3(BRCA1):c.2612_2613insT (p.Phe872Valfs) rs80357948
NM_007294.3(BRCA1):c.2612delCinsTT (p.Pro871Leufs) rs397508986
NM_007294.3(BRCA1):c.2612dupC (p.Phe872Valfs) rs1555589289
NM_007294.3(BRCA1):c.2617del (p.Ser873Glnfs) rs80357912
NM_007294.3(BRCA1):c.2617dupT (p.Ser873Phefs) rs80357912
NM_007294.3(BRCA1):c.2621delA (p.Asn874Ilefs) rs587781423
NM_007294.3(BRCA1):c.2630delA (p.Asn877Metfs) rs886038002
NM_007294.3(BRCA1):c.2635G>T (p.Glu879Ter) rs80357251
NM_007294.3(BRCA1):c.2637delA (p.Glu880Argfs) rs886040056
NM_007294.3(BRCA1):c.2641G>T (p.Glu881Ter) rs397508988
NM_007294.3(BRCA1):c.2643delA (p.Glu881Aspfs) rs397508989
NM_007294.3(BRCA1):c.2643dup (p.Cys882Metfs)
NM_007294.3(BRCA1):c.2646_2648delTGC (p.Cys882_Ser1217delinsTer) rs80357513
NM_007294.3(BRCA1):c.2647_2648insGGCA (p.Ala883Glyfs) rs1555589236
NM_007294.3(BRCA1):c.2648_2649insGGCA (p.Thr884Alafs) rs886040057
NM_007294.3(BRCA1):c.2649_2650del (p.Thr884Ilefs) rs886040058
NM_007294.3(BRCA1):c.2649_2650insGGCA (p.Thr884Glyfs) rs886038003
NM_007294.3(BRCA1):c.2650_2651insGGCA (p.Thr884Argfs) rs1555589228
NM_007294.3(BRCA1):c.2652dupA (p.Phe885Ilefs) rs886040059
NM_007294.3(BRCA1):c.2654delT (p.Phe885Serfs) rs398122663
NM_007294.3(BRCA1):c.2654dupT (p.Ser886Leufs) rs398122663
NM_007294.3(BRCA1):c.2657_2658delCT (p.Ser886Cysfs) rs397508990
NM_007294.3(BRCA1):c.2658_2659insA (p.Ala887Serfs) rs80357541
NM_007294.3(BRCA1):c.2659_2660insA (p.Ala887Aspfs) rs397508991
NM_007294.3(BRCA1):c.2659dupG (p.Ala887Glyfs) rs1555589203
NM_007294.3(BRCA1):c.2660_2661insA (p.His888Profs) rs1555589195
NM_007294.3(BRCA1):c.2665dupT (p.Ser889Phefs) rs397508992
NM_007294.3(BRCA1):c.2666dupC (p.Gly890Trpfs) rs876660425
NM_007294.3(BRCA1):c.2670delG (p.Ser891Profs) rs80357659
NM_007294.3(BRCA1):c.2671delT (p.Ser891Profs) rs397508993
NM_007294.3(BRCA1):c.2675T>G (p.Leu892Ter) rs397508994
NM_007294.3(BRCA1):c.2675_2678delTAAA (p.Leu892Terfs) rs80357518
NM_007294.3(BRCA1):c.2677A>T (p.Lys893Ter) rs80357170
NM_007294.3(BRCA1):c.2678dup (p.Lys894Glufs) rs886040060
NM_007294.3(BRCA1):c.2679_2680delGA (p.Lys894Thrfs) rs397508995
NM_007294.3(BRCA1):c.2679_2682delGAAA (p.Lys893Asnfs) rs80357596
NM_007294.3(BRCA1):c.2680A>T (p.Lys894Ter) rs876659457
NM_007294.3(BRCA1):c.2680_2687delAAACAAAG (p.Lys894Serfs) rs1555589143
NM_007294.3(BRCA1):c.2681_2682delAA (p.Lys894Thrfs) rs80357971
NM_007294.3(BRCA1):c.2682delA (p.Lys894Asnfs) rs80357971
NM_007294.3(BRCA1):c.2683C>T (p.Gln895Ter) rs397508997
NM_007294.3(BRCA1):c.2683_2686delCAAA (p.Gln895Valfs) rs397508998
NM_007294.3(BRCA1):c.2683_2693del (p.Gln895Serfs) rs886040061
NM_007294.3(BRCA1):c.2685_2686delAA (p.Pro897Lysfs) rs80357636
NM_007294.3(BRCA1):c.2686delA (p.Ser896Valfs) rs80357636
NM_007294.3(BRCA1):c.2686dupA (p.Ser896Lysfs) rs80357636
NM_007294.3(BRCA1):c.2687_2688insA (p.Ser896Argfs) rs1135401853
NM_007294.3(BRCA1):c.2687_2693delGTCCAAA (p.Ser896Lysfs) rs886040062
NM_007294.3(BRCA1):c.2688_2689insA (p.Pro897Thrfs) rs1555589140
NM_007294.3(BRCA1):c.2689_2690insAC (p.Pro897Hisfs) rs1555589138
NM_007294.3(BRCA1):c.2690_2691dup (p.Lys898Glnfs) rs1555589128
NM_007294.3(BRCA1):c.2693_2694dupAA (p.Val899Lysfs) rs80357549
NM_007294.3(BRCA1):c.2694del (p.Val899Serfs) rs80357549
NM_007294.3(BRCA1):c.2694dupA (p.Val899Serfs) rs80357549
NM_007294.3(BRCA1):c.269_281delTTTGTGCTTTTCA (p.Ile90Serfs) rs80359879
NM_007294.3(BRCA1):c.2702_2703delTT (p.Phe901Terfs) rs80357899
NM_007294.3(BRCA1):c.2704del (p.Glu902Asnfs) rs886040064
NM_007294.3(BRCA1):c.2706_2707dupAT (p.Cys903Tyrfs) rs80357717
NM_007294.3(BRCA1):c.2707delT (p.Cys903Valfs) rs1064794864
NM_007294.3(BRCA1):c.2709T>A (p.Cys903Ter) rs1555589094
NM_007294.3(BRCA1):c.2709_2710delTG (p.Cys903Terfs) rs886040065
NM_007294.3(BRCA1):c.2709delT (p.Cys903Trpfs) rs80357594
NM_007294.3(BRCA1):c.2710G>T (p.Glu904Ter) rs80357035
NM_007294.3(BRCA1):c.2710del (p.Glu904Asnfs) rs886040066
NM_007294.3(BRCA1):c.2713C>T (p.Gln905Ter) rs397509002
NM_007294.3(BRCA1):c.2717delA (p.Lys906Argfs) rs876659072
NM_007294.3(BRCA1):c.2719G>T (p.Glu907Ter) rs876658593
NM_007294.3(BRCA1):c.2719_2722delGAAG (p.Glu907Lysfs) rs80357731
NM_007294.3(BRCA1):c.2719delG (p.Glu907Lysfs) rs879255481
NM_007294.3(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.3(BRCA1):c.2726_2730delATCAA (p.Asn909Argfs) rs80357712
NM_007294.3(BRCA1):c.2726delA (p.Asn909Ilefs) rs80357614
NM_007294.3(BRCA1):c.2726dupA (p.Asn909Lysfs) rs80357614
NM_007294.3(BRCA1):c.2727_2730delTCAA (p.Asn909Lysfs) rs80357605
NM_007294.3(BRCA1):c.2728C>T (p.Gln910Ter) rs397509004
NM_007294.3(BRCA1):c.2728delC (p.Gln910Lysfs) rs397509005
NM_007294.3(BRCA1):c.273_274delTG (p.Ala92Phefs) rs587776485
NM_007294.3(BRCA1):c.2740G>T (p.Glu914Ter) rs80357419
NM_007294.3(BRCA1):c.2744_2745delCT (p.Ser915Terfs) rs80357540
NM_007294.3(BRCA1):c.2745dupT (p.Asn916Terfs) rs397509008
NM_007294.3(BRCA1):c.2748delT (p.Asn916Lysfs) rs398122667
NM_007294.3(BRCA1):c.2749dupA (p.Ile917Asnfs) rs80357942
NM_007294.3(BRCA1):c.2750del (p.Ile917Thrfs) rs886040067
NM_007294.3(BRCA1):c.2751delC (p.Lys918Serfs) rs886040068
NM_007294.3(BRCA1):c.2753_2755delAGCinsCA (p.Lys918Thrfs) rs886040069
NM_007294.3(BRCA1):c.2754_2755insGGGTG (p.Pro919Glyfs) rs1064793468
NM_007294.3(BRCA1):c.2755_2756insGGGTG (p.Pro919Argfs) rs1555589008
NM_007294.3(BRCA1):c.2760delA (p.Gln921Argfs) rs1064795769
NM_007294.3(BRCA1):c.2761C>T (p.Gln921Ter) rs80357377
NM_007294.3(BRCA1):c.2762delA (p.Gln921Argfs) rs80357703
NM_007294.3(BRCA1):c.2764_2767delACAG (p.Thr922Leufs) rs80357822
NM_007294.3(BRCA1):c.2766delA (p.Val923Leufs) rs80357812
NM_007294.3(BRCA1):c.2767_2770delGTTA (p.Val923Ilefs) rs80357661
NM_007294.3(BRCA1):c.2774delT (p.Ile925Thrfs) rs398122669
NM_007294.3(BRCA1):c.2776_2777del (p.Thr926Cysfs) rs886040070
NM_007294.3(BRCA1):c.2776_2777insTA (p.Thr926Ilefs) rs886040071
NM_007294.3(BRCA1):c.2778_2779insAT (p.Ala927Metfs) rs886040072
NM_007294.3(BRCA1):c.2778dup (p.Ala927Cysfs) rs886040072
NM_007294.3(BRCA1):c.2783delG (p.Gly928Alafs) rs1064795600
NM_007294.3(BRCA1):c.2787_2788insTTATCACTGCAGGCTTT (p.Pro930Leufs) rs886040073
NM_007294.3(BRCA1):c.2788_2789insTTATCACTGCAGGCTTT (p.Pro930Leufs) rs1555588952
NM_007294.3(BRCA1):c.2796_2799delTGGT (p.Gly933Argfs) rs80357840
NM_007294.3(BRCA1):c.2796delT (p.Gly933Valfs) rs1555588942
NM_007294.3(BRCA1):c.2798_2799delGT (p.Gly933Alafs) rs397509011
NM_007294.3(BRCA1):c.2799delT (p.Gln934Argfs) rs80357998
NM_007294.3(BRCA1):c.279_280delTCinsGAA (p.Phe93Leufs) rs1555596663
NM_007294.3(BRCA1):c.2800C>T (p.Gln934Ter) rs80357223
NM_007294.3(BRCA1):c.2805delA (p.Asp936Ilefs) rs397509012
NM_007294.3(BRCA1):c.2805dupA (p.Asp936Argfs) rs397509012
NM_007294.3(BRCA1):c.2806_2807delGA (p.Asp936Terfs) rs886038004
NM_007294.3(BRCA1):c.2806_2809delGATA (p.Asp936Serfs) rs80357832
NM_007294.3(BRCA1):c.2808_2811delTAAG (p.Lys937Glnfs) rs397509013
NM_007294.3(BRCA1):c.2809A>T (p.Lys937Ter) rs1555588915
NM_007294.3(BRCA1):c.280C>T (p.Gln94Ter) rs886037972
NM_007294.3(BRCA1):c.2812_2813delCC (p.Pro938Serfs) rs730882056
NM_007294.3(BRCA1):c.2812_2813delCCinsG (p.Pro938Glufs) rs273899689
NM_007294.3(BRCA1):c.2814del (p.Val939Leufs) rs886040074
NM_007294.3(BRCA1):c.2820_2830delTAATGCCAAATinsAAGATAAGCCAGTTTGATAA (p.Asp940_Lys1278delinsGluArgTer) rs1555588883
NM_007294.3(BRCA1):c.2823delT (p.Asn941Lysfs) rs886040075
NM_007294.3(BRCA1):c.2830delT (p.Cys944Valfs) rs397509014
NM_007294.3(BRCA1):c.2832T>A (p.Cys944Ter) rs80357458
NM_007294.3(BRCA1):c.2834_2835delGT (p.Ser945Asnfs) rs397509015
NM_007294.3(BRCA1):c.2834_2836delGTAinsC (p.Ser945Thrfs) rs386134270
NM_007294.3(BRCA1):c.2835dupT (p.Ile946Tyrfs) rs80357519
NM_007294.3(BRCA1):c.2836_2837delAT (p.Ile946Glnfs) rs397509016
NM_007294.3(BRCA1):c.283_286delCTTG (p.Leu95Thrfs)
NM_007294.3(BRCA1):c.2840_2841delAA (p.Lys947Argfs) rs80357984
NM_007294.3(BRCA1):c.2843del (p.Gly948Glufs) rs886040076
NM_007294.3(BRCA1):c.2844_2853delAGGCTCTAGG (p.Gly949Phefs) rs397509017
NM_007294.3(BRCA1):c.2848dupT (p.Ser950Phefs) rs397509018
NM_007294.3(BRCA1):c.2850_2851insC (p.Arg951Glnfs) rs886040077
NM_007294.3(BRCA1):c.2850dup (p.Arg951Terfs) rs1555588846
NM_007294.3(BRCA1):c.2851_2852insC (p.Arg951Thrfs) rs1555588844
NM_007294.3(BRCA1):c.2856_2857delTT (p.Phe952Leufs) rs397509019
NM_007294.3(BRCA1):c.2861_2864del (p.Leu954Hisfs) rs886040078
NM_007294.3(BRCA1):c.2861dupT (p.Ser955Ilefs) rs886040079
NM_007294.3(BRCA1):c.2864C>A (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2864C>G (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2864_2865insT (p.Ser956Ilefs) rs397507205
NM_007294.3(BRCA1):c.2866_2870delTCTCA (p.Ser956Valfs) rs80357819
NM_007294.3(BRCA1):c.2866dup (p.Ser956Phefs) rs1555588822
NM_007294.3(BRCA1):c.2867del (p.Ser956Phefs) rs1555588818
NM_007294.3(BRCA1):c.2868delT (p.Gln957Serfs) rs80357929
NM_007294.3(BRCA1):c.2869C>T (p.Gln957Ter) rs80356973
NM_007294.3(BRCA1):c.2870dupA (p.Phe958Valfs) rs397509020
NM_007294.3(BRCA1):c.2871_2872insA (p.Phe958Ilefs) rs80357693
NM_007294.3(BRCA1):c.2872_2873insA (p.Phe958Tyrfs) rs1555588803
NM_007294.3(BRCA1):c.2872_2876delTTCAG (p.Phe958Argfs) rs397509021
NM_007294.3(BRCA1):c.2875A>T (p.Arg959Ter) rs1401324575
NM_007294.3(BRCA1):c.2875del (p.Arg959Glufs) rs886040080
NM_007294.3(BRCA1):c.2878_2879del (p.Gly960Glnfs) rs886040081
NM_007294.3(BRCA1):c.2882delA (p.Asn961Thrfs) rs886040082
NM_007294.3(BRCA1):c.2887delA (p.Thr963Leufs) rs80357559
NM_007294.3(BRCA1):c.2889_2890delTG (p.Gly964Thrfs) rs80357890
NM_007294.3(BRCA1):c.288_292delCACAGins7
NM_007294.3(BRCA1):c.288_292delCACAGinsAACCTGT (p.Asp96Glufs) rs483353091
NM_007294.3(BRCA1):c.2890G>T (p.Gly964Ter) rs879254027
NM_007294.3(BRCA1):c.2898delT (p.Thr967Leufs) rs886038005
NM_007294.3(BRCA1):c.2902_2903insTC (p.Pro968Leufs) rs398122670
NM_007294.3(BRCA1):c.2903_2904insTC (p.Asn969Glnfs) rs886040083
NM_007294.3(BRCA1):c.2903dup (p.Asn969Lysfs) rs1555588756
NM_007294.3(BRCA1):c.2904_2905insTC (p.Asn969Serfs) rs1555588752
NM_007294.3(BRCA1):c.2906_2908delATAinsCT (p.Asn969Thrfs) rs886040084
NM_007294.3(BRCA1):c.2906del (p.Asn969Ilefs) rs886040085
NM_007294.3(BRCA1):c.290_291delCA (p.Thr97Argfs) rs80357738
NM_007294.3(BRCA1):c.2910delA (p.Lys970Asnfs) rs80357893
NM_007294.3(BRCA1):c.2912_2913delAT (p.His971Argfs) rs878854940
NM_007294.3(BRCA1):c.2914G>T (p.Gly972Ter) rs397509023
NM_007294.3(BRCA1):c.2915delG (p.Gly972Aspfs) rs80357573
NM_007294.3(BRCA1):c.2917_2920del (p.Leu973Tyrfs) rs886040086
NM_007294.3(BRCA1):c.2920_2921delTT (p.Leu974Thrfs) rs80357611
NM_007294.3(BRCA1):c.2921T>A (p.Leu974Ter) rs80356872
NM_007294.3(BRCA1):c.2921dupT (p.Leu974Phefs) rs80357611
NM_007294.3(BRCA1):c.2923C>T (p.Gln975Ter) rs80357497
NM_007294.3(BRCA1):c.2927delA (p.Asn976Thrfs) rs886038006
NM_007294.3(BRCA1):c.2929_2930dupCC (p.Tyr978Hisfs) rs397509025
NM_007294.3(BRCA1):c.2933dupA (p.Tyr978Terfs) rs878853292
NM_007294.3(BRCA1):c.2934T>A (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934T>G (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934delT (p.Arg979Valfs) rs80357741
NM_007294.3(BRCA1):c.2938delA (p.Ile980Tyrfs) rs730881439
NM_007294.3(BRCA1):c.2940delA (p.Pro981Hisfs) rs80357876
NM_007294.3(BRCA1):c.2945delC (p.Pro982Hisfs) rs730881461
NM_007294.3(BRCA1):c.2947delC (p.Leu983Phefs) rs876659108
NM_007294.3(BRCA1):c.2951_2952del (p.Phe984Serfs) rs80357627
NM_007294.3(BRCA1):c.2952delT (p.Ile986Serfs) rs80357627
NM_007294.3(BRCA1):c.2952dupT (p.Pro985Serfs) rs80357627
NM_007294.3(BRCA1):c.2955delC (p.Ile986Serfs) rs397509027
NM_007294.3(BRCA1):c.2959A>T (p.Lys987Ter) rs878854941
NM_007294.3(BRCA1):c.2960_2964delAGTCA (p.Lys987Ilefs) rs1555588625
NM_007294.3(BRCA1):c.2960dup (p.Ser988Valfs) rs886040088
NM_007294.3(BRCA1):c.2963C>A (p.Ser988Ter) rs397507206
NM_007294.3(BRCA1):c.2967delT (p.Phe989Leufs) rs397509028
NM_007294.3(BRCA1):c.2970del (p.Thr992Leufs) rs886040089
NM_007294.3(BRCA1):c.2971A>T (p.Lys991Ter) rs886040090
NM_007294.3(BRCA1):c.2973_2979delAACTAAA (p.Lys991Asnfs) rs397509030
NM_007294.3(BRCA1):c.2973_2989del17 (p.Thr992Serfs) rs397509031
NM_007294.3(BRCA1):c.2980delT (p.Cys994Valfs) rs80357502
NM_007294.3(BRCA1):c.2981_2982delGT (p.Cys994Terfs) rs397507207
NM_007294.3(BRCA1):c.2981del (p.Cys994Leufs) rs886040091
NM_007294.3(BRCA1):c.2983A>T (p.Lys995Ter) rs879255315
NM_007294.3(BRCA1):c.2989_2990dupAA (p.Asn997Lysfs) rs80357829
NM_007294.3(BRCA1):c.2990delA (p.Asn997Ilefs) rs80357829
NM_007294.3(BRCA1):c.2995_2996delCTinsTA (p.Leu999Ter) rs273899692
NM_007294.3(BRCA1):c.2999delA (p.Glu1000Glyfs) rs80357991
NM_007294.3(BRCA1):c.2T>C (p.Met1Thr) rs80357111
NM_007294.3(BRCA1):c.2T>G (p.Met1Arg) rs80357111
NM_007294.3(BRCA1):c.3001G>T (p.Glu1001Ter) rs886038007
NM_007294.3(BRCA1):c.3005delA (p.Asn1002Thrfs) rs80357601
NM_007294.3(BRCA1):c.3006_3009del (p.Asn1002Lysfs) rs886040092
NM_007294.3(BRCA1):c.3008_3009delTT (p.Phe1003Terfs) rs80357617
NM_007294.3(BRCA1):c.301+1G>A rs587782173
NM_007294.3(BRCA1):c.301+1G>C rs587782173
NM_007294.3(BRCA1):c.301+2dupT rs273899694
NM_007294.3(BRCA1):c.3010G>T (p.Glu1004Ter) rs786202534
NM_007294.3(BRCA1):c.3013delG (p.Glu1005Asnfs) rs80357937
NM_007294.3(BRCA1):c.3015delA (p.Glu1005Aspfs) rs886038008
NM_007294.3(BRCA1):c.3016_3020delCATTC (p.His1006Asnfs) rs1135401855
NM_007294.3(BRCA1):c.3018_3021delTTCA (p.His1006Glnfs) rs80357749
NM_007294.3(BRCA1):c.302-1G>A rs80358116
NM_007294.3(BRCA1):c.302-1G>C rs80358116
NM_007294.3(BRCA1):c.302-1G>T rs80358116
NM_007294.3(BRCA1):c.302-2A>C rs80358011
NM_007294.3(BRCA1):c.302-2A>G rs80358011
NM_007294.3(BRCA1):c.302-2A>T rs80358011
NM_007294.3(BRCA1):c.302-2_302-1del rs483353093
NM_007294.3(BRCA1):c.302-2delA rs273899695
NM_007294.3(BRCA1):c.302-3C>G rs80358051
NM_007294.3(BRCA1):c.302-?_593+?del
NM_007294.3(BRCA1):c.3020C>G (p.Ser1007Ter) rs80357168
NM_007294.3(BRCA1):c.3020_3023del (p.Ser1007Cysfs) rs886040093
NM_007294.3(BRCA1):c.3024dup (p.Ser1009Valfs) rs886040094
NM_007294.3(BRCA1):c.3026C>A (p.Ser1009Ter) rs273899696
NM_007294.3(BRCA1):c.3029_3030delCT (p.Pro1010Argfs) rs80357510
NM_007294.3(BRCA1):c.3033_3034delAA (p.Glu1013Asnfs)
NM_007294.3(BRCA1):c.3037_3038delGA (p.Glu1013Asnfs) rs397507208
NM_007294.3(BRCA1):c.303T>A (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.303T>G (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.3044dupG (p.Asn1016Lysfs) rs80357746
NM_007294.3(BRCA1):c.3048_3052dupTGAGA (p.Asn1018Metfs) rs80357856
NM_007294.3(BRCA1):c.3049G>T (p.Glu1017Ter) rs80357004
NM_007294.3(BRCA1):c.3052_3053ins5
NM_007294.3(BRCA1):c.3053_3054insTGAGA (p.Ile1019Glufs) rs80357547
NM_007294.3(BRCA1):c.3054_3055insTGAGA (p.Ile1019Terfs) rs1555588469
NM_007294.3(BRCA1):c.3056_3059delTTCC (p.Ile1019Lysfs) rs1135401856
NM_007294.3(BRCA1):c.3059del (p.Pro1020Glnfs) rs1555588460
NM_007294.3(BRCA1):c.3062delG (p.Ser1021Ilefs) rs1135401857
NM_007294.3(BRCA1):c.3064_3065insA (p.Thr1022Asnfs) rs1135401858
NM_007294.3(BRCA1):c.3066delA (p.Val1023Terfs) rs786202906
NM_007294.3(BRCA1):c.3068del (p.Val1023Glyfs)
NM_007294.3(BRCA1):c.3075_3076ins76 (p.?)
NM_007294.3(BRCA1):c.3075_3076insGGAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGATCATTCCAAGTACAGTGAGCACA (p.Ile1026Glyfs) rs886040095
NM_007294.3(BRCA1):c.3076_3077ins76 (p.?)
NM_007294.3(BRCA1):c.3076_3077insGGAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGATCATTCCAAGTACAGTGAGCACA (p.Ile1026Argfs) rs1555588427
NM_007294.3(BRCA1):c.3083delG (p.Arg1028Leufs) rs1484076591
NM_007294.3(BRCA1):c.3084_3094delTAATAACATTA (p.Asn1029Argfs) rs80357647
NM_007294.3(BRCA1):c.3087_3100dup (p.Asn1034Ilefs) rs80357967
NM_007294.3(BRCA1):c.3091dupA (p.Ile1031Asnfs) rs1555588399
NM_007294.3(BRCA1):c.3097G>T (p.Glu1033Ter) rs273899698
NM_007294.3(BRCA1):c.3103_3104delGT (p.Val1035Phefs) rs1555588392
NM_007294.3(BRCA1):c.3106_3109delTTTA (p.Phe1036Lysfs) rs1555588385
NM_007294.3(BRCA1):c.3107_3112delTTAAAG (p.Phe1036_Cys1372delinsTer) rs80357920
NM_007294.3(BRCA1):c.3108delT (p.Phe1036Leufs) rs80357841
NM_007294.3(BRCA1):c.3108dupT (p.Lys1037Terfs) rs80357841
NM_007294.3(BRCA1):c.3109_3110insT (p.Lys1037Ilefs) rs886040096
NM_007294.3(BRCA1):c.310del (p.Ser104Alafs) rs886040097
NM_007294.3(BRCA1):c.310dupA (p.Ser104Lysfs) rs1555596484
NM_007294.3(BRCA1):c.3110_3111insT (p.Lys1037Asnfs) rs1555588381
NM_007294.3(BRCA1):c.3112G>T (p.Glu1038Ter) rs80357161
NM_007294.3(BRCA1):c.3114_3117delAGCCinsGA (p.Ala1039Lysfs) rs273899700
NM_007294.3(BRCA1):c.3115delG (p.Ala1039Profs) rs886040098
NM_007294.3(BRCA1):c.3117_3120del (p.Ser1040Glnfs) rs886040099
NM_007294.3(BRCA1):c.3117delC (p.Ser1040Alafs) rs1555588361
NM_007294.3(BRCA1):c.3122C>G (p.Ser1041Ter) rs397509035
NM_007294.3(BRCA1):c.3125_3134delGCAATATTAA (p.Ser1042Metfs) rs397509036
NM_007294.3(BRCA1):c.3129_3138delTATTAATGAA (p.Asn1043Lysfs) rs730881462
NM_007294.3(BRCA1):c.3132delT (p.Asn1045Metfs) rs879255316
NM_007294.3(BRCA1):c.3135_3138delTGAA (p.Asn1045Lysfs)
NM_007294.3(BRCA1):c.3138_3141delAGTA (p.Gly1048Profs) rs1064794177
NM_007294.3(BRCA1):c.3143delG (p.Gly1048Valfs) rs886040100
NM_007294.3(BRCA1):c.3145delT (p.Ser1049Profs) rs397509038
NM_007294.3(BRCA1):c.3150_3208dup59 (p.Ala1070Valfs) rs1555588199
NM_007294.3(BRCA1):c.3155delA (p.Asn1052Metfs) rs397509040
NM_007294.3(BRCA1):c.3157G>T (p.Glu1053Ter) rs786203587
NM_007294.3(BRCA1):c.3157delG (p.Glu1053Lysfs) rs397509041
NM_007294.3(BRCA1):c.3157dupG (p.Glu1053Glyfs) rs397509042
NM_007294.3(BRCA1):c.3158_3159insG (p.Val1054Serfs) rs80357769
NM_007294.3(BRCA1):c.3161_3164dup (p.Ser1056Glyfs)
NM_007294.3(BRCA1):c.3164_3165ins4
NM_007294.3(BRCA1):c.3164delG (p.Gly1055Alafs) rs397509043
NM_007294.3(BRCA1):c.3168delC (p.Ser1057Valfs) rs397509044
NM_007294.3(BRCA1):c.3169_3172delAGTA (p.Ser1057Leufs) rs397509045
NM_007294.3(BRCA1):c.3174delT (p.Asn1059Metfs) rs397507210
NM_007294.3(BRCA1):c.3178G>T (p.Glu1060Ter) rs80357424
NM_007294.3(BRCA1):c.317delA (p.Asn106Ilefs) rs80357950
NM_007294.3(BRCA1):c.3181delA (p.Ile1061Terfs) rs80357702
NM_007294.3(BRCA1):c.3182del (p.Ile1061Lysfs) rs886040101
NM_007294.3(BRCA1):c.3183delA (p.Ile1061Metfs) rs397509046
NM_007294.3(BRCA1):c.3188_3189delCCinsG (p.Ser1063Terfs) rs273899701
NM_007294.3(BRCA1):c.3193dupG (p.Asp1065Glyfs) rs80357511
NM_007294.3(BRCA1):c.3194_3195insG (p.Asp1065Glufs) rs80357883
NM_007294.3(BRCA1):c.3196G>T (p.Glu1066Ter) rs1555588220
NM_007294.3(BRCA1):c.3196dup (p.Glu1066Glyfs) rs1555588222
NM_007294.3(BRCA1):c.3203_3206del (p.Ile1068Lysfs) rs886040102
NM_007294.3(BRCA1):c.3204delT (p.Gln1069Lysfs) rs398122673
NM_007294.3(BRCA1):c.3205delC (p.Gln1069Lysfs) rs886040103
NM_007294.3(BRCA1):c.3210dup (p.Glu1071Argfs) rs886040104
NM_007294.3(BRCA1):c.3211_3212dup (p.Leu1072Asnfs) rs886040105
NM_007294.3(BRCA1):c.3211dupG (p.Glu1071Glyfs) rs397509047
NM_007294.3(BRCA1):c.3214delC (p.Leu1072Terfs) rs80357923
NM_007294.3(BRCA1):c.3217_3218del (p.Gly1073Terfs) rs886040106
NM_007294.3(BRCA1):c.321delT (p.Phe107Leufs) rs80357544
NM_007294.3(BRCA1):c.3226A>T (p.Arg1076Ter) rs886038009
NM_007294.3(BRCA1):c.3226delA (p.Arg1076Glufs) rs273899703
NM_007294.3(BRCA1):c.3228_3229delAG (p.Gly1077Alafs) rs80357635
NM_007294.3(BRCA1):c.3239T>A (p.Leu1080Ter) rs80357145
NM_007294.3(BRCA1):c.3243_3288dup (p.Ser1097Cysfs) rs1555588016
NM_007294.3(BRCA1):c.3247_3251delATGCT (p.Met1083Terfs) rs1135401859
NM_007294.3(BRCA1):c.3253A>T (p.Arg1085Ter) rs1432504119
NM_007294.3(BRCA1):c.3253dupA (p.Arg1085Lysfs) rs80357517
NM_007294.3(BRCA1):c.3254_3255dupGA (p.Leu1086Aspfs) rs80357624
NM_007294.3(BRCA1):c.3254_3255insGA (p.Leu1086Asnfs) rs80357625
NM_007294.3(BRCA1):c.3255dupA (p.Leu1086Ilefs) rs1555588090
NM_007294.3(BRCA1):c.3256_3257insGA (p.Leu1086Terfs) rs80357764
NM_007294.3(BRCA1):c.3257T>A (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3257T>G (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3257_3258insGA (p.Gly1087Lysfs) rs1555588074
NM_007294.3(BRCA1):c.3257delT (p.Leu1086Terfs) rs80357858
NM_007294.3(BRCA1):c.3257dupT (p.Leu1086Phefs) rs80357858
NM_007294.3(BRCA1):c.3258del (p.Val1088Phefs) rs886040107
NM_007294.3(BRCA1):c.3262_3277del (p.Val1088Serfs) rs886040108
NM_007294.3(BRCA1):c.3262delG (p.Val1088Phefs) rs397509049
NM_007294.3(BRCA1):c.3266T>A (p.Leu1089Ter) rs886040110
NM_007294.3(BRCA1):c.3266del (p.Leu1089Cysfs) rs886040109
NM_007294.3(BRCA1):c.3268C>T (p.Gln1090Ter) rs80357402
NM_007294.3(BRCA1):c.3279_3280delCT (p.Tyr1094Terfs) rs886038010
NM_007294.3(BRCA1):c.3279delC (p.Tyr1094Ilefs) rs397509050
NM_007294.3(BRCA1):c.3282T>G (p.Tyr1094Ter) rs886040111
NM_007294.3(BRCA1):c.3285delA (p.Lys1095Asnfs) rs397509051
NM_007294.3(BRCA1):c.3286C>T (p.Gln1096Ter) rs80357485
NM_007294.3(BRCA1):c.3286delC (p.Gln1096Lysfs) rs80357533
NM_007294.3(BRCA1):c.3288_3289delAA (p.Leu1098Serfs) rs80357686
NM_007294.3(BRCA1):c.3288_3289ins46 (p.?)
NM_007294.3(BRCA1):c.3289delA (p.Ser1097Valfs) rs80357686
NM_007294.3(BRCA1):c.3289dupA (p.Ser1097Lysfs) rs80357686
NM_007294.3(BRCA1):c.3292_3293delCT (p.Leu1098Serfs) rs80357992
NM_007294.3(BRCA1):c.3294delT (p.Pro1099Leufs) rs876658626
NM_007294.3(BRCA1):c.3296delC (p.Pro1099Leufs) rs80357815
NM_007294.3(BRCA1):c.329_330delAG (p.Lys110Argfs) rs80357754
NM_007294.3(BRCA1):c.329delA (p.Lys110Argfs) rs80357604
NM_007294.3(BRCA1):c.329dupA (p.Glu111Glyfs) rs80357604
NM_007294.3(BRCA1):c.32_33insC (p.Gln12Thrfs) rs80357811
NM_007294.3(BRCA1):c.3302_3305delGTAA (p.Ser1101Ilefs) rs1555587992
NM_007294.3(BRCA1):c.3307_3308insC (p.Cys1103Serfs) rs1555587988
NM_007294.3(BRCA1):c.3308_3309insC (p.Lys1104Terfs) rs886040113
NM_007294.3(BRCA1):c.3309T>A (p.Cys1103Ter) rs80357317
NM_007294.3(BRCA1):c.3309_3310insC (p.Lys1104Glnfs) rs1555587980
NM_007294.3(BRCA1):c.330_331insA (p.Glu111Argfs) rs886040112
NM_007294.3(BRCA1):c.3314delA (p.His1105Leufs) rs397509054
NM_007294.3(BRCA1):c.3317delC (p.Pro1106Leufs) rs1555587972
NM_007294.3(BRCA1):c.3319G>T (p.Glu1107Ter) rs80357106
NM_007294.3(BRCA1):c.331del (p.Glu111Lysfs) rs886040114
NM_007294.3(BRCA1):c.3323_3324delTA (p.Ile1108Lysfs) rs786202791
NM_007294.3(BRCA1):c.3323_3326delTAAA (p.Ile1108Lysfs) rs80357763
NM_007294.3(BRCA1):c.3325_3329delAAAAA (p.Lys1109Alafs) rs80357575
NM_007294.3(BRCA1):c.3326_3329delAAAA (p.Lys1109Serfs) rs80357575
NM_007294.3(BRCA1):c.3329_3330delAG (p.Lys1110Thrfs) rs80357525
NM_007294.3(BRCA1):c.3329delA (p.Lys1110Serfs) rs80357575
NM_007294.3(BRCA1):c.3329dupA (p.Gln1111Alafs) rs80357575
NM_007294.3(BRCA1):c.3330_3331insA (p.Gln1111Thrfs) rs80357996
NM_007294.3(BRCA1):c.3330delG (p.Lys1110Asnfs) rs886038011
NM_007294.3(BRCA1):c.3331C>T (p.Gln1111Ter) rs80357089
NM_007294.3(BRCA1):c.3331_3334delCAAG (p.Gln1111Asnfs) rs80357701
NM_007294.3(BRCA1):c.3331_3335del (p.Gln1111Ilefs) rs886040115
NM_007294.3(BRCA1):c.3331del (p.Gln1111Lysfs) rs886040116
NM_007294.3(BRCA1):c.3333_3336delAGAA (p.Gln1111Hisfs) rs397509057
NM_007294.3(BRCA1):c.3333delA (p.Glu1112Asnfs) rs80357966
NM_007294.3(BRCA1):c.3333dup (p.Glu1112Argfs) rs80357966
NM_007294.3(BRCA1):c.3334delG (p.Glu1112Asnfs) rs1555587944
NM_007294.3(BRCA1):c.3339T>G (p.Tyr1113Ter) rs80357421
NM_007294.3(BRCA1):c.3339_3341del (p.Tyr1113_Ser1448delinsTer) rs886040117
NM_007294.3(BRCA1):c.3340G>T (p.Glu1114Ter) rs80357278
NM_007294.3(BRCA1):c.3342_3345delAGAA (p.Glu1115Terfs) rs397509058
NM_007294.3(BRCA1):c.3343delG (p.Glu1115Lysfs) rs273899705
NM_007294.3(BRCA1):c.3351dupT (p.Gln1118Serfs) rs80357785
NM_007294.3(BRCA1):c.3352C>T (p.Gln1118Ter) rs397507215
NM_007294.3(BRCA1):c.3354_3355delGA (p.Gln1118Hisfs) rs397509059
NM_007294.3(BRCA1):c.3357delT (p.Val1120Leufs) rs80357827
NM_007294.3(BRCA1):c.3358_3359delGT (p.Val1120Terfs) rs80357945
NM_007294.3(BRCA1):c.3358_3368del (p.Val1120Phefs) rs886040118
NM_007294.3(BRCA1):c.3359_3360delTT (p.Val1120Glufs) rs80357843
NM_007294.3(BRCA1):c.3359_3363delTTAAT (p.Val1120Aspfs) rs397509060
NM_007294.3(BRCA1):c.335_338delATAA (p.Asn112Thrfs) rs587782666
NM_007294.3(BRCA1):c.335del (p.Asn112Ilefs) rs886040119
NM_007294.3(BRCA1):c.335dup (p.Asn112Lysfs) rs886040119
NM_007294.3(BRCA1):c.3360dup (p.Asn1121Terfs) rs886040120
NM_007294.3(BRCA1):c.3362delA (p.Asn1121Ilefs) rs80357865
NM_007294.3(BRCA1):c.3365_3366delCA (p.Thr1122Argfs) rs80357892
NM_007294.3(BRCA1):c.3373dup (p.Ser1125Phefs) rs886040121
NM_007294.3(BRCA1):c.3375_3376delTC (p.Pro1126Ilefs) rs80357828
NM_007294.3(BRCA1):c.3377delC (p.Pro1126Hisfs) rs397509061
NM_007294.3(BRCA1):c.3381T>G (p.Tyr1127Ter) rs781319410
NM_007294.3(BRCA1):c.3384_3391del (p.Ile1129Terfs) rs886040122
NM_007294.3(BRCA1):c.3388_3408del21ins16 (p.?)
NM_007294.3(BRCA1):c.3388delT (p.Ser1130Glnfs) rs886040123
NM_007294.3(BRCA1):c.3389C>G (p.Ser1130Ter) rs80357405
NM_007294.3(BRCA1):c.3390delA (p.Asp1131Ilefs) rs80357900
NM_007294.3(BRCA1):c.3395del (p.Asn1132Thrfs) rs886040124
NM_007294.3(BRCA1):c.3396del (p.Leu1133Terfs) rs886040125
NM_007294.3(BRCA1):c.3397_3398delTT (p.Leu1133Argfs) rs80357577
NM_007294.3(BRCA1):c.3398T>A (p.Leu1133Ter) rs80356971
NM_007294.3(BRCA1):c.3398T>G (p.Leu1133Ter) rs80356971
NM_007294.3(BRCA1):c.3400G>T (p.Glu1134Ter) rs80357018
NM_007294.3(BRCA1):c.3401_3405delAACAG (p.Glu1134Alafs) rs1555587781
NM_007294.3(BRCA1):c.3403C>T (p.Gln1135Ter) rs80357136
NM_007294.3(BRCA1):c.3412G>T (p.Gly1138Ter) rs886040126
NM_007294.3(BRCA1):c.3413delG (p.Gly1138Glufs) rs397509063
NM_007294.3(BRCA1):c.3413dup (p.Ser1139Lysfs) rs397509063
NM_007294.3(BRCA1):c.3414_3415insG (p.Ser1139Glufs) rs1135401860
NM_007294.3(BRCA1):c.3416_3427delGTAGTCATGCATinsC (p.Ser1139Thrfs) rs886040128
NM_007294.3(BRCA1):c.3416delG (p.Ser1139Ilefs) rs397509064
NM_007294.3(BRCA1):c.3416dup (p.Ser1139Argfs) rs1555587739
NM_007294.3(BRCA1):c.3417delT (p.Ser1139Argfs) rs273899706
NM_007294.3(BRCA1):c.3420dupT (p.His1141Serfs) rs397509065
NM_007294.3(BRCA1):c.3424delG (p.Ala1142Hisfs) rs1555587718
NM_007294.3(BRCA1):c.3428delCinsTA (p.Ser1143Leufs) rs397509066
NM_007294.3(BRCA1):c.342_343delTC (p.Pro115Terfs) rs80357881
NM_007294.3(BRCA1):c.342delT (p.Pro115Leufs) rs886040129
NM_007294.3(BRCA1):c.3430C>T (p.Gln1144Ter) rs80357369
NM_007294.3(BRCA1):c.3436_3439delTGTT (p.Cys1146Leufs) rs397509067
NM_007294.3(BRCA1):c.343_344delCC (p.Pro115Terfs)
NM_007294.3(BRCA1):c.3442G>T (p.Glu1148Ter) rs886038012
NM_007294.3(BRCA1):c.3442delG (p.Glu1148Argfs) rs80357808
NM_007294.3(BRCA1):c.3450delT (p.Asp1151Metfs) rs397509068
NM_007294.3(BRCA1):c.3450dupT (p.Asp1151Terfs) rs397509069
NM_007294.3(BRCA1):c.3458_3462delTGTTA (p.Leu1153Argfs) rs886038014
NM_007294.3(BRCA1):c.3459_3460delGT (p.Leu1154Argfs) rs886038013
NM_007294.3(BRCA1):c.3461T>G (p.Leu1154Ter) rs886040130
NM_007294.3(BRCA1):c.3462dupA (p.Asp1155Argfs) rs80357857
NM_007294.3(BRCA1):c.3468delT (p.Asp1156Glufs) rs397509070
NM_007294.3(BRCA1):c.346G>T (p.Glu116Ter)
NM_007294.3(BRCA1):c.346delG (p.Glu116Asnfs) rs762635795
NM_007294.3(BRCA1):c.3472G>T (p.Glu1158Ter) rs397509072
NM_007294.3(BRCA1):c.3477_3479delAAAinsC (p.Lys1160Glyfs) rs273899707
NM_007294.3(BRCA1):c.3477_3480delAAAG (p.Ile1159Metfs) rs80357781
NM_007294.3(BRCA1):c.3478_3479del (p.Lys1160Glyfs) rs273899707
NM_007294.3(BRCA1):c.3478_3487delAAGGAAGATA (p.Lys1160Leufs) rs786203694
NM_007294.3(BRCA1):c.3479_3483del (p.Lys1160Argfs) rs886040132
NM_007294.3(BRCA1):c.3479_3488delAGGAAGATAC (p.Lys1160Ilefs) rs397509073
NM_007294.3(BRCA1):c.3479delA (p.Lys1160Argfs) rs273899707
NM_007294.3(BRCA1):c.3481G>T (p.Glu1161Ter) rs786203438
NM_007294.3(BRCA1):c.3481_3491delGAAGATACTAG (p.Glu1161Phefs) rs80357877
NM_007294.3(BRCA1):c.3481_3493delGAAGATACTAGTT (p.Glu1161Leufs) rs1555587588
NM_007294.3(BRCA1):c.3481delG (p.Glu1161Lysfs) rs397509074
NM_007294.3(BRCA1):c.3482_3492del (p.Glu1161Valfs) rs886040133
NM_007294.3(BRCA1):c.3485_3488del (p.Asp1162Valfs) rs886040134
NM_007294.3(BRCA1):c.3485_3491del (p.Asp1162Valfs) rs886040135
NM_007294.3(BRCA1):c.3485delA (p.Asp1162Valfs) rs80357509
NM_007294.3(BRCA1):c.3489_3499del (p.Ser1164Lysfs) rs886040136
NM_007294.3(BRCA1):c.3494_3495delTT (p.Phe1165Cysfs) rs397509076
NM_007294.3(BRCA1):c.3496delG (p.Ala1166Leufs) rs886038015
NM_007294.3(BRCA1):c.3498del (p.Glu1167Lysfs) rs886040137
NM_007294.3(BRCA1):c.34C>T (p.Gln12Ter) rs80357134
NM_007294.3(BRCA1):c.34dup (p.Gln12Profs) rs1555601009
NM_007294.3(BRCA1):c.3503delA (p.Asn1168Metfs) rs397507216
NM_007294.3(BRCA1):c.3503dupA (p.Asn1168Lysfs) rs397507216
NM_007294.3(BRCA1):c.3504_3505insA (p.Asp1169Argfs) rs886040138
NM_007294.3(BRCA1):c.3505_3509delGACAT (p.Asp1169Terfs) rs397509078
NM_007294.3(BRCA1):c.3506dup (p.Asp1169Glufs) rs1555587573
NM_007294.3(BRCA1):c.3511A>T (p.Lys1171Ter) rs730882164
NM_007294.3(BRCA1):c.3512delA (p.Lys1171Argfs) rs886040139
NM_007294.3(BRCA1):c.3514G>T (p.Glu1172Ter) rs397509079
NM_007294.3(BRCA1):c.3516_3517ins100 (p.?)
NM_007294.3(BRCA1):c.3526delG (p.Val1176Phefs) rs1064794016
NM_007294.3(BRCA1):c.3531delT (p.Phe1177Leufs) rs80357621
NM_007294.3(BRCA1):c.3531dupT (p.Ser1178Terfs) rs80357621
NM_007294.3(BRCA1):c.3534del (p.Ser1178Argfs) rs886040140
NM_007294.3(BRCA1):c.3535A>T (p.Lys1179Ter) rs587782188
NM_007294.3(BRCA1):c.3540_3541delCG (p.Val1181Profs) rs397509080
NM_007294.3(BRCA1):c.3541_3542del (p.Val1181Profs) rs886040141
NM_007294.3(BRCA1):c.3541delG (p.Val1181Serfs) rs886038016
NM_007294.3(BRCA1):c.3543_3544insGA (p.Gln1182Aspfs) rs1555587537
NM_007294.3(BRCA1):c.3544C>T (p.Gln1182Ter) rs80357296
NM_007294.3(BRCA1):c.3547_3550delAAAGinsGAT (p.Lys1183Aspfs) rs886038017
NM_007294.3(BRCA1):c.3548_3549delAA (p.Lys1183Argfs) rs80357956
NM_007294.3(BRCA1):c.3549_3550delAG (p.Gly1184Argfs) rs730882057
NM_007294.3(BRCA1):c.3549_3550delAGinsT (p.Lys1183Asnfs) rs273899709
NM_007294.3(BRCA1):c.3553G>T (p.Glu1185Ter) rs397509081
NM_007294.3(BRCA1):c.355A>T (p.Lys119Ter) rs886040142
NM_007294.3(BRCA1):c.3564dup (p.Ser1189Glufs) rs886040143
NM_007294.3(BRCA1):c.3569_3570delCT (p.Pro1190Glnfs) rs80357845
NM_007294.3(BRCA1):c.3569delC (p.Pro1190Leufs) rs1555587497
NM_007294.3(BRCA1):c.3570delT (p.Ser1191Alafs) rs886038018
NM_007294.3(BRCA1):c.3571_3572ins4
NM_007294.3(BRCA1):c.3571delA (p.Ser1191Alafs) rs886040145
NM_007294.3(BRCA1):c.3576_3577insAA (p.Phe1193Asnfs) rs1555587476
NM_007294.3(BRCA1):c.3578dupT (p.Thr1194Hisfs) rs397509083
NM_007294.3(BRCA1):c.3579_3580insT (p.Thr1194Tyrfs) rs587782824
NM_007294.3(BRCA1):c.357_358delAGinsT (p.Lys119Asnfs) rs886040144
NM_007294.3(BRCA1):c.3580_3581insT (p.Thr1194Ilefs) rs1555587464
NM_007294.3(BRCA1):c.3580delA (p.Thr1194Profs) rs80357663
NM_007294.3(BRCA1):c.3582_3589delCCATACAC (p.His1195Phefs) rs886040146
NM_007294.3(BRCA1):c.3583_3590del (p.His1195Phefs) rs886040147
NM_007294.3(BRCA1):c.3583delC (p.His1195Ilefs) rs273900710
NM_007294.3(BRCA1):c.3586dupA (p.Thr1196Asnfs) rs80357531
NM_007294.3(BRCA1):c.3587dup (p.His1197Thrfs) rs886040148
NM_007294.3(BRCA1):c.3590delA (p.His1197Leufs) rs1555587442
NM_007294.3(BRCA1):c.3592_3593dupTT (p.Leu1198Phefs) rs80357562
NM_007294.3(BRCA1):c.3593T>A (p.Leu1198Ter) rs397509085
NM_007294.3(BRCA1):c.3596_3602delCTCAGGG (p.Ala1199Valfs) rs397509086
NM_007294.3(BRCA1):c.3598C>T (p.Gln1200Ter) rs62625307
NM_007294.3(BRCA1):c.3599_3600delAG (p.Gln1200Argfs) rs398122674
NM_007294.3(BRCA1):c.3604del (p.Tyr1202Thrfs) rs886040150
NM_007294.3(BRCA1):c.3605dup (p.Tyr1202Terfs) rs886040151
NM_007294.3(BRCA1):c.3607C>T (p.Arg1203Ter) rs62625308
NM_007294.3(BRCA1):c.3612delA (p.Ala1206Profs) rs80357980
NM_007294.3(BRCA1):c.3616delG (p.Ala1206Profs) rs886038019
NM_007294.3(BRCA1):c.3619A>T (p.Lys1207Ter) rs80357455
NM_007294.3(BRCA1):c.361dupG (p.Glu121Glyfs) rs886040152
NM_007294.3(BRCA1):c.3620dupA (p.Lys1208Glufs) rs80357926
NM_007294.3(BRCA1):c.3621_3626delGAAATTinsAA (p.Leu1209Serfs) rs397509087
NM_007294.3(BRCA1):c.3621del (p.Lys1208Asnfs) rs1555587401
NM_007294.3(BRCA1):c.3624delA (p.Lys1208Asnfs) rs80357512
NM_007294.3(BRCA1):c.3624dupA (p.Leu1209Ilefs) rs80357512
NM_007294.3(BRCA1):c.3625_3626insA (p.Leu1209Tyrfs) rs886040153
NM_007294.3(BRCA1):c.3626T>G (p.Leu1209Ter) rs786203884
NM_007294.3(BRCA1):c.3626delT (p.Leu1209Terfs) rs80357571
NM_007294.3(BRCA1):c.3626dupT (p.Leu1209Phefs) rs80357571
NM_007294.3(BRCA1):c.3627dupA (p.Glu1210Argfs) rs80357729
NM_007294.3(BRCA1):c.3628delG (p.Glu1210Serfs) rs397509090
NM_007294.3(BRCA1):c.3629_3630delAG (p.Glu1210Valfs) rs80357589
NM_007294.3(BRCA1):c.3629dupA (p.Ser1211Valfs) rs886040154
NM_007294.3(BRCA1):c.3631_3634del (p.Ser1211Glnfs) rs886040156
NM_007294.3(BRCA1):c.3635C>G (p.Ser1212Ter) rs886038021
NM_007294.3(BRCA1):c.3637G>T (p.Glu1213Ter) rs1135401864
NM_007294.3(BRCA1):c.3637delG (p.Glu1213Lysfs) rs1555587365
NM_007294.3(BRCA1):c.363_364del (p.Glu121Aspfs) rs886040155
NM_007294.3(BRCA1):c.3640G>T (p.Glu1214Ter) rs80356923
NM_007294.3(BRCA1):c.3640_3644delGAGAA (p.Glu1214Leufs) rs1555587356
NM_007294.3(BRCA1):c.3641delA (p.Glu1214Glyfs)
NM_007294.3(BRCA1):c.3642_3643delGA (p.Asn1215Leufs) rs80357805
NM_007294.3(BRCA1):c.3644_3648delACTTA (p.Asn1215Ilefs) rs1060505051
NM_007294.3(BRCA1):c.3647T>A (p.Leu1216Ter) rs397509091
NM_007294.3(BRCA1):c.3647T>G (p.Leu1216Ter) rs397509091
NM_007294.3(BRCA1):c.3648_3652delATCTA (p.Ser1217Terfs) rs1555587333
NM_007294.3(BRCA1):c.3648dupA (p.Ser1217Ilefs) rs80357902
NM_007294.3(BRCA1):c.3649_3650insA (p.Ser1217Tyrfs) rs80357831
NM_007294.3(BRCA1):c.3649dupT (p.Ser1217Phefs) rs1555587345
NM_007294.3(BRCA1):c.3650_3651insA (p.Ser1218Terfs) rs1555587337
NM_007294.3(BRCA1):c.3651dup (p.Ser1218Terfs) rs886040157
NM_007294.3(BRCA1):c.3658delG (p.Asp1220Metfs) rs786202963
NM_007294.3(BRCA1):c.3661G>T (p.Glu1221Ter) rs80357310
NM_007294.3(BRCA1):c.3664G>T (p.Glu1222Ter) rs80357356
NM_007294.3(BRCA1):c.3665_3666delAG (p.Glu1222Alafs) rs1555587316
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.3669del (p.Cys1225Alafs) rs886040158
NM_007294.3(BRCA1):c.3671_3672ins4
NM_007294.3(BRCA1):c.3672delC (p.Cys1225Alafs) rs398122677
NM_007294.3(BRCA1):c.3675C>A (p.Cys1225Ter) rs879254023
NM_007294.3(BRCA1):c.3676_3679delTTCC (p.Phe1226Asnfs) rs80357671
NM_007294.3(BRCA1):c.3679C>T (p.Gln1227Ter) rs886040159
NM_007294.3(BRCA1):c.3683delA (p.His1228Profs) rs397507217
NM_007294.3(BRCA1):c.3689T>G (p.Leu1230Ter) rs80357162
NM_007294.3(BRCA1):c.368delC (p.Ser123Leufs) rs431825397
NM_007294.3(BRCA1):c.3693dupT (p.Gly1232Trpfs) rs397509092
NM_007294.3(BRCA1):c.3695_3698delGTAA (p.Gly1232Glufs) rs397509093
NM_007294.3(BRCA1):c.3695delG (p.Gly1232Valfs) rs886038022
NM_007294.3(BRCA1):c.3697A>T (p.Lys1233Ter) rs774679104
NM_007294.3(BRCA1):c.3699delA (p.Val1234Terfs) rs80357873
NM_007294.3(BRCA1):c.36_39del (p.Asn13Serfs) rs886040149
NM_007294.3(BRCA1):c.3700_3704delGTAAA (p.Val1234Glnfs) rs80357609
NM_007294.3(BRCA1):c.3704_3707delACAA (p.Asn1235Ilefs) rs397509094
NM_007294.3(BRCA1):c.3704delA (p.Asn1235Thrfs) rs397509095
NM_007294.3(BRCA1):c.3705_3747dup (p.Glu1250Glnfs) rs797044631
NM_007294.3(BRCA1):c.3706_3707delAA (p.Asn1236Tyrfs) rs80357666
NM_007294.3(BRCA1):c.3706_3713delAATATACC (p.Asn1236Phefs) rs80357552
NM_007294.3(BRCA1):c.3710_3711dupTA (p.Pro1238Tyrfs) rs777371832
NM_007294.3(BRCA1):c.3710_3714delTACCT (p.Pro1238Serfs) rs1135401865
NM_007294.3(BRCA1):c.3710delT (p.Ile1237Asnfs) rs80357564
NM_007294.3(BRCA1):c.3714_3747delTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC (p.Gln1240Valfs) rs886038023
NM_007294.3(BRCA1):c.3715_3717delTCTinsC (p.Ser1239Profs) rs273900714
NM_007294.3(BRCA1):c.3715delT (p.Ser1239Leufs) rs397509096
NM_007294.3(BRCA1):c.3716dupC (p.Gln1240Serfs) rs397509097
NM_007294.3(BRCA1):c.3718C>T (p.Gln1240Ter) rs80356903
NM_007294.3(BRCA1):c.3722_3740del19 (p.Ser1241Leufs) rs80359882
NM_007294.3(BRCA1):c.3726dup (p.Arg1243Terfs)
NM_007294.3(BRCA1):c.3729_3730insGACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGG (p.His1244Aspfs) rs886040895
NM_007294.3(BRCA1):c.372del (p.Ile125Serfs) rs886040160
NM_007294.3(BRCA1):c.3730_3731insGACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGG (p.His1244Argfs) rs1555587210
NM_007294.3(BRCA1):c.3731_3738del (p.His1244Argfs) rs886040161
NM_007294.3(BRCA1):c.3731_3743del (p.His1244Leufs) rs886040162
NM_007294.3(BRCA1):c.3736delA (p.Thr1246Profs) rs80357578
NM_007294.3(BRCA1):c.3747_3748insC (p.Glu1250Argfs) rs1555587185
NM_007294.3(BRCA1):c.3748G>T (p.Glu1250Ter) rs28897686
NM_007294.3(BRCA1):c.3748_3749insC (p.Glu1250Alafs) rs1555587165
NM_007294.3(BRCA1):c.3749_3767del (p.Cys1251Argfs)
NM_007294.3(BRCA1):c.374dup (p.Gln126Profs) rs1555596392
NM_007294.3(BRCA1):c.3750del (p.Glu1250Aspfs) rs886040163
NM_007294.3(BRCA1):c.3753T>A (p.Cys1251Ter) rs397509098
NM_007294.3(BRCA1):c.3754_3755delCT (p.Leu1252Valfs) rs1135401866
NM_007294.3(BRCA1):c.3756_3757delGT (p.Ser1253Terfs) rs397509099
NM_007294.3(BRCA1):c.3756_3759delGTCT (p.Ser1253Argfs) rs80357868
NM_007294.3(BRCA1):c.3756_3760del (p.Ser1253Glufs) rs886040164
NM_007294.3(BRCA1):c.3758_3759delCT (p.Ser1253Terfs) rs1555587135
NM_007294.3(BRCA1):c.3759_3760delTA (p.Lys1254Glufs) rs80357520
NM_007294.3(BRCA1):c.3759delT (p.Lys1254Argfs) rs431825398
NM_007294.3(BRCA1):c.3759dupT (p.Lys1254Terfs) rs80357687
NM_007294.3(BRCA1):c.375_376insT (p.Gln126Serfs) rs397509101
NM_007294.3(BRCA1):c.3760_3761insT (p.Lys1254Ilefs) rs80357986
NM_007294.3(BRCA1):c.3761_3762insT (p.Lys1254Asnfs) rs80357928
NM_007294.3(BRCA1):c.3761_3762insTT (p.Lys1254Asnfs) rs80357928
NM_007294.3(BRCA1):c.3762_3763delGA (p.Asn1255Hisfs) rs80357645
NM_007294.3(BRCA1):c.3762_3763insTT (p.Asn1255Leufs) rs1555587113
NM_007294.3(BRCA1):c.3763_3764delAA (p.Asn1255Hisfs) rs397509103
NM_007294.3(BRCA1):c.3764dupA (p.Asn1255Lysfs) rs80357848
NM_007294.3(BRCA1):c.3765del (p.Asn1255Lysfs) rs886040165
NM_007294.3(BRCA1):c.3766dupA (p.Thr1256Asnfs) rs80357704
NM_007294.3(BRCA1):c.3767_3768delCA (p.Thr1256Argfs) rs730881440
NM_007294.3(BRCA1):c.376C>T (p.Gln126Ter) rs1085307902
NM_007294.3(BRCA1):c.376_377insT (p.Gln126Leufs) rs1555596382
NM_007294.3(BRCA1):c.3770_3771delAG (p.Glu1257Glyfs) rs80357579
NM_007294.3(BRCA1):c.3770_3777delAGGAGAAT (p.Glu1257Valfs) rs886038024
NM_007294.3(BRCA1):c.3771_3772delGG (p.Asn1259Phefs) rs80357810
NM_007294.3(BRCA1):c.3771_3772delGGinsC (p.Glu1257Aspfs) rs397507218
NM_007294.3(BRCA1):c.3771_3778delGGAGAATT (p.Glu1257Aspfs) rs397509104
NM_007294.3(BRCA1):c.3772G>T (p.Glu1258Ter) rs397509105
NM_007294.3(BRCA1):c.3772_3776delGAGAA (p.Glu1258Phefs) rs1135401867
NM_007294.3(BRCA1):c.3774_3775delGA (p.Asn1259Phefs) rs397509106
NM_007294.3(BRCA1):c.3778_3779insA (p.Leu1260Tyrfs) rs80357849
NM_007294.3(BRCA1):c.3779T>G (p.Leu1260Ter) rs886038025
NM_007294.3(BRCA1):c.3779delT (p.Leu1260Tyrfs) rs80357798
NM_007294.3(BRCA1):c.3780dup (p.Leu1261Ilefs) rs1555587063
NM_007294.3(BRCA1):c.3782T>G (p.Leu1261Ter) rs397507219
NM_007294.3(BRCA1):c.3782delT (p.Leu1261Tyrfs) rs80357545
NM_007294.3(BRCA1):c.3785C>A (p.Ser1262Ter) rs80357269
NM_007294.3(BRCA1):c.3794delA (p.Asn1265Ilefs) rs80357767
NM_007294.3(BRCA1):c.37_40delAATG (p.Asn13Serfs) rs80357530
NM_007294.3(BRCA1):c.3800T>G (p.Leu1267Ter) rs587782190
NM_007294.3(BRCA1):c.3810C>A (p.Cys1270Ter) rs886040166
NM_007294.3(BRCA1):c.3813dupT (p.Asn1272Terfs) rs397509108
NM_007294.3(BRCA1):c.3814_3815insT (p.Asn1272Ilefs) rs397509109
NM_007294.3(BRCA1):c.3815_3816insT (p.Gln1273Profs) rs1555587013
NM_007294.3(BRCA1):c.3817C>T (p.Gln1273Ter) rs80357208
NM_007294.3(BRCA1):c.3819_3823delGGTAA (p.Gln1273Hisfs) rs886037785
NM_007294.3(BRCA1):c.3820delG (p.Val1274Terfs) rs80357616
NM_007294.3(BRCA1):c.3820dupG (p.Val1274Glyfs) rs80357616
NM_007294.3(BRCA1):c.3821dup (p.Ile1275Asnfs) rs886040167
NM_007294.3(BRCA1):c.3824dup (p.Leu1276Ilefs) rs1555586989
NM_007294.3(BRCA1):c.3825delA (p.Leu1276Trpfs) rs1555586983
NM_007294.3(BRCA1):c.3825dupA (p.Leu1276Ilefs) rs397507220
NM_007294.3(BRCA1):c.3830dupC (p.Ala1279Glyfs) rs80357878
NM_007294.3(BRCA1):c.3833delA (p.Lys1278Argfs) rs1135401868
NM_007294.3(BRCA1):c.3835delG (p.Ala1279Hisfs) rs1060505047
NM_007294.3(BRCA1):c.3837_3840del (p.Ser1280Argfs) rs886040168
NM_007294.3(BRCA1):c.3839_3843del (p.Ser1280Terfs) rs886040169
NM_007294.3(BRCA1):c.3839_3843delCTCAGins4
NM_007294.3(BRCA1):c.3839_3843delCTCAGinsAGGC (p.Ser1280Terfs) rs273900717
NM_007294.3(BRCA1):c.3840_3850del (p.Gln1281Profs) rs886040170
NM_007294.3(BRCA1):c.3841C>T (p.Gln1281Ter) rs80356866
NM_007294.3(BRCA1):c.3841_3842delCA (p.Gln1281Glyfs) rs80357584
NM_007294.3(BRCA1):c.3844delG (p.Glu1282Asnfs) rs397509113
NM_007294.3(BRCA1):c.3851_3852dupAC (p.Leu1285Thrfs) rs397507221
NM_007294.3(BRCA1):c.3853delC (p.Ser1286Valfs) rs397507222
NM_007294.3(BRCA1):c.3856delA (p.Ser1286Valfs) rs80357855
NM_007294.3(BRCA1):c.3858_3861delTGAG (p.Ser1286Argfs) rs80357842
NM_007294.3(BRCA1):c.385_386delGGinsC (p.Gly129Profs) rs886040171
NM_007294.3(BRCA1):c.3862G>T (p.Glu1288Ter) rs876659708
NM_007294.3(BRCA1):c.3862delG (p.Glu1288Lysfs) rs273900718
NM_007294.3(BRCA1):c.3867_3871delAAAAT (p.Lys1290Phefs) rs80357560
NM_007294.3(BRCA1):c.3868A>T (p.Lys1290Ter) rs80357254
NM_007294.3(BRCA1):c.3869_3870delAA (p.Lys1290Metfs) rs80357918
NM_007294.3(BRCA1):c.386delG (p.Gly129Alafs) rs1135401836
NM_007294.3(BRCA1):c.3870_3871insC (p.Cys1291Leufs) rs1135401869
NM_007294.3(BRCA1):c.3870_3877delATGTTCTG (p.Lys1290Asnfs) rs1555586879
NM_007294.3(BRCA1):c.3871_3872insC (p.Cys1291Serfs) rs397509114
NM_007294.3(BRCA1):c.3872_3873insC (p.Ser1292Phefs) rs1555586891
NM_007294.3(BRCA1):c.3874delT (p.Ser1292Leufs) rs587780802
NM_007294.3(BRCA1):c.3876delT (p.Ala1293Leufs) rs397509115
NM_007294.3(BRCA1):c.3880_3883delAGCT (p.Ser1294Cysfs) rs397509116
NM_007294.3(BRCA1):c.3885del (p.Leu1295Phefs) rs886040172
NM_007294.3(BRCA1):c.3889delT (p.Ser1297Leufs) rs886038027
NM_007294.3(BRCA1):c.3893C>A (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3893C>G (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3895C>T (p.Gln1299Ter) rs80357038
NM_007294.3(BRCA1):c.389_391delACAinsTCT (p.Tyr130_Arg131delinsPheTer) rs1064793054
NM_007294.3(BRCA1):c.3901_3902delAG (p.Ser1301Terfs) rs80357646
NM_007294.3(BRCA1):c.3904G>T (p.Glu1302Ter) rs80357461
NM_007294.3(BRCA1):c.3907_3908delTTinsGGA (p.Leu1303Glyfs) rs80357634
NM_007294.3(BRCA1):c.3908_3909delTGinsAGT (p.Leu1303Terfs) rs886040174
NM_007294.3(BRCA1):c.3908_3909dup (p.Glu1304Trpfs) rs886040174
NM_007294.3(BRCA1):c.3908dupT (p.Leu1303Phefs) rs80357634
NM_007294.3(BRCA1):c.390C>A (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.390C>G (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.3910G>T (p.Glu1304Ter) rs886038028
NM_007294.3(BRCA1):c.3910delG (p.Glu1304Lysfs) rs397509117
NM_007294.3(BRCA1):c.3914delA (p.Asp1305Alafs) rs397509118
NM_007294.3(BRCA1):c.3916_3917delTT (p.Leu1306Aspfs) rs80357678
NM_007294.3(BRCA1):c.3917del (p.Leu1306Terfs) rs886040175
NM_007294.3(BRCA1):c.391A>T (p.Arg131Ter) rs80357207
NM_007294.3(BRCA1):c.3926delA (p.Asn1309Ilefs) rs397509119
NM_007294.3(BRCA1):c.3927_3930delTACA (p.Asn1309Lysfs) rs397509120
NM_007294.3(BRCA1):c.3928dupA (p.Thr1310Asnfs) rs886040176
NM_007294.3(BRCA1):c.3931_3934delAACA (p.Asn1311Profs) rs80357864
NM_007294.3(BRCA1):c.3931_3934dupAACA (p.Thr1312Lysfs) rs80357864
NM_007294.3(BRCA1):c.3932delA (p.Asn1311Thrfs) rs80357504
NM_007294.3(BRCA1):c.3937C>T (p.Gln1313Ter) rs80357318
NM_007294.3(BRCA1):c.3947_3950del (p.Phe1316Terfs) rs886040177
NM_007294.3(BRCA1):c.3952_3955del (p.Ile1318Valfs) rs886040178
NM_007294.3(BRCA1):c.3954delT (p.Ile1318Metfs) rs1135401870
NM_007294.3(BRCA1):c.3954dup (p.Gly1319Trpfs) rs1135401870
NM_007294.3(BRCA1):c.3956_3957delGT (p.Gly1319Valfs) rs1135401871
NM_007294.3(BRCA1):c.3959del (p.Ser1320Phefs) rs886040179
NM_007294.3(BRCA1):c.3961del (p.Ser1321Profs) rs886040180
NM_007294.3(BRCA1):c.3964A>T (p.Lys1322Ter) rs80357343
NM_007294.3(BRCA1):c.3966delA (p.Lys1322Asnfs) rs80357979
NM_007294.3(BRCA1):c.3967C>T (p.Gln1323Ter) rs80357262
NM_007294.3(BRCA1):c.3967delC (p.Gln1323Lysfs) rs397509122
NM_007294.3(BRCA1):c.3968_3971delAAAT (p.Gln1323Argfs) rs886040181
NM_007294.3(BRCA1):c.3969_3970delAA (p.Gln1323Hisfs) rs587782834
NM_007294.3(BRCA1):c.3972_3974delGAGinsAA (p.Met1324Ilefs) rs886040182
NM_007294.3(BRCA1):c.3972delG (p.Met1324Ilefs) rs80357987
NM_007294.3(BRCA1):c.3973delA (p.Arg1325Glyfs) rs80357904
NM_007294.3(BRCA1):c.3979C>T (p.Gln1327Ter) rs876659720
NM_007294.3(BRCA1):c.397delC (p.Arg133Valfs) rs886037973
NM_007294.3(BRCA1):c.3981delG (p.Gln1327Hisfs) rs397509123
NM_007294.3(BRCA1):c.3982dupT (p.Ser1328Phefs) rs397509124
NM_007294.3(BRCA1):c.3985_3987delGAAinsTTTC (p.Glu1329Phefs) rs886040183
NM_007294.3(BRCA1):c.3990_3993del (p.Ser1330Argfs) rs886040184
NM_007294.3(BRCA1):c.3991C>T (p.Gln1331Ter) rs397507224
NM_007294.3(BRCA1):c.3995_4001delGAGTTGG (p.Gly1332Valfs) rs886040185
NM_007294.3(BRCA1):c.3999_4008delTGGTCTGAGT (p.Gly1334Thrfs) rs754792932
NM_007294.3(BRCA1):c.3999delT (p.Gly1334Valfs) rs397509125
NM_007294.3(BRCA1):c.399_400delTG (p.Ala134Glnfs) rs80357568
NM_007294.3(BRCA1):c.3G>A (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.3G>C (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.3G>T (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.4001delG (p.Gly1334Valfs) rs397509127
NM_007294.3(BRCA1):c.4002_4005delTCTG (p.Leu1335Valfs) rs397509128
NM_007294.3(BRCA1):c.4013delA (p.Lys1338Argfs) rs886038029
NM_007294.3(BRCA1):c.4015G>T (p.Glu1339Ter) rs80357021
NM_007294.3(BRCA1):c.4015dupG (p.Glu1339Glyfs) rs886038030
NM_007294.3(BRCA1):c.4016_4017insTT (p.Glu1339Aspfs) rs886040187
NM_007294.3(BRCA1):c.4018_4019dup (p.Leu1340Phefs) rs1555586639
NM_007294.3(BRCA1):c.4033G>T (p.Glu1345Ter) rs886040188
NM_007294.3(BRCA1):c.4035delA (p.Glu1346Lysfs) rs80357711
NM_007294.3(BRCA1):c.4036delG (p.Glu1346Lysfs) rs886040189
NM_007294.3(BRCA1):c.4038_4039delAA (p.Gly1348Asnfs) rs273900721
NM_007294.3(BRCA1):c.4038_4041delAAGA (p.Arg1347Glufs) rs431825404
NM_007294.3(BRCA1):c.4039A>T (p.Arg1347Ter) rs28897689
NM_007294.3(BRCA1):c.4039dup (p.Arg1347Lysfs) rs273900721
NM_007294.3(BRCA1):c.403A>T (p.Lys135Ter) rs879255485
NM_007294.3(BRCA1):c.4041_4042delAG (p.Gly1348Asnfs) rs80357727
NM_007294.3(BRCA1):c.4042G>T (p.Gly1348Ter) rs886040191
NM_007294.3(BRCA1):c.4043delG (p.Gly1348Glufs) rs397509130
NM_007294.3(BRCA1):c.4049dupG (p.Glu1352Glyfs) rs397509131
NM_007294.3(BRCA1):c.4050_4051insG (p.Leu1351Valfs) rs483353092
NM_007294.3(BRCA1):c.4051_4052insG (p.Leu1351Cysfs) rs1555586564
NM_007294.3(BRCA1):c.4052T>A (p.Leu1351Ter) rs397509132
NM_007294.3(BRCA1):c.4052dupT (p.Leu1351Phefs) rs80357779
NM_007294.3(BRCA1):c.4054G>T (p.Glu1352Ter) rs80357202
NM_007294.3(BRCA1):c.4057G>T (p.Glu1353Ter) rs80357178
NM_007294.3(BRCA1):c.4057_4061delGAAAA (p.Glu1353Terfs) rs397509133
NM_007294.3(BRCA1):c.4062_4065delTAAT (p.Asn1355Lysfs) rs398122679
NM_007294.3(BRCA1):c.4062_4066del (p.Asn1354Lysfs) rs886040192
NM_007294.3(BRCA1):c.4062_4068delTAATCAA (p.Asn1354Lysfs) rs397509134
NM_007294.3(BRCA1):c.4064_4066delATCinsT (p.Asn1355Ilefs) rs1060502345
NM_007294.3(BRCA1):c.4065_4068delTCAA (p.Asn1355Lysfs) rs80357508
NM_007294.3(BRCA1):c.4066C>T (p.Gln1356Ter) rs886040193
NM_007294.3(BRCA1):c.4066_4069delCAAG (p.Gln1356Lysfs) rs397509135
NM_007294.3(BRCA1):c.4066del (p.Gln1356Lysfs) rs886040194
NM_007294.3(BRCA1):c.4069G>T (p.Glu1357Ter) rs886040195
NM_007294.3(BRCA1):c.4069_4070insTTGA (p.Glu1357Valfs) rs886037788
NM_007294.3(BRCA1):c.406del (p.Arg136Aspfs) rs80357709
NM_007294.3(BRCA1):c.406dupA (p.Arg136Lysfs) rs80357709
NM_007294.3(BRCA1):c.4070_4071insTTGA (p.Glu1357Aspfs) rs1555586517
NM_007294.3(BRCA1):c.4071del (p.Glu1358Serfs) rs886040197
NM_007294.3(BRCA1):c.4072G>T (p.Glu1358Ter) rs397509136
NM_007294.3(BRCA1):c.4074_4090del (p.Gln1359Leufs) rs886040198
NM_007294.3(BRCA1):c.4075C>T (p.Gln1359Ter) rs80357456
NM_007294.3(BRCA1):c.4079del (p.Ser1360Thrfs) rs886040199
NM_007294.3(BRCA1):c.407delG (p.Arg136Asnfs) rs886040200
NM_007294.3(BRCA1):c.4085delA (p.Asp1362Valfs) rs80357737
NM_007294.3(BRCA1):c.4088C>A (p.Ser1363Ter) rs398122680
NM_007294.3(BRCA1):c.4088C>G (p.Ser1363Ter) rs398122680
NM_007294.3(BRCA1):c.4092_4093delCT (p.Leu1365Argfs) rs397509137
NM_007294.3(BRCA1):c.4094T>G (p.Leu1365Ter) rs398122681
NM_007294.3(BRCA1):c.4094delT (p.Leu1365Terfs) rs397509138
NM_007294.3(BRCA1):c.4096+1G>A rs80358178
NM_007294.3(BRCA1):c.4096+3A>G rs80358015
NM_007294.3(BRCA1):c.4097-1G>A rs80358070
NM_007294.3(BRCA1):c.4097-2A>C rs80358019
NM_007294.3(BRCA1):c.4097-2A>G rs80358019
NM_007294.3(BRCA1):c.4097-78_4185+69del rs1555586010
NM_007294.3(BRCA1):c.4099G>T (p.Glu1367Ter) rs786202998
NM_007294.3(BRCA1):c.40_41del (p.Val14Hisfs) rs886040186
NM_007294.3(BRCA1):c.40del (p.Val14Serfs) rs886040201
NM_007294.3(BRCA1):c.4107_4108insATCT (p.Ser1370Ilefs) rs886040202
NM_007294.3(BRCA1):c.4107_4110dupATCT (p.Gly1371Ilefs) rs397509139
NM_007294.3(BRCA1):c.4108_4109insATCT (p.Ser1370Tyrfs) rs1555586260
NM_007294.3(BRCA1):c.4110_4111delTG (p.Gly1371Valfs) rs80357529
NM_007294.3(BRCA1):c.4111_4112insATCT (p.Gly1371Aspfs) rs80357935
NM_007294.3(BRCA1):c.4112_4113insATCT (p.Cys1372Serfs) rs1555586240
NM_007294.3(BRCA1):c.4113delG (p.Cys1372Valfs) rs80357861
NM_007294.3(BRCA1):c.4116T>A (p.Cys1372Ter) rs397509140
NM_007294.3(BRCA1):c.4116_4117delTG (p.Cys1372Terfs) rs80357804
NM_007294.3(BRCA1):c.4116_4117insTT (p.Glu1373Leufs) rs398122682
NM_007294.3(BRCA1):c.4116del (p.Cys1372Trpfs) rs886040204
NM_007294.3(BRCA1):c.4117G>T (p.Glu1373Ter) rs80357259
NM_007294.3(BRCA1):c.4117_4118insTT (p.Glu1373Valfs) rs1555586212
NM_007294.3(BRCA1):c.411_414del (p.Leu138Argfs) rs886040203
NM_007294.3(BRCA1):c.411del (p.Leu138Tyrfs) rs886040205
NM_007294.3(BRCA1):c.411dup (p.Leu138Serfs) rs886040205
NM_007294.3(BRCA1):c.4120_4121delAG (p.Ser1374Terfs) rs80357787
NM_007294.3(BRCA1):c.4122_4123delTG (p.Ser1374Argfs) rs80357691
NM_007294.3(BRCA1):c.4123G>T (p.Glu1375Ter) rs80357397
NM_007294.3(BRCA1):c.4126_4129del (p.Thr1376Alafs) rs886040206
NM_007294.3(BRCA1):c.4127del (p.Thr1376Lysfs) rs886040207
NM_007294.3(BRCA1):c.4128_4129delAA (p.Ser1377Argfs) rs80357921
NM_007294.3(BRCA1):c.4129del (p.Ser1377Alafs) rs886040208
NM_007294.3(BRCA1):c.412_418delCTACAGA (p.Leu138Valfs) rs80357816
NM_007294.3(BRCA1):c.4136_4137delCT (p.Ser1379Terfs) rs397509141
NM_007294.3(BRCA1):c.4137_4138del (p.Glu1380Argfs) rs886040209
NM_007294.3(BRCA1):c.4137delT (p.Glu1380Lysfs) rs1064793746
NM_007294.3(BRCA1):c.4139_4140delAA (p.Glu1380Glyfs) rs886038032
NM_007294.3(BRCA1):c.4146C>A (p.Cys1382Ter) rs1057517574
NM_007294.3(BRCA1):c.4146_4155dupCTCAGGGCTA (p.Ser1386Leufs) rs483353079
NM_007294.3(BRCA1):c.4148C>G (p.Ser1383Ter) rs80357071
NM_007294.3(BRCA1):c.4152_4153del (p.Leu1385Ilefs)
NM_007294.3(BRCA1):c.4155_4156ins10 (p.?)
NM_007294.3(BRCA1):c.4158_4162delCTCTC (p.Ser1387Glufs) rs397509142
NM_007294.3(BRCA1):c.415C>T (p.Gln139Ter) rs80357372
NM_007294.3(BRCA1):c.415del (p.Gln139Argfs) rs1555596315
NM_007294.3(BRCA1):c.4161_4162delTC (p.Gln1388Glufs) rs80357565
NM_007294.3(BRCA1):c.4162C>T (p.Gln1388Ter) rs876660601
NM_007294.3(BRCA1):c.4162_4163del (p.Gln1388Glufs) rs886040210
NM_007294.3(BRCA1):c.4163_4166delAGAG (p.Gln1388Leufs) rs80357532
NM_007294.3(BRCA1):c.4163dupA (p.Ser1389Glufs) rs80357788
NM_007294.3(BRCA1):c.4165_4166delAG (p.Ser1389Terfs) rs80357572
NM_007294.3(BRCA1):c.4165_4166dupAG (p.Ser1389Argfs) rs80357572
NM_007294.3(BRCA1):c.4167_4168delTG (p.Ser1389Argfs) rs397509144
NM_007294.3(BRCA1):c.4167_4168insAG (p.Asp1390Argfs) rs80357847
NM_007294.3(BRCA1):c.4167_4170delTGAC (p.Ser1389Argfs) rs80357538
NM_007294.3(BRCA1):c.4167delT (p.Ser1389Argfs) rs397509145
NM_007294.3(BRCA1):c.4168_4169delGA (p.Asp1390Hisfs) rs1555586103
NM_007294.3(BRCA1):c.4168_4169dup (p.Asp1390Glufs) rs1555586100
NM_007294.3(BRCA1):c.416dupA (p.Ser140Glufs) rs786203432
NM_007294.3(BRCA1):c.4175del (p.Leu1392Terfs) rs886040211
NM_007294.3(BRCA1):c.4182_4183dupTC (p.Gln1395Leufs) rs80357742
NM_007294.3(BRCA1):c.4183C>T (p.Gln1395Ter) rs80357260
NM_007294.3(BRCA1):c.4185+1G>A rs80358076
NM_007294.3(BRCA1):c.4185+1G>T rs80358076
NM_007294.3(BRCA1):c.4185+1delG
NM_007294.3(BRCA1):c.4185+2T>A rs431825406
NM_007294.3(BRCA1):c.4185+2T>C rs431825406
NM_007294.3(BRCA1):c.4185+2_4185+22del21insA rs273900724
NM_007294.3(BRCA1):c.4185G>A (p.Gln1395=) rs80356857
NM_007294.3(BRCA1):c.4185_4185+3delGGTA rs397509149
NM_007294.3(BRCA1):c.4186-1643_4357+2020del
NM_007294.3(BRCA1):c.4186-1787_4357+4122dup
NM_007294.3(BRCA1):c.4186-2A>G rs878854950
NM_007294.3(BRCA1):c.4186-832_4357+1955del
NM_007294.3(BRCA1):c.4186-?_4357+?del
NM_007294.3(BRCA1):c.4186-?_4357+?dup172
NM_007294.3(BRCA1):c.4186-?_4484+?del
NM_007294.3(BRCA1):c.4186-?_4675+?del
NM_007294.3(BRCA1):c.4186-?_4986+?del
NM_007294.3(BRCA1):c.4186-?_5193+?del
NM_007294.3(BRCA1):c.4186-?_5277+?del
NM_007294.3(BRCA1):c.4186C>T (p.Gln1396Ter) rs80357011
NM_007294.3(BRCA1):c.418dup (p.Ser140Lysfs) rs886040212
NM_007294.3(BRCA1):c.4193_4194insGG (p.Asp1398Glufs) rs886038033
NM_007294.3(BRCA1):c.4194_4195insGG (p.Thr1399Glyfs) rs1555584262
NM_007294.3(BRCA1):c.4195_4196delAC (p.Thr1399Hisfs) rs80357649
NM_007294.3(BRCA1):c.4195delA (p.Thr1399Profs)
NM_007294.3(BRCA1):c.4196_4197delCCinsT (p.Thr1399Ilefs)
NM_007294.3(BRCA1):c.4197del (p.Met1400Cysfs) rs886040213
NM_007294.3(BRCA1):c.4201C>T (p.Gln1401Ter) rs397509151
NM_007294.3(BRCA1):c.4205del (p.His1402Leufs) rs886040214
NM_007294.3(BRCA1):c.4206_4207del (p.His1402Glnfs) rs886040215
NM_007294.3(BRCA1):c.4210delC (p.Leu1404Terfs) rs80357765
NM_007294.3(BRCA1):c.4214delT (p.Ile1405Lysfs) rs273900728
NM_007294.3(BRCA1):c.4216A>T (p.Lys1406Ter) rs886040216
NM_007294.3(BRCA1):c.4218del (p.Lys1406Asnfs) rs886040217
NM_007294.3(BRCA1):c.4222C>T (p.Gln1408Ter) rs80356989
NM_007294.3(BRCA1):c.4225C>T (p.Gln1409Ter) rs886040218
NM_007294.3(BRCA1):c.4228G>T (p.Glu1410Ter) rs397509152
NM_007294.3(BRCA1):c.4237G>T (p.Glu1413Ter) rs397509153
NM_007294.3(BRCA1):c.4239del (p.Glu1413Aspfs) rs886040219
NM_007294.3(BRCA1):c.4240dupC (p.Leu1414Profs) rs397509154
NM_007294.3(BRCA1):c.4243G>T (p.Glu1415Ter) rs1057519558
NM_007294.3(BRCA1):c.4243_4244insT (p.Glu1415Valfs) rs1555584178
NM_007294.3(BRCA1):c.4243delG (p.Glu1415Lysfs) rs80357981
NM_007294.3(BRCA1):c.424_431delCCCGAAAA (p.Pro142Serfs) rs1555596294
NM_007294.3(BRCA1):c.4250delT (p.Val1417Glyfs) rs587782879
NM_007294.3(BRCA1):c.4251_4252delGT (p.Leu1418Argfs) rs80357977
NM_007294.3(BRCA1):c.4253T>G (p.Leu1418Ter) rs397509157
NM_007294.3(BRCA1):c.4255G>T (p.Glu1419Ter) rs80357309
NM_007294.3(BRCA1):c.4258C>T (p.Gln1420Ter) rs80357305
NM_007294.3(BRCA1):c.4266delG (p.Ser1423Alafs) rs397509158
NM_007294.3(BRCA1):c.4266dupG (p.Ser1423Glufs) rs397509158
NM_007294.3(BRCA1):c.4270C>T (p.Gln1424Ter) rs886040220
NM_007294.3(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.3(BRCA1):c.4281_4282insTAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAAC (p.Ser1428_Arg1762delinsTer) rs886040896
NM_007294.3(BRCA1):c.4282_4283delAG (p.Ser1428Leufs) rs397509159
NM_007294.3(BRCA1):c.4282delA (p.Ser1428Alafs) rs1555584125
NM_007294.3(BRCA1):c.4283_4284insG (p.Ser1428Argfs) rs1135401873
NM_007294.3(BRCA1):c.4284_4285delCTinsG (p.Ser1428Argfs) rs886040221
NM_007294.3(BRCA1):c.4284_4285insG (p.Tyr1429Valfs) rs1555584122
NM_007294.3(BRCA1):c.4285_4286insG (p.Tyr1429Terfs) rs80357716
NM_007294.3(BRCA1):c.4285dup (p.Tyr1429Leufs) rs1555584118
NM_007294.3(BRCA1):c.4286_4287insG (p.Tyr1429Terfs) rs1555584110
NM_007294.3(BRCA1):c.4287C>A (p.Tyr1429Ter) rs397509160
NM_007294.3(BRCA1):c.4289dupC (p.Ser1431Phefs) rs80357556
NM_007294.3(BRCA1):c.4290_4296del (p.Ser1431Terfs) rs886040222
NM_007294.3(BRCA1):c.4300dupA (p.Ser1434Lysfs) rs80357790
NM_007294.3(BRCA1):c.4307_4308delCT (p.Ser1436Phefs) rs397509161
NM_007294.3(BRCA1):c.4309del (p.Ser1437Leufs) rs886040223
NM_007294.3(BRCA1):c.4310delC (p.Ser1437Leufs) rs1135401874
NM_007294.3(BRCA1):c.431delA (p.Asn144Ilefs) rs397509162
NM_007294.3(BRCA1):c.431dup (p.Asn144Lysfs) rs397509162
NM_007294.3(BRCA1):c.4321dupG (p.Asp1441Glyfs) rs80357748
NM_007294.3(BRCA1):c.4327C>G (p.Arg1443Gly) rs41293455
NM_007294.3(BRCA1):c.4327C>T (p.Arg1443Ter) rs41293455
NM_007294.3(BRCA1):c.4331_4332delAT (p.Asn1444Thrfs) rs397509163
NM_007294.3(BRCA1):c.4331_4338delATCCAGAA (p.Asn1444Thrfs) rs80357825
NM_007294.3(BRCA1):c.4335_4338dupAGAA (p.Gln1447Argfs) rs397509164
NM_007294.3(BRCA1):c.4338_4339ins4
NM_007294.3(BRCA1):c.4339C>T (p.Gln1447Ter) rs80357067
NM_007294.3(BRCA1):c.4342dup (p.Ser1448Lysfs) rs886040225
NM_007294.3(BRCA1):c.4348delT (p.Ser1450Glnfs) rs1135401932
NM_007294.3(BRCA1):c.4348dupT (p.Ser1450Phefs) rs80357548
NM_007294.3(BRCA1):c.4349C>G (p.Ser1450Ter) rs886040226
NM_007294.3(BRCA1):c.4354A>T (p.Lys1452Ter) rs398122685
NM_007294.3(BRCA1):c.4357+1G>A rs80358027
NM_007294.3(BRCA1):c.4357+1G>C rs80358027
NM_007294.3(BRCA1):c.4357+1G>T rs80358027
NM_007294.3(BRCA1):c.4357+1_4357+10del rs886040907
NM_007294.3(BRCA1):c.4357+1delG rs397509165
NM_007294.3(BRCA1):c.4357+2T>C rs80358152
NM_007294.3(BRCA1):c.4357+2T>G rs80358152
NM_007294.3(BRCA1):c.4357+6T>C rs80358143
NM_007294.3(BRCA1):c.4358-?_4484+?del
NM_007294.3(BRCA1):c.4358-?_4484+?dup
NM_007294.3(BRCA1):c.4358-?_4986+?del
NM_007294.3(BRCA1):c.4358-?_4986+?dup
NM_007294.3(BRCA1):c.4358-?_5074+?del
NM_007294.3(BRCA1):c.4358-?_5193+?del
NM_007294.3(BRCA1):c.4358-?_5277+?del
NM_007294.3(BRCA1):c.4358_4484del127 (p.Ala1453Glyfs) rs1555582530
NM_007294.3(BRCA1):c.4364T>G (p.Leu1455Ter) rs886040227
NM_007294.3(BRCA1):c.4370C>A (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4370C>G (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4372C>T (p.Gln1458Ter) rs80356932
NM_007294.3(BRCA1):c.4372_4373delCA (p.Gln1458Glufs) rs879255317
NM_007294.3(BRCA1):c.4373_4389del17 (p.Gln1458Profs) rs80359885
NM_007294.3(BRCA1):c.4375A>T (p.Lys1459Ter) rs886040228
NM_007294.3(BRCA1):c.4379delG (p.Ser1460Ilefs) rs786203149
NM_007294.3(BRCA1):c.437_440delCCTT (p.Ser146Cysfs) rs397509168
NM_007294.3(BRCA1):c.4382_4388dup (p.Tyr1463Terfs)
NM_007294.3(BRCA1):c.4386dupA (p.Tyr1463Ilefs) rs786204267
NM_007294.3(BRCA1):c.4387delT (p.Tyr1463Thrfs) rs397507229
NM_007294.3(BRCA1):c.4388_4389ins7
NM_007294.3(BRCA1):c.4389C>A (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4389C>G (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4389_4392dupCCCT (p.Ile1465Profs) rs879255282
NM_007294.3(BRCA1):c.438_439ins25 (p.?)
NM_007294.3(BRCA1):c.4391_4393delCTAinsTT (p.Pro1464Leufs) rs273900730
NM_007294.3(BRCA1):c.4391_4403delCTATAAGCCAGAAinsTT (p.Pro1464Leufs) rs273900731
NM_007294.3(BRCA1):c.4391delC (p.Pro1464Leufs) rs80357916
NM_007294.3(BRCA1):c.4391dupC (p.Ile1465Tyrfs) rs80357916
NM_007294.3(BRCA1):c.4392delT (p.Ile1465Terfs) rs1064793577
NM_007294.3(BRCA1):c.4393delA (p.Ile1465Terfs) rs397507230
NM_007294.3(BRCA1):c.4394dup (p.Ser1466Lysfs) rs1555582670
NM_007294.3(BRCA1):c.4397_4398insA (p.Ser1466Argfs) rs886040229
NM_007294.3(BRCA1):c.4398_4399insA (p.Gln1467Thrfs) rs1555582663
NM_007294.3(BRCA1):c.4399C>T (p.Gln1467Ter) rs397509171
NM_007294.3(BRCA1):c.4400_4418del19insTTT (p.Gln1467Leufs) rs876659310
NM_007294.3(BRCA1):c.4401delG (p.Asn1468Ilefs) rs587781611
NM_007294.3(BRCA1):c.4408G>T (p.Glu1470Ter) rs886040230
NM_007294.3(BRCA1):c.441+1G>A rs397509172
NM_007294.3(BRCA1):c.441+2T>A rs397509173
NM_007294.3(BRCA1):c.441+2T>G rs397509173
NM_007294.3(BRCA1):c.4412delG (p.Gly1471Alafs) rs1064793951
NM_007294.3(BRCA1):c.4416_4417delTTinsG (p.Ser1473Leufs) rs397509174
NM_007294.3(BRCA1):c.4417del (p.Ser1473Leufs) rs886040231
NM_007294.3(BRCA1):c.442-1129_547+223del
NM_007294.3(BRCA1):c.442-2A>C rs80358155
NM_007294.3(BRCA1):c.442-43_524del rs1555594841
NM_007294.3(BRCA1):c.442-7T>A rs886040909
NM_007294.3(BRCA1):c.442-952_547dup
NM_007294.3(BRCA1):c.442-?_4185+?del
NM_007294.3(BRCA1):c.442-?_4357+?del
NM_007294.3(BRCA1):c.442-?_5277+?dup
NM_007294.3(BRCA1):c.442-?_5467+?del
NM_007294.3(BRCA1):c.442-?_547+?del
NM_007294.3(BRCA1):c.442-?_547+?dup
NM_007294.3(BRCA1):c.442-?_593+?del
NM_007294.3(BRCA1):c.442-?_670+?del
NM_007294.3(BRCA1):c.4427dupA (p.Phe1477Valfs) rs397507231
NM_007294.3(BRCA1):c.442C>T (p.Gln148Ter) rs876659614
NM_007294.3(BRCA1):c.4432G>T (p.Glu1478Ter) rs876659878
NM_007294.3(BRCA1):c.4435delG (p.Val1479Cysfs) rs397509176
NM_007294.3(BRCA1):c.4447delA (p.Ser1483Valfs) rs397509177
NM_007294.3(BRCA1):c.4450_4451ins4
NM_007294.3(BRCA1):c.4452_4455delTACC (p.Thr1485Valfs) rs397509178
NM_007294.3(BRCA1):c.4453_4474del (p.Thr1485Glufs) rs886040232
NM_007294.3(BRCA1):c.4456delA (p.Ser1486Valfs) rs397509179
NM_007294.3(BRCA1):c.4457delG (p.Ser1486Ilefs) rs397509180
NM_007294.3(BRCA1):c.445G>T (p.Glu149Ter) rs876658381
NM_007294.3(BRCA1):c.445delG (p.Glu149Lysfs) rs1060502327
NM_007294.3(BRCA1):c.4463dupA (p.Asn1488Lysfs) rs80357620
NM_007294.3(BRCA1):c.4468G>T (p.Glu1490Ter) rs138608489
NM_007294.3(BRCA1):c.4474G>T (p.Gly1492Ter) rs863224511
NM_007294.3(BRCA1):c.4480G>T (p.Glu1494Ter) rs80357148
NM_007294.3(BRCA1):c.4482_4483delAA (p.Arg1495Valfs) rs80357854
NM_007294.3(BRCA1):c.4483delA (p.Arg1495Glyfs) rs80357854
NM_007294.3(BRCA1):c.4484+1G>A rs80358063
NM_007294.3(BRCA1):c.4484+1G>T rs80358063
NM_007294.3(BRCA1):c.4484+1delG rs397509181
NM_007294.3(BRCA1):c.4484+2T>C rs1555582520
NM_007294.3(BRCA1):c.4484+5G>C rs886040910
NM_007294.3(BRCA1):c.4484G>A (p.Arg1495Lys) rs80357389
NM_007294.3(BRCA1):c.4484G>C (p.Arg1495Thr) rs80357389
NM_007294.3(BRCA1):c.4484G>T (p.Arg1495Met) rs80357389
NM_007294.3(BRCA1):c.4485-1G>A rs80358189
NM_007294.3(BRCA1):c.4485-1G>C rs80358189
NM_007294.3(BRCA1):c.4485-1G>T rs80358189
NM_007294.3(BRCA1):c.4485-2A>G rs80358054
NM_007294.3(BRCA1):c.4485-2A>T rs80358054
NM_007294.3(BRCA1):c.4485-?_4675+?del
NM_007294.3(BRCA1):c.4485-?_4675+?dup
NM_007294.3(BRCA1):c.4485-?_4986+?del
NM_007294.3(BRCA1):c.4485-?_5074+?del
NM_007294.3(BRCA1):c.4485_4675del191 (p.Ser1496Glyfs) rs1555581778
NM_007294.3(BRCA1):c.4486delT (p.Ser1496Hisfs) rs1555582082
NM_007294.3(BRCA1):c.4487C>A (p.Ser1496Ter) rs80356953
NM_007294.3(BRCA1):c.4487C>G (p.Ser1496Ter) rs80356953
NM_007294.3(BRCA1):c.4493delC (p.Pro1498Leufs) rs398122687
NM_007294.3(BRCA1):c.4503C>A (p.Cys1501Ter) rs747539984
NM_007294.3(BRCA1):c.4505delC (p.Pro1502Hisfs) rs1555582069
NM_007294.3(BRCA1):c.4507_4511delTCATT (p.Ser1503Argfs) rs1135401877
NM_007294.3(BRCA1):c.4508C>A (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4508C>G (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4516delG (p.Asp1506Ilefs) rs273900736
NM_007294.3(BRCA1):c.4523G>A (p.Trp1508Ter) rs786202631
NM_007294.3(BRCA1):c.4523_4526delGGTAinsTGCCCATCATTAGATGAG (p.Trp1508Leufs) rs1064794004
NM_007294.3(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.3(BRCA1):c.4527C>A (p.Tyr1509Ter) rs886040233
NM_007294.3(BRCA1):c.4528delA (p.Met1510Cysfs) rs397509182
NM_007294.3(BRCA1):c.4532dup (p.His1511Glnfs) rs1555582009
NM_007294.3(BRCA1):c.4533_4534delCA (p.His1511Glnfs) rs80357534
NM_007294.3(BRCA1):c.4534_4535delAG (p.Ser1512Leufs) rs397509183
NM_007294.3(BRCA1):c.4552C>T (p.Gln1518Ter) rs80356881
NM_007294.3(BRCA1):c.4566C>A (p.Tyr1522Ter) rs886040234
NM_007294.3(BRCA1):c.4566C>G (p.Tyr1522Ter) rs886040234
NM_007294.3(BRCA1):c.4569_4570insCC (p.Ser1524Profs) rs886040235
NM_007294.3(BRCA1):c.4569_4572del (p.Ser1524Lysfs) rs886040236
NM_007294.3(BRCA1):c.456_457delCA (p.Ser153Cysfs) rs80357882
NM_007294.3(BRCA1):c.456delC (p.Ser153Valfs) rs876659830
NM_007294.3(BRCA1):c.4570delT (p.Ser1524Leufs) rs878853293
NM_007294.3(BRCA1):c.4571_4572insCC (p.Gln1525Leufs) rs1555581948
NM_007294.3(BRCA1):c.4573C>T (p.Gln1525Ter) rs886040237
NM_007294.3(BRCA1):c.4574_4575delAA (p.Gln1525Argfs) rs80357813
NM_007294.3(BRCA1):c.4575_4585delAGAGGAGCTCA (p.Gln1525Hisfs) rs397509184
NM_007294.3(BRCA1):c.4576G>T (p.Glu1526Ter) rs878853294
NM_007294.3(BRCA1):c.457_458delAG (p.Ser153Cysfs) rs397509185
NM_007294.3(BRCA1):c.457_458ins21 (p.?)
NM_007294.3(BRCA1):c.4587_4590delTAAG (p.Ile1529Metfs) rs431825409
NM_007294.3(BRCA1):c.4591del (p.Val1531Leufs) rs886040238
NM_007294.3(BRCA1):c.4593dup (p.Val1532Cysfs) rs886040239
NM_007294.3(BRCA1):c.4595_4596insCT (p.Asp1533Leufs) rs80357699
NM_007294.3(BRCA1):c.4596_4597insCT (p.Asp1533Leufs) rs1555581894
NM_007294.3(BRCA1):c.45delT (p.Asn16Metfs) rs730881457
NM_007294.3(BRCA1):c.45dup (p.Asn16Terfs)
NM_007294.3(BRCA1):c.4603G>T (p.Glu1535Ter) rs80357366
NM_007294.3(BRCA1):c.4609C>T (p.Gln1537Ter) rs80357229
NM_007294.3(BRCA1):c.4609_4610insCC (p.Gln1537Profs) rs886038035
NM_007294.3(BRCA1):c.460_467delGTCCAACT (p.Val154Leufs) rs1060502362
NM_007294.3(BRCA1):c.4610_4611insCC (p.Gln1537Hisfs) rs1555581882
NM_007294.3(BRCA1):c.4611_4612insG (p.Gln1538Alafs) rs80357915
NM_007294.3(BRCA1):c.4612C>T (p.Gln1538Ter) rs80356992
NM_007294.3(BRCA1):c.4612_4613insG (p.Gln1538Argfs) rs1555581879
NM_007294.3(BRCA1):c.4616dup (p.Glu1540Glyfs) rs1555581874
NM_007294.3(BRCA1):c.4618G>T (p.Glu1540Ter) rs80357277
NM_007294.3(BRCA1):c.4618_4621delGAAGinsAAA (p.Glu1540Lysfs) rs886040240
NM_007294.3(BRCA1):c.4621G>T (p.Glu1541Ter) rs80357248
NM_007294.3(BRCA1):c.4622_4623delAG (p.Glu1541Valfs) rs886040241
NM_007294.3(BRCA1):c.4625_4626delCT (p.Ser1542Trpfs) rs80357542
NM_007294.3(BRCA1):c.463C>T (p.Gln155Ter) rs80357180
NM_007294.3(BRCA1):c.4644_4645ins8
NM_007294.3(BRCA1):c.4646_4665del20 (p.Glu1549Alafs) rs397509186
NM_007294.3(BRCA1):c.4647_4648dupAA (p.Thr1550Lysfs) rs869025213
NM_007294.3(BRCA1):c.464_465delAA (p.Gln155Profs) rs886037974
NM_007294.3(BRCA1):c.4654_4655insC (p.Tyr1552Serfs) rs1555581824
NM_007294.3(BRCA1):c.4654_4673del20 (p.Tyr1552Argfs) rs876659293
NM_007294.3(BRCA1):c.4655_4658delACTT (p.Tyr1552Cysfs) rs80357561
NM_007294.3(BRCA1):c.4655dupA (p.Tyr1552Terfs) rs587782143
NM_007294.3(BRCA1):c.4656C>G (p.Tyr1552Ter) rs80357151
NM_007294.3(BRCA1):c.465delA (p.Gln155Hisfs) rs1555594954
NM_007294.3(BRCA1):c.4666C>T (p.Gln1556Ter) rs1555581812
NM_007294.3(BRCA1):c.4668dup (p.Asp1557Argfs) rs886040242
NM_007294.3(BRCA1):c.466dupC (p.Leu156Profs) rs397507236
NM_007294.3(BRCA1):c.4674delA (p.Glu1559Argfs) rs886040911
NM_007294.3(BRCA1):c.4675+1G>A rs80358044
NM_007294.3(BRCA1):c.4675+1G>C rs80358044
NM_007294.3(BRCA1):c.4675+1G>T rs80358044
NM_007294.3(BRCA1):c.4675+2T>A rs879255293
NM_007294.3(BRCA1):c.4675+2T>C rs879255293
NM_007294.3(BRCA1):c.4675+3A>T rs80358082
NM_007294.3(BRCA1):c.4675G>A (p.Glu1559Lys) rs80356988
NM_007294.3(BRCA1):c.4675G>C (p.Glu1559Gln) rs80356988
NM_007294.3(BRCA1):c.4675_4675+1insA rs1135401878
NM_007294.3(BRCA1):c.4676-1420_4986+900del
NM_007294.3(BRCA1):c.4676-1G>A rs80358008
NM_007294.3(BRCA1):c.4676-1G>T rs80358008
NM_007294.3(BRCA1):c.4676-2A>G rs80358096
NM_007294.3(BRCA1):c.4676-?_4986+?del
NM_007294.3(BRCA1):c.4676-?_5074+?del
NM_007294.3(BRCA1):c.4676-?_5193+?del
NM_007294.3(BRCA1):c.4676-?_5467+?del
NM_007294.3(BRCA1):c.4677_5075del
NM_007294.3(BRCA1):c.4678G>T (p.Gly1560Ter) rs80357349
NM_007294.3(BRCA1):c.4678_4679delGG (p.Gly1560Asnfs) rs1555581104
NM_007294.3(BRCA1):c.4681delA (p.Thr1561Profs) rs397509187
NM_007294.3(BRCA1):c.4684_4685delCC (p.Pro1562Leufs) rs397509188
NM_007294.3(BRCA1):c.4688_4694delACCTGGAinsG (p.Tyr1563_Tyr1863del) rs1555581087
NM_007294.3(BRCA1):c.4688dup (p.Tyr1563Terfs) rs886040243
NM_007294.3(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.3(BRCA1):c.4695dupA (p.Ser1566Ilefs) rs397509189
NM_007294.3(BRCA1):c.4696_4697insA (p.Ser1566Tyrfs) rs483353095
NM_007294.3(BRCA1):c.4697_4698insA (p.Gly1567Trpfs) rs1555581078
NM_007294.3(BRCA1):c.4698_4704dupTGGAATC (p.Ser1569Trpfs) rs879255318
NM_007294.3(BRCA1):c.4699_4708del (p.Gly1567Serfs) rs886040244
NM_007294.3(BRCA1):c.469_470insAT (p.Ser157Tyrfs) rs1555594935
NM_007294.3(BRCA1):c.4700_4710delGAATCAGCCTCinsA (p.Gly1567Aspfs) rs886040245
NM_007294.3(BRCA1):c.4709dupT (p.Phe1571Leufs) rs864622132
NM_007294.3(BRCA1):c.470_471delCT (p.Ser157Terfs) rs80357887
NM_007294.3(BRCA1):c.470_477delCTAACCTT (p.Ser157Trpfs) rs397509190
NM_007294.3(BRCA1):c.4712_4716delTCTCT (p.Phe1571Terfs) rs80357718
NM_007294.3(BRCA1):c.4712delT (p.Phe1571Serfs) rs886037790
NM_007294.3(BRCA1):c.4724delC (p.Pro1575Leufs) rs397509191
NM_007294.3(BRCA1):c.4736_4739delCTTC (p.Pro1579Leufs) rs1555581017
NM_007294.3(BRCA1):c.4741G>T (p.Glu1581Ter) rs397509193
NM_007294.3(BRCA1):c.4743del (p.Asp1582Thrfs) rs886040246
NM_007294.3(BRCA1):c.4745delA (p.Asp1582Alafs) rs80357907
NM_007294.3(BRCA1):c.4749_4750delAG (p.Arg1583Serfs) rs80357641
NM_007294.3(BRCA1):c.4754_4755delCA (p.Pro1585Argfs) rs80357837
NM_007294.3(BRCA1):c.4755del (p.Glu1586Serfs) rs886037789
NM_007294.3(BRCA1):c.4758_4759insA (p.Ser1587Ilefs) rs886040247
NM_007294.3(BRCA1):c.4759_4760insA (p.Ser1587Tyrfs) rs1555580980
NM_007294.3(BRCA1):c.475delC (p.Gly160Glufs) rs886037976
NM_007294.3(BRCA1):c.4760C>G (p.Ser1587Ter) rs397509195
NM_007294.3(BRCA1):c.4764_4765delTC (p.Arg1589Cysfs) rs80357795
NM_007294.3(BRCA1):c.4764delT (p.Arg1589Valfs) rs397509196
NM_007294.3(BRCA1):c.4775_4779delACATAinsC (p.Asn1592Thrfs) rs397507237
NM_007294.3(BRCA1):c.4784del (p.Ser1595Phefs) rs886040248
NM_007294.3(BRCA1):c.4787C>A (p.Ser1596Ter) rs80357429
NM_007294.3(BRCA1):c.4799dupT (p.Leu1600Phefs) rs587782392
NM_007294.3(BRCA1):c.4801A>T (p.Lys1601Ter) rs80357303
NM_007294.3(BRCA1):c.4803delA (p.Val1602Phefs) rs1555580912
NM_007294.3(BRCA1):c.4806delT (p.Gln1604Asnfs) rs886038036
NM_007294.3(BRCA1):c.4810C>T (p.Gln1604Ter) rs80357352
NM_007294.3(BRCA1):c.4818delA (p.Val1607Leufs) rs1555580883
NM_007294.3(BRCA1):c.4822_4823insG (p.Ala1608Glyfs) rs1135401933
NM_007294.3(BRCA1):c.4823_4824insG (p.Glu1609Argfs) rs1555580865
NM_007294.3(BRCA1):c.4828dup (p.Ser1610Phefs) rs1555580854
NM_007294.3(BRCA1):c.4834C>T (p.Gln1612Ter) rs786202064
NM_007294.3(BRCA1):c.4834_4835delCA (p.Gln1612Glufs) rs1555580840
NM_007294.3(BRCA1):c.4834del (p.Gln1612Argfs) rs886040249
NM_007294.3(BRCA1):c.4836dupG (p.Ser1613Glufs) rs397509198
NM_007294.3(BRCA1):c.4837_4838delAGinsGCC (p.Ser1613Alafs) rs730880287
NM_007294.3(BRCA1):c.4837delA (p.Ser1613Valfs) rs397509199
NM_007294.3(BRCA1):c.4838_4839insC (p.Pro1614Serfs) rs397509200
NM_007294.3(BRCA1):c.4841dup (p.Ala1615Serfs) rs1555580813
NM_007294.3(BRCA1):c.4843dupG (p.Ala1615Glyfs) rs80357615
NM_007294.3(BRCA1):c.485_486delTG (p.Val162Glufs) rs80357708
NM_007294.3(BRCA1):c.485_486dup (p.Arg163Terfs) rs80357708
NM_007294.3(BRCA1):c.485dupT (p.Arg163Glufs) rs587781427
NM_007294.3(BRCA1):c.4860_4941del82 (p.Asp1621Lysfs) rs1555580648
NM_007294.3(BRCA1):c.4862_4871del10 (p.Asp1621Glyfs) rs1555580773
NM_007294.3(BRCA1):c.4868C>G (p.Ala1623Gly) rs80356862
NM_007294.3(BRCA1):c.4873_4885delTATAATGCAATGG (p.Tyr1625Lysfs) rs397509201
NM_007294.3(BRCA1):c.4875T>A (p.Tyr1625Ter) rs886040251
NM_007294.3(BRCA1):c.4877del (p.Asn1626Metfs) rs886040252
NM_007294.3(BRCA1):c.4878dup (p.Ala1627Cysfs) rs886040253
NM_007294.3(BRCA1):c.4885delG (p.Glu1629Lysfs) rs886040254
NM_007294.3(BRCA1):c.4885dup (p.Glu1629Glyfs) rs886040254
NM_007294.3(BRCA1):c.4887_4893del (p.Glu1630Terfs) rs886040255
NM_007294.3(BRCA1):c.4888_4889delGA (p.Glu1630Lysfs) rs879255490
NM_007294.3(BRCA1):c.488delG (p.Arg163Lysfs) rs397509202
NM_007294.3(BRCA1):c.4891del (p.Ser1631Valfs) rs80357656
NM_007294.3(BRCA1):c.4891dupA (p.Ser1631Lysfs) rs80357656
NM_007294.3(BRCA1):c.4895_4896delTG (p.Val1632Glufs) rs886038037
NM_007294.3(BRCA1):c.4901_4919del19 (p.Arg1634Lysfs) rs1555580678
NM_007294.3(BRCA1):c.4903G>T (p.Glu1635Ter) rs200432771
NM_007294.3(BRCA1):c.4903delG (p.Glu1635Argfs) rs1555580697
NM_007294.3(BRCA1):c.4905_4906delGA (p.Lys1636Alafs) rs397509203
NM_007294.3(BRCA1):c.490delA (p.Thr164Leufs) rs863224512
NM_007294.3(BRCA1):c.4910delC (p.Pro1637Glnfs) rs397509204
NM_007294.3(BRCA1):c.4921del (p.Ala1641Leufs) rs886040257
NM_007294.3(BRCA1):c.4930G>T (p.Glu1644Ter) rs397509205
NM_007294.3(BRCA1):c.4932_4933dupAA (p.Arg1645Lysfs) rs80357833
NM_007294.3(BRCA1):c.4934_4935insAA (p.Val1646Argfs) rs1135401879
NM_007294.3(BRCA1):c.4935_4936insAA (p.Val1646Lysfs) rs1555580653
NM_007294.3(BRCA1):c.4936delG (p.Val1646Serfs) rs80357653
NM_007294.3(BRCA1):c.493_494delCT (p.Leu165Glufs) rs397509206
NM_007294.3(BRCA1):c.493delC (p.Leu165Terfs) rs80357551
NM_007294.3(BRCA1):c.4941delC (p.Asn1647Lysfs) rs80357905
NM_007294.3(BRCA1):c.4944_4945delAA (p.Arg1649Asnfs) rs80357655
NM_007294.3(BRCA1):c.4945_4947delAGAinsTTTT (p.Arg1649Phefs) rs397509207
NM_007294.3(BRCA1):c.4945delA (p.Arg1649Glufs) rs80357655
NM_007294.3(BRCA1):c.494dupT (p.Arg166Glufs) rs80357762
NM_007294.3(BRCA1):c.4963T>C (p.Ser1655Pro) rs1057518639
NM_007294.3(BRCA1):c.4964C>T (p.Ser1655Phe) rs80357390
NM_007294.3(BRCA1):c.4964_4979delCTGGCCTGACCCCAGA (p.Ser1655Terfs) rs397509209
NM_007294.3(BRCA1):c.4964_4982del19 (p.Ser1655Tyrfs) rs80359876
NM_007294.3(BRCA1):c.4966_4984del19 (p.Gly1656Leufs) rs80359884
NM_007294.3(BRCA1):c.4969delC (p.Leu1657Terfs) rs886038038
NM_007294.3(BRCA1):c.4972delA (p.Thr1658Profs) rs1060505044
NM_007294.3(BRCA1):c.4976del (p.Pro1659Glnfs) rs879255295
NM_007294.3(BRCA1):c.4981G>T (p.Glu1661Ter) rs80357401
NM_007294.3(BRCA1):c.4986+1G>A rs80358162
NM_007294.3(BRCA1):c.4986+1G>T rs80358162
NM_007294.3(BRCA1):c.4986+1_4986+2ins65
NM_007294.3(BRCA1):c.4986+2T>C rs397509210
NM_007294.3(BRCA1):c.4986+2_4986+3delTG rs1135401880
NM_007294.3(BRCA1):c.4986+3G>C rs80358023
NM_007294.3(BRCA1):c.4986+4A>C rs80358087
NM_007294.3(BRCA1):c.4986+4A>T rs80358087
NM_007294.3(BRCA1):c.4986+5G>A rs397509211
NM_007294.3(BRCA1):c.4986+5G>C rs397509211
NM_007294.3(BRCA1):c.4986+6T>C rs80358086
NM_007294.3(BRCA1):c.4986+6T>G rs80358086
NM_007294.3(BRCA1):c.4986dup (p.Met1663Tyrfs) rs1555580601
NM_007294.3(BRCA1):c.4987-1G=
NM_007294.3(BRCA1):c.4987-1G>A rs730881495
NM_007294.3(BRCA1):c.4987-1G>T rs730881495
NM_007294.3(BRCA1):c.4987-2341_5074+2676del
NM_007294.3(BRCA1):c.4987-2508_5074+84del
NM_007294.3(BRCA1):c.4987-2A>G rs397509212
NM_007294.3(BRCA1):c.4987-577_5074+343del
NM_007294.3(BRCA1):c.4987-5T>A rs397509214
NM_007294.3(BRCA1):c.4987-5T>C rs397509214
NM_007294.3(BRCA1):c.4987-?_5074+?del
NM_007294.3(BRCA1):c.4987-?_5152+?del
NM_007294.3(BRCA1):c.4987-?_5193+?del
NM_007294.3(BRCA1):c.4987-?_5277+?del
NM_007294.3(BRCA1):c.4987_5074del88 (p.Val1665Serfs) rs1555579598
NM_007294.3(BRCA1):c.4987delA (p.Met1663Cysfs) rs886040912
NM_007294.3(BRCA1):c.4995_5007dup (p.Arg1670Valfs) rs1555579747
NM_007294.3(BRCA1):c.4996_4997dupTA (p.Lys1667Thrfs) rs1555579782
NM_007294.3(BRCA1):c.4997dupA (p.Tyr1666Terfs) rs876658947
NM_007294.3(BRCA1):c.4998C>A (p.Tyr1666Ter) rs730882165
NM_007294.3(BRCA1):c.4999A>T (p.Lys1667Ter) rs80357204
NM_007294.3(BRCA1):c.5005delG (p.Ala1669Profs) rs80357938
NM_007294.3(BRCA1):c.5007_5008ins13 (p.?)
NM_007294.3(BRCA1):c.5007_5008insC (p.Arg1670Glnfs) rs1555579748
NM_007294.3(BRCA1):c.5008_5009insC (p.Arg1670Thrfs) rs1555579738
NM_007294.3(BRCA1):c.500_501del (p.Thr167Lysfs) rs886040258
NM_007294.3(BRCA1):c.5013dup (p.His1672Thrfs) rs886040259
NM_007294.3(BRCA1):c.5019del (p.His1673Glnfs) rs886040260
NM_007294.3(BRCA1):c.5021dup (p.Thr1675Hisfs) rs1555579721
NM_007294.3(BRCA1):c.5026_5027del (p.Leu1676Asnfs) rs397509217
NM_007294.3(BRCA1):c.5026_5036delTTAACTAATCT (p.Leu1676Asnfs) rs80357894
NM_007294.3(BRCA1):c.5027T>A (p.Leu1676Ter) rs786203754
NM_007294.3(BRCA1):c.5027T>G (p.Leu1676Ter) rs786203754
NM_007294.3(BRCA1):c.5027_5031delTAACT (p.Leu1676Terfs) rs431825410
NM_007294.3(BRCA1):c.5027del (p.Leu1676Terfs) rs397509217
NM_007294.3(BRCA1):c.5027dupT (p.Leu1676Phefs) rs397509217
NM_007294.3(BRCA1):c.502A>T (p.Lys168Ter) rs886040263
NM_007294.3(BRCA1):c.5030_5033delCTAA (p.Thr1677Ilefs) rs80357580
NM_007294.3(BRCA1):c.5030_5033dup (p.Leu1679Terfs) rs80357580
NM_007294.3(BRCA1):c.5033_5034ins4
NM_007294.3(BRCA1):c.5035_5039delCTAAT (p.Leu1679Tyrfs) rs80357623
NM_007294.3(BRCA1):c.5035delC (p.Leu1679Terfs) rs80357896
NM_007294.3(BRCA1):c.5038_5041dup (p.Thr1681Asnfs) rs1555579686
NM_007294.3(BRCA1):c.5039_5040delTT (p.Ile1680Asnfs) rs1135401935
NM_007294.3(BRCA1):c.5040delT (p.Thr1681Leufs) rs80357673
NM_007294.3(BRCA1):c.5041_5042insTTAA (p.Thr1681Ilefs) rs886040264
NM_007294.3(BRCA1):c.5042delC (p.Thr1681Metfs) rs886040265
NM_007294.3(BRCA1):c.5043_5044insTAAT (p.Glu1682Terfs) rs1555579675
NM_007294.3(BRCA1):c.5044_5048delGAAGAinsT (p.Glu1682Terfs) rs886040266
NM_007294.3(BRCA1):c.5047G>T (p.Glu1683Ter) rs80356879
NM_007294.3(BRCA1):c.5050_5051delAC (p.Thr1684Tyrfs) rs879255283
NM_007294.3(BRCA1):c.5051delC (p.Thr1684Ilefs) rs1135401881
NM_007294.3(BRCA1):c.5053A>G (p.Thr1685Ala) rs80356890
NM_007294.3(BRCA1):c.5054C>T (p.Thr1685Ile) rs80357043
NM_007294.3(BRCA1):c.5054_5057dupCTCA (p.Val1687Serfs) rs879254050
NM_007294.3(BRCA1):c.5056dupC (p.His1686Profs) rs80357974
NM_007294.3(BRCA1):c.5057A>G (p.His1686Arg) rs730882166
NM_007294.3(BRCA1):c.5058_5059insCAAC (p.Val1687Glnfs) rs886040267
NM_007294.3(BRCA1):c.5059_5060insCAAC (p.Val1687Alafs) rs1555579630
NM_007294.3(BRCA1):c.5059delG (p.Val1687Leufs) rs1555579633
NM_007294.3(BRCA1):c.505C>T (p.Gln169Ter) rs80357133
NM_007294.3(BRCA1):c.5062_5064delGTT (p.Val1688del) rs80358344
NM_007294.3(BRCA1):c.5065dup (p.Met1689Asnfs) rs886040268
NM_007294.3(BRCA1):c.5066T>G (p.Met1689Arg) rs80357061
NM_007294.3(BRCA1):c.5068A>T (p.Lys1690Ter) rs397507239
NM_007294.3(BRCA1):c.5071dupA (p.Thr1691Asnfs) rs80357672
NM_007294.3(BRCA1):c.5072C>T (p.Thr1691Ile) rs80357034
NM_007294.3(BRCA1):c.5073A>T (p.Thr1691=)
NM_007294.3(BRCA1):c.5074+1G>A rs80358053
NM_007294.3(BRCA1):c.5074+1G>C rs80358053
NM_007294.3(BRCA1):c.5074+1G>T rs80358053
NM_007294.3(BRCA1):c.5074+2T>C rs80358089
NM_007294.3(BRCA1):c.5074+3A>G rs80358181
NM_007294.3(BRCA1):c.5074G>A (p.Asp1692Asn) rs80187739
NM_007294.3(BRCA1):c.5074G>C (p.Asp1692His) rs80187739
NM_007294.3(BRCA1):c.5074G>T (p.Asp1692Tyr) rs80187739
NM_007294.3(BRCA1):c.5075-1G>A rs1800747
NM_007294.3(BRCA1):c.5075-1G>C rs1800747
NM_007294.3(BRCA1):c.5075-2A>C rs80358066
NM_007294.3(BRCA1):c.5075-2A>G rs80358066
NM_007294.3(BRCA1):c.5075-2A>T rs80358066
NM_007294.3(BRCA1):c.5075-2del rs886040913
NM_007294.3(BRCA1):c.5075-8T>G rs397509221
NM_007294.3(BRCA1):c.5075-?_5152+?del
NM_007294.3(BRCA1):c.5075-?_5193+?del
NM_007294.3(BRCA1):c.5075-?_5193+?dup
NM_007294.3(BRCA1):c.5075-?_5193+?dup119
NM_007294.3(BRCA1):c.5075-?_5277+?del
NM_007294.3(BRCA1):c.5075-?_5277+?dup203
NM_007294.3(BRCA1):c.5075_5078delATGC (p.Asp1692Valfs) rs397509223
NM_007294.3(BRCA1):c.5075_5152del78 (p.Asp1692_Trp1718delinsGly) rs1555578539
NM_007294.3(BRCA1):c.5076del (p.Asp1692Glufs) rs886040269
NM_007294.3(BRCA1):c.5077_5080delGCTGinsTTGATTCTGC (p.Ala1693_Glu1694delinsLeuIleLeuGln) rs397509224
NM_007294.3(BRCA1):c.5078_5080delCTG (p.Ala1693del) rs80358345
NM_007294.3(BRCA1):c.5080G>T (p.Glu1694Ter) rs80356896
NM_007294.3(BRCA1):c.5080delG (p.Glu1694Serfs) rs1555578650
NM_007294.3(BRCA1):c.5083_5084insG (p.Phe1695Cysfs) rs886040270
NM_007294.3(BRCA1):c.5084_5085delTT (p.Phe1695Cysfs) rs80357760
NM_007294.3(BRCA1):c.5084_5085insG (p.Phe1695Leufs) rs1555578648
NM_007294.3(BRCA1):c.5091_5092delTG (p.Cys1697Terfs) rs80357710
NM_007294.3(BRCA1):c.5091delT (p.Cys1697Trpfs) rs1135401882
NM_007294.3(BRCA1):c.5095C>T (p.Arg1699Trp) rs55770810
NM_007294.3(BRCA1):c.5096G>A (p.Arg1699Gln) rs41293459
NM_007294.3(BRCA1):c.5098delA (p.Thr1700Hisfs) rs483353099
NM_007294.3(BRCA1):c.5102_5103delTG (p.Leu1701Glnfs) rs80357608
NM_007294.3(BRCA1):c.5102delT (p.Leu1701Argfs) rs1555578613
NM_007294.3(BRCA1):c.5106delA (p.Lys1702Asnfs) rs80357553
NM_007294.3(BRCA1):c.5109T>G (p.Tyr1703Ter) rs80356974
NM_007294.3(BRCA1):c.510delG (p.Ile171Tyrfs) rs1060505052
NM_007294.3(BRCA1):c.5112delT (p.Leu1705Terfs) rs397509228
NM_007294.3(BRCA1):c.5114_5121del (p.Leu1705Argfs) rs886040271
NM_007294.3(BRCA1):c.5116G>A (p.Gly1706Arg) rs886040864
NM_007294.3(BRCA1):c.5117G>A (p.Gly1706Glu) rs80356860
NM_007294.3(BRCA1):c.5123C>A (p.Ala1708Glu) rs28897696
NM_007294.3(BRCA1):c.5123delC (p.Ala1708Glyfs) rs886038040
NM_007294.3(BRCA1):c.5126delG (p.Gly1709Glufs) rs80357874
NM_007294.3(BRCA1):c.5128G>T (p.Gly1710Ter) rs397509229
NM_007294.3(BRCA1):c.5129delG (p.Gly1710Glufs) rs1135401829
NM_007294.3(BRCA1):c.512dupT (p.Gln172Thrfs) rs587781487
NM_007294.3(BRCA1):c.5131A>T (p.Lys1711Ter) rs886040272
NM_007294.3(BRCA1):c.5133delA (p.Lys1711Asnfs) rs730880288
NM_007294.3(BRCA1):c.5133dupA (p.Trp1712Metfs) rs730880288
NM_007294.3(BRCA1):c.5135G>A (p.Trp1712Ter) rs876658672
NM_007294.3(BRCA1):c.5136G>A (p.Trp1712Ter) rs80357418
NM_007294.3(BRCA1):c.5137delG (p.Val1713Terfs) rs80357997
NM_007294.3(BRCA1):c.5137dup (p.Val1713Glyfs) rs80357997
NM_007294.3(BRCA1):c.5143A>C (p.Ser1715Arg) rs80357222
NM_007294.3(BRCA1):c.5145C>G (p.Ser1715Arg) rs80357094
NM_007294.3(BRCA1):c.5145delC (p.Tyr1716Ilefs) rs80357870
NM_007294.3(BRCA1):c.5147_5148insC (p.Trp1718Leufs) rs1135401883
NM_007294.3(BRCA1):c.5148T>A (p.Tyr1716Ter) rs397509230
NM_007294.3(BRCA1):c.5148T>G (p.Tyr1716Ter) rs397509230
NM_007294.3(BRCA1):c.5148_5149insC (p.Phe1717Leufs) rs1555578542
NM_007294.3(BRCA1):c.514C>T (p.Gln172Ter) rs80356947
NM_007294.3(BRCA1):c.514delC (p.Gln172Asnfs) rs80357872
NM_007294.3(BRCA1):c.5150delT (p.Phe1717Serfs) rs80357720
NM_007294.3(BRCA1):c.5152+1G>A rs80358094
NM_007294.3(BRCA1):c.5152+1G>C rs80358094
NM_007294.3(BRCA1):c.5152+1G>T rs80358094
NM_007294.3(BRCA1):c.5152+2T>A rs886040914
NM_007294.3(BRCA1):c.5152+2T>G
NM_007294.3(BRCA1):c.5152+2dupT rs397509231
NM_007294.3(BRCA1):c.5152+3A>C rs80358124
NM_007294.3(BRCA1):c.5152+3_5152+4insT rs273901744
NM_007294.3(BRCA1):c.5152+5G>A rs80358165
NM_007294.3(BRCA1):c.5153-1G>A rs80358137
NM_007294.3(BRCA1):c.5153-1G>C rs80358137
NM_007294.3(BRCA1):c.5153-2A>G rs786202545
NM_007294.3(BRCA1):c.5153-2delA rs273901746
NM_007294.3(BRCA1):c.5153-?_5193+?del
NM_007294.3(BRCA1):c.5153G>A (p.Trp1718Ter) rs41293461
NM_007294.3(BRCA1):c.5154G>A (p.Trp1718Ter) rs80357239
NM_007294.3(BRCA1):c.5155_5158dup (p.Thr1720Serfs) rs1555578402
NM_007294.3(BRCA1):c.5155_5159delGTGACinsAAA (p.Val1719Lysfs) rs1555578398
NM_007294.3(BRCA1):c.5155delG (p.Val1719Terfs) rs80357743
NM_007294.3(BRCA1):c.5155dup (p.Val1719Glyfs) rs80357743
NM_007294.3(BRCA1):c.5156_5157delTG (p.Val1719Aspfs) rs80357895
NM_007294.3(BRCA1):c.5156_5157insAATA (p.Thr1720Ilefs) rs1555578407
NM_007294.3(BRCA1):c.5156delT (p.Val1719Glyfs) rs1057517590
NM_007294.3(BRCA1):c.5161C>T (p.Gln1721Ter) rs878854957
NM_007294.3(BRCA1):c.5161_5165del (p.Gln1721Tyrfs) rs886040274
NM_007294.3(BRCA1):c.5162delA (p.Gln1721Argfs) rs397509233
NM_007294.3(BRCA1):c.5163_5164insC (p.Ser1722Leufs) rs886040275
NM_007294.3(BRCA1):c.5165C>T (p.Ser1722Phe) rs80357104
NM_007294.3(BRCA1):c.5165dup (p.Ile1723Tyrfs) rs1555578376
NM_007294.3(BRCA1):c.5167delAinsTTT (p.Ile1723Phefs) rs730882167
NM_007294.3(BRCA1):c.516delA (p.Gln172Hisfs) rs879254223
NM_007294.3(BRCA1):c.5172_5173insA (p.Glu1725Argfs) rs1555578360
NM_007294.3(BRCA1):c.5173G>T (p.Glu1725Ter) rs80357291
NM_007294.3(BRCA1):c.5176A>T (p.Arg1726Ter)
NM_007294.3(BRCA1):c.5176delA (p.Arg1726Glufs) rs876658478
NM_007294.3(BRCA1):c.5177_5178delGA (p.Arg1726Lysfs) rs80357730
NM_007294.3(BRCA1):c.5179A>T (p.Lys1727Ter) rs80357347
NM_007294.3(BRCA1):c.5179_5192delAAAATGCTGAATGA (p.Lys1727Alafs) rs397509234
NM_007294.3(BRCA1):c.5181_5182delAA (p.Lys1727Asnfs) rs34570933
NM_007294.3(BRCA1):c.5182delA (p.Met1728Cysfs) rs34570933
NM_007294.3(BRCA1):c.5182dup (p.Met1728Asnfs)
NM_007294.3(BRCA1):c.5186delT (p.Leu1729Argfs) rs398122692
NM_007294.3(BRCA1):c.518del (p.Pro173Leufs) rs886040276
NM_007294.3(BRCA1):c.5191G>T (p.Glu1731Ter) rs397507244
NM_007294.3(BRCA1):c.5193+1G>A rs80358004
NM_007294.3(BRCA1):c.5193+1G>C rs80358004
NM_007294.3(BRCA1):c.5193+1G>T rs80358004
NM_007294.3(BRCA1):c.5193+1delG rs397509236
NM_007294.3(BRCA1):c.5193+2T>G rs886040915
NM_007294.3(BRCA1):c.5193+2delT rs273901751
NM_007294.3(BRCA1):c.5193+3_5193+15del rs273901752
NM_007294.3(BRCA1):c.5194-10_5236dup rs1555576921
NM_007294.3(BRCA1):c.5194-12G>A rs80358079
NM_007294.3(BRCA1):c.5194-1699_5277+1996delins236
NM_007294.3(BRCA1):c.5194-1730_5277+1996delins268
NM_007294.3(BRCA1):c.5194-1G>A rs80358173
NM_007294.3(BRCA1):c.5194-1G>C rs80358173
NM_007294.3(BRCA1):c.5194-1G>T rs80358173
NM_007294.3(BRCA1):c.5194-1_5197delinsTATT rs1555576990
NM_007294.3(BRCA1):c.5194-2A>G rs80358069
NM_007294.3(BRCA1):c.5194-452_5277+3638del
NM_007294.3(BRCA1):c.5194-5858_5277+2206del
NM_007294.3(BRCA1):c.5194-?_5277+?del
NM_007294.3(BRCA1):c.5194-?_5277+?delinsG
NM_007294.3(BRCA1):c.5194-?_5277+?dup
NM_007294.3(BRCA1):c.519delT (p.Gln174Lysfs) rs886037784
NM_007294.3(BRCA1):c.51delT (p.Met18Cysfs) rs886037967
NM_007294.3(BRCA1):c.5200_5201insC (p.Phe1734Serfs) rs1135401936
NM_007294.3(BRCA1):c.5201_5202insC (p.Glu1735Terfs) rs1555576982
NM_007294.3(BRCA1):c.5202delT (p.Phe1734Leufs) rs876659867
NM_007294.3(BRCA1):c.5205delA (p.Val1736Serfs) rs587781258
NM_007294.3(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.3(BRCA1):c.5207delT (p.Val1736Alafs) rs397509239
NM_007294.3(BRCA1):c.5208_5247del40insTC (p.Arg1737Glnfs) rs886040277
NM_007294.3(BRCA1):c.5209A>T (p.Arg1737Ter) rs80357496
NM_007294.3(BRCA1):c.5209_5210insC (p.Arg1737Thrfs) rs1555576968
NM_007294.3(BRCA1):c.5209_5248del40insTC (p.Arg1737Serfs) rs273901753
NM_007294.3(BRCA1):c.5209dup (p.Arg1737Lysfs) rs886040278
NM_007294.3(BRCA1):c.520C>T (p.Gln174Ter)
NM_007294.3(BRCA1):c.520delC (p.Gln174Lysfs) rs80357639
NM_007294.3(BRCA1):c.5210_5211insC (p.Arg1737Serfs) rs1555576964
NM_007294.3(BRCA1):c.5211_5212delAG (p.Gly1738Argfs) rs1555576959
NM_007294.3(BRCA1):c.5212G>A (p.Gly1738Arg) rs80356937
NM_007294.3(BRCA1):c.5212G>T (p.Gly1738Ter) rs80356937
NM_007294.3(BRCA1):c.5213G>A (p.Gly1738Glu) rs80357450
NM_007294.3(BRCA1):c.5213del (p.Gly1738Glufs) rs886040279
NM_007294.3(BRCA1):c.5215_5216delGA (p.Asp1739Cysfs) rs1064794467
NM_007294.3(BRCA1):c.5216A>T (p.Asp1739Val) rs80357227
NM_007294.3(BRCA1):c.5221_5224del (p.Val1741Metfs) rs886040280
NM_007294.3(BRCA1):c.5229_5230delAA (p.Arg1744Lysfs) rs80357852
NM_007294.3(BRCA1):c.5230_5237del (p.Arg1744Profs) rs886040281
NM_007294.3(BRCA1):c.5230delA (p.Arg1744Glufs) rs397509240
NM_007294.3(BRCA1):c.5231delG (p.Arg1744Lysfs) rs397509241
NM_007294.3(BRCA1):c.5232_5238delAAACCACins12 (p.?)
NM_007294.3(BRCA1):c.5232_5238delAAACCACinsGTCCAAAGCGAG (p.Asn1745Serfs) rs483353071
NM_007294.3(BRCA1):c.5234dupA (p.Asn1745Lysfs) rs886038042
NM_007294.3(BRCA1):c.5236delC (p.His1746Thrfs) rs876659483
NM_007294.3(BRCA1):c.5237delA (p.His1746Profs) rs1555576907
NM_007294.3(BRCA1):c.5239C>T (p.Gln1747Ter) rs80357367
NM_007294.3(BRCA1):c.5239delC (p.Gln1747Lysfs) rs886040282
NM_007294.3(BRCA1):c.5239dup (p.Gln1747Profs) rs886040282
NM_007294.3(BRCA1):c.5241delA (p.Gly1748Valfs) rs80357791
NM_007294.3(BRCA1):c.5243delG (p.Gly1748Valfs) rs80357676
NM_007294.3(BRCA1):c.5246C>G (p.Pro1749Arg) rs80357462
NM_007294.3(BRCA1):c.5247_5248insTC (p.Lys1750Serfs) rs1555576878
NM_007294.3(BRCA1):c.5248_5249insTC (p.Lys1750Ilefs) rs1555576871
NM_007294.3(BRCA1):c.5249delA (p.Lys1750Serfs) rs879253993
NM_007294.3(BRCA1):c.5249dup (p.Arg1751Alafs) rs879253993
NM_007294.3(BRCA1):c.5250delG (p.Lys1750Asnfs) rs1555576868
NM_007294.3(BRCA1):c.5251C>T (p.Arg1751Ter) rs80357123
NM_007294.3(BRCA1):c.5257dupA (p.Arg1753Lysfs) rs397509245
NM_007294.3(BRCA1):c.5259delA (p.Glu1754Asnfs) rs80357925
NM_007294.3(BRCA1):c.5260G>T (p.Glu1754Ter) rs80357432
NM_007294.3(BRCA1):c.5266C>T (p.Gln1756Ter) rs397509247
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs397507247
NM_007294.3(BRCA1):c.5267_5268insC (p.Gln1756Hisfs) rs886040284
NM_007294.3(BRCA1):c.5268_5269insC (p.Asp1757Argfs) rs431825414
NM_007294.3(BRCA1):c.5268_5274delGGACAGA (p.Asp1757Argfs) rs886038043
NM_007294.3(BRCA1):c.5269_5270insC (p.Asp1757Alafs) rs1555576840
NM_007294.3(BRCA1):c.5269_5273delGACAG (p.Asp1757Lysfs) rs786202040
NM_007294.3(BRCA1):c.5270_5276delACAGAAA (p.Asp1757Glyfs) rs397509248
NM_007294.3(BRCA1):c.5271_5277del (p.Asp1757Glufs)
NM_007294.3(BRCA1):c.5276delA (p.Lys1759Argfs) rs80357732
NM_007294.3(BRCA1):c.5277+1G>A rs80358150
NM_007294.3(BRCA1):c.5277+1_5277+6del
NM_007294.3(BRCA1):c.5277+1delG rs273901754
NM_007294.3(BRCA1):c.5277+833_5277+1671delins141
NM_007294.3(BRCA1):c.5277G>A (p.Lys1759=) rs80356854
NM_007294.3(BRCA1):c.5278-1G>A rs80358099
NM_007294.3(BRCA1):c.5278-1G>C rs80358099
NM_007294.3(BRCA1):c.5278-1G>T rs80358099
NM_007294.3(BRCA1):c.5278-2A>G rs397509253
NM_007294.3(BRCA1):c.5278-2del rs878853285
NM_007294.3(BRCA1):c.5278-?_5332+?del
NM_007294.3(BRCA1):c.5278-?_5406+?del
NM_007294.3(BRCA1):c.5278-?_5406+?dup
NM_007294.3(BRCA1):c.5278-?_5467+?del
NM_007294.3(BRCA1):c.5278-?_5467+?dup
NM_007294.3(BRCA1):c.5279_5332del54 (p.Ile1760_Asp1778delinsAsn) rs1555575677
NM_007294.3(BRCA1):c.5282del (p.Phe1761Serfs) rs886040285
NM_007294.3(BRCA1):c.5284delA (p.Arg1762Glyfs) rs80357684
NM_007294.3(BRCA1):c.5289delG (p.Leu1764Terfs) rs80357886
NM_007294.3(BRCA1):c.5289dupG (p.Leu1764Alafs) rs80357886
NM_007294.3(BRCA1):c.5291T>C (p.Leu1764Pro) rs80357281
NM_007294.3(BRCA1):c.5293G>T (p.Glu1765Ter) rs397509256
NM_007294.3(BRCA1):c.5296dup (p.Ile1766Asnfs) rs1555575732
NM_007294.3(BRCA1):c.5297T>A (p.Ile1766Asn) rs80357463
NM_007294.3(BRCA1):c.5297T>G (p.Ile1766Ser) rs80357463
NM_007294.3(BRCA1):c.5299del (p.Cys1767Valfs) rs886040286
NM_007294.3(BRCA1):c.529delT (p.Ser177Leufs) rs80357758
NM_007294.3(BRCA1):c.5300_5301del (p.Cys1767Leufs) rs886040287
NM_007294.3(BRCA1):c.5301T>A (p.Cys1767Ter) rs886040288
NM_007294.3(BRCA1):c.5302delT (p.Cys1768Alafs) rs886040289
NM_007294.3(BRCA1):c.5304delC (p.Tyr1769Metfs) rs80357959
NM_007294.3(BRCA1):c.5307T>A (p.Tyr1769Ter) rs397509258
NM_007294.3(BRCA1):c.5310_5311delGC (p.Pro1771Leufs) rs587781825
NM_007294.3(BRCA1):c.5310delG (p.Phe1772Serfs) rs80357581
NM_007294.3(BRCA1):c.5310dupG (p.Pro1771Alafs) rs80357581
NM_007294.3(BRCA1):c.5311_5332+1del rs886040916
NM_007294.3(BRCA1):c.5315delT (p.Phe1772Serfs) rs397509261
NM_007294.3(BRCA1):c.5319dupC (p.Asn1774Glnfs) rs80357823
NM_007294.3(BRCA1):c.531del (p.Val178Serfs) rs886040290
NM_007294.3(BRCA1):c.531dupT (p.Val178Cysfs) rs864622350
NM_007294.3(BRCA1):c.5320_5321delAA (p.Asn1774Hisfs) rs80357818
NM_007294.3(BRCA1):c.5323_5324delAT (p.Met1775Alafs) rs397509262
NM_007294.3(BRCA1):c.5324T>A (p.Met1775Lys) rs41293463
NM_007294.3(BRCA1):c.5324T>G (p.Met1775Arg) rs41293463
NM_007294.3(BRCA1):c.5328delC (p.Thr1777Glnfs) rs80357751
NM_007294.3(BRCA1):c.5328dupC (p.Thr1777Hisfs) rs80357751
NM_007294.3(BRCA1):c.5331_5332+1delinsCAACAT rs878853286
NM_007294.3(BRCA1):c.5331_5332+6delinsCAACAT rs886040917
NM_007294.3(BRCA1):c.5332+1G>A rs80358041
NM_007294.3(BRCA1):c.5332+1G>C rs80358041
NM_007294.3(BRCA1):c.5332+1G>T rs80358041
NM_007294.3(BRCA1):c.5332+2T>A rs80358182
NM_007294.3(BRCA1):c.5332+2T>C rs80358182
NM_007294.3(BRCA1):c.5332+2T>G rs80358182
NM_007294.3(BRCA1):c.5332G>A (p.Asp1778Asn) rs80357112
NM_007294.3(BRCA1):c.5333-198_5387del rs1555575109
NM_007294.3(BRCA1):c.5333-1G>A rs80358126
NM_007294.3(BRCA1):c.5333-1G>C rs80358126
NM_007294.3(BRCA1):c.5333-1G>T rs80358126
NM_007294.3(BRCA1):c.5333-2A>C rs397509264
NM_007294.3(BRCA1):c.5333-36_5333-22del rs1555575231
NM_007294.3(BRCA1):c.5333-36_5406+400del rs1555574977
NM_007294.3(BRCA1):c.5333-3T>G rs397509265
NM_007294.3(BRCA1):c.5333-?_5406+?del
NM_007294.3(BRCA1):c.5335C>T (p.Gln1779Ter) rs397509267
NM_007294.3(BRCA1):c.5335delC (p.Gln1779Asnfs) rs80357590
NM_007294.3(BRCA1):c.5338delC (p.Leu1780Trpfs) rs886038045
NM_007294.3(BRCA1):c.5339T>C (p.Leu1780Pro) rs80357474
NM_007294.3(BRCA1):c.5341G>T (p.Glu1781Ter) rs397509268
NM_007294.3(BRCA1):c.5341_5343delGAAinsTG (p.Glu1781Cysfs) rs886040291
NM_007294.3(BRCA1):c.5341delG (p.Glu1781Asnfs) rs80357694
NM_007294.3(BRCA1):c.5345G>A (p.Trp1782Ter) rs80357219
NM_007294.3(BRCA1):c.5346G>A (p.Trp1782Ter) rs80357284
NM_007294.3(BRCA1):c.5348del (p.Met1783Argfs) rs886040292
NM_007294.3(BRCA1):c.5352dupA (p.Gln1785Thrfs) rs80357744
NM_007294.3(BRCA1):c.5353C>T (p.Gln1785Ter) rs80356969
NM_007294.3(BRCA1):c.5353_5354dup (p.Gln1785Hisfs) rs886040293
NM_007294.3(BRCA1):c.5359T>A (p.Cys1787Ser) rs80357065
NM_007294.3(BRCA1):c.5359_5363delTGTGGinsAGTGA (p.Cys1787_Gly1788delinsSerAsp) rs786203663
NM_007294.3(BRCA1):c.5360_5361delGTinsAG (p.Cys1787Ter) rs397509270
NM_007294.3(BRCA1):c.5361_5362delTG (p.Cys1787Trpfs) rs886040294
NM_007294.3(BRCA1):c.5363G>A (p.Gly1788Asp) rs80357069
NM_007294.3(BRCA1):c.5363G>T (p.Gly1788Val) rs80357069
NM_007294.3(BRCA1):c.5365_5366delGCinsA (p.Ala1789Ilefs) rs1555575142
NM_007294.3(BRCA1):c.5366delC (p.Ala1789Valfs) rs760188581
NM_007294.3(BRCA1):c.5368delT (p.Ser1790Leufs) rs879254116
NM_007294.3(BRCA1):c.5369_5385delCTGTGGTGAAGGAGCTT (p.Ser1790Phefs) rs397509272
NM_007294.3(BRCA1):c.536_547+165del rs1555594718
NM_007294.3(BRCA1):c.536delA (p.Tyr179Serfs) rs397509273
NM_007294.3(BRCA1):c.5370_5397delTGTGGTGAAGGAGCTTTCATCATTCACC (p.Val1791Leufs) rs80359878
NM_007294.3(BRCA1):c.5377A>T (p.Lys1793Ter) rs397509274
NM_007294.3(BRCA1):c.5380G>T (p.Glu1794Ter) rs776323117
NM_007294.3(BRCA1):c.5386delT (p.Ser1796Hisfs) rs80357838
NM_007294.3(BRCA1):c.5386dupT (p.Ser1796Phefs) rs80357838
NM_007294.3(BRCA1):c.5387C>A (p.Ser1796Ter) rs80357055
NM_007294.3(BRCA1):c.5389dup (p.Ser1797Phefs) rs886040295
NM_007294.3(BRCA1):c.5390C>A (p.Ser1797Ter) rs879255492
NM_007294.3(BRCA1):c.5390C>G (p.Ser1797Ter) rs879255492
NM_007294.3(BRCA1):c.5391delA (p.Phe1798Serfs) rs774988515
NM_007294.3(BRCA1):c.5398delC (p.Gly1801Alafs) rs1064794662
NM_007294.3(BRCA1):c.5406+1G>A rs80358028
NM_007294.3(BRCA1):c.5406+1_5406+3delGTA rs397509277
NM_007294.3(BRCA1):c.5406+2del rs273901765
NM_007294.3(BRCA1):c.5406+3A>T rs397509278
NM_007294.3(BRCA1):c.5406+4A>G rs397509279
NM_007294.3(BRCA1):c.5406+4_5406+7delAGTA rs1555575073
NM_007294.3(BRCA1):c.5406+5G>A rs80358073
NM_007294.3(BRCA1):c.5406+5G>C rs80358073
NM_007294.3(BRCA1):c.5406+5G>T rs80358073
NM_007294.3(BRCA1):c.5407-1G>A rs80358029
NM_007294.3(BRCA1):c.5407-1G>C rs80358029
NM_007294.3(BRCA1):c.5407-2A>G rs80358002
NM_007294.3(BRCA1):c.5407-2A>T rs80358002
NM_007294.3(BRCA1):c.5407-?_*(1_?)del
NM_007294.3(BRCA1):c.5407-?_5467+?del
NM_007294.3(BRCA1):c.5407-?_5467+?dup
NM_007294.3(BRCA1):c.5407_5414delGGTGTCCA (p.Gly1803Profs) rs886040865
NM_007294.3(BRCA1):c.5417delC (p.Pro1806Glnfs) rs80357558
NM_007294.3(BRCA1):c.5419delA (p.Ile1807Leufs) rs80357934
NM_007294.3(BRCA1):c.5419dup (p.Ile1807Asnfs) rs80357934
NM_007294.3(BRCA1):c.541G>T (p.Glu181Ter) rs1131692162
NM_007294.3(BRCA1):c.5427dup (p.Val1810Cysfs) rs1555574739
NM_007294.3(BRCA1):c.5429_5430insGA (p.Gln1811Serfs) rs1135401887
NM_007294.3(BRCA1):c.5430_5431insGA (p.Gln1811Aspfs) rs1555574722
NM_007294.3(BRCA1):c.5431C>T (p.Gln1811Ter) rs397509283
NM_007294.3(BRCA1):c.5434C>G (p.Pro1812Ala) rs1800751
NM_007294.3(BRCA1):c.5440delG (p.Ala1814Profs) rs80357946
NM_007294.3(BRCA1):c.5444G>A (p.Trp1815Ter) rs80356962
NM_007294.3(BRCA1):c.5445G>A (p.Trp1815Ter) rs397509284
NM_007294.3(BRCA1):c.5449G>T (p.Glu1817Ter) rs80356868
NM_007294.3(BRCA1):c.5450_5451delAG (p.Glu1817Glyfs) rs397509286
NM_007294.3(BRCA1):c.5453A>G (p.Asp1818Gly) rs80357477
NM_007294.3(BRCA1):c.5463_5464insT (p.His1822Serfs) rs1057518636
NM_007294.3(BRCA1):c.5464_5465insT (p.His1822Leufs) rs273902769
NM_007294.3(BRCA1):c.5466dup (p.Ala1823Cysfs) rs1555574698
NM_007294.3(BRCA1):c.5467+1G>A rs80358145
NM_007294.3(BRCA1):c.5467+1del rs886040918
NM_007294.3(BRCA1):c.5467+2T>C rs80358009
NM_007294.3(BRCA1):c.5467+2T>G rs80358009
NM_007294.3(BRCA1):c.5467G>A (p.Ala1823Thr) rs80357212
NM_007294.3(BRCA1):c.5468-11_5520dup rs1555574411
NM_007294.3(BRCA1):c.5468-1G>A rs80358048
NM_007294.3(BRCA1):c.5468-285_*4016delinsCA
NM_007294.3(BRCA1):c.5468-2A>G rs398122699
NM_007294.3(BRCA1):c.5468-2A>T rs398122699
NM_007294.3(BRCA1):c.5468-40T>A rs80358151
NM_007294.3(BRCA1):c.547+1G>A rs80358030
NM_007294.3(BRCA1):c.547+1G>T rs80358030
NM_007294.3(BRCA1):c.547+2T>A rs80358047
NM_007294.3(BRCA1):c.547+3A>T rs886040919
NM_007294.3(BRCA1):c.5470_5477delATTGGGCA (p.Ile1824Aspfs) rs80357973
NM_007294.3(BRCA1):c.5474_5481delGGCAGATG (p.Gly1825Valfs) rs730881441
NM_007294.3(BRCA1):c.5479_5480insGA (p.Met1827Argfs) rs80357757
NM_007294.3(BRCA1):c.548-?_4185+?del
NM_007294.3(BRCA1):c.548-?_5193+?del
NM_007294.3(BRCA1):c.548-?_593+?dup
NM_007294.3(BRCA1):c.5483delG (p.Cys1828Leufs) rs397509288
NM_007294.3(BRCA1):c.5484_5485delTG (p.Cys1828Terfs) rs886038046
NM_007294.3(BRCA1):c.5485dupG (p.Glu1829Glyfs) rs768401297
NM_007294.3(BRCA1):c.5486_5510del (p.Glu1829Glyfs) rs886040297
NM_007294.3(BRCA1):c.5490delA (p.Pro1831Leufs) rs80357976
NM_007294.3(BRCA1):c.5492delC (p.Pro1831Leufs) rs80357582
NM_007294.3(BRCA1):c.5493_5494insTT (p.Val1832Leufs) rs886040298
NM_007294.3(BRCA1):c.5495_5496insTT (p.Val1833Trpfs) rs1555574436
NM_007294.3(BRCA1):c.5496_5499delGGTG (p.Val1833Profs) rs878853296
NM_007294.3(BRCA1):c.5496_5506delGGTGACCCGAGinsA (p.Val1833Serfs) rs273902775
NM_007294.3(BRCA1):c.5497G>A (p.Val1833Met) rs80357268
NM_007294.3(BRCA1):c.5497_5506delGTGACCCGAG (p.Val1833Serfs) rs273902775
NM_007294.3(BRCA1):c.5498_5511delTGACCCGAGAGTGG (p.Val1833Glyfs) rs80359873
NM_007294.3(BRCA1):c.5502_5503dup (p.Arg1835Profs) rs397509291
NM_007294.3(BRCA1):c.5503C>T (p.Arg1835Ter) rs41293465
NM_007294.3(BRCA1):c.5503_5506del (p.Arg1835Serfs) rs886040300
NM_007294.3(BRCA1):c.5503_5564del62 (p.Arg1835Thrfs) rs80359883
NM_007294.3(BRCA1):c.5503delC (p.Arg1835Glufs) rs397509291
NM_007294.3(BRCA1):c.5503dupC (p.Arg1835Profs) rs397509291
NM_007294.3(BRCA1):c.5506G>T (p.Glu1836Ter) rs80356942
NM_007294.3(BRCA1):c.5509_5510delTG (p.Trp1837Glyfs) rs1135401888
NM_007294.3(BRCA1):c.5510G>A (p.Trp1837Ter) rs80357307
NM_007294.3(BRCA1):c.5511G>A (p.Trp1837Ter) rs80356914
NM_007294.3(BRCA1):c.5512delG (p.Val1838Cysfs) rs80357839
NM_007294.3(BRCA1):c.5513T>A (p.Val1838Glu) rs80357107
NM_007294.3(BRCA1):c.5518delG (p.Asp1840Thrfs) rs1555574414
NM_007294.3(BRCA1):c.5521delA (p.Ser1841Valfs) rs80357721
NM_007294.3(BRCA1):c.5524_5531delGTAGCACT (p.Val1842Leufs) rs879255287
NM_007294.3(BRCA1):c.5525delT (p.Val1842Glufs) rs864622220
NM_007294.3(BRCA1):c.5532_5533delCT (p.Tyr1845Profs) rs1064793059
NM_007294.3(BRCA1):c.5533_5534insG (p.Tyr1845Terfs) rs1555574384
NM_007294.3(BRCA1):c.5533dupT (p.Tyr1845Leufs) rs397509294
NM_007294.3(BRCA1):c.5534_5539delACCAGTins20 (p.?)
NM_007294.3(BRCA1):c.5534delA (p.Tyr1845Serfs) rs1060505048
NM_007294.3(BRCA1):c.5535C>A (p.Tyr1845Ter) rs80356977
NM_007294.3(BRCA1):c.5535C>G (p.Tyr1845Ter) rs80356977
NM_007294.3(BRCA1):c.5536C>T (p.Gln1846Ter) rs80356873
NM_007294.3(BRCA1):c.5536del (p.Gln1846Serfs) rs886040301
NM_007294.3(BRCA1):c.5537_5556del (p.Gln1846Leufs) rs886040302
NM_007294.3(BRCA1):c.5541C>A (p.Cys1847Ter) rs397509295
NM_007294.3(BRCA1):c.5542C>T (p.Gln1848Ter) rs886040303
NM_007294.3(BRCA1):c.5548delC (p.Leu1850Trpfs) rs397509296
NM_007294.3(BRCA1):c.5551del (p.Asp1851Thrfs) rs886040304
NM_007294.3(BRCA1):c.5553dupC (p.Thr1852Hisfs) rs397509297
NM_007294.3(BRCA1):c.5556_5560del (p.Tyr1853Aspfs) rs886040305
NM_007294.3(BRCA1):c.5558dupA (p.Tyr1853Terfs) rs80357629
NM_007294.3(BRCA1):c.5559C>A (p.Tyr1853Ter) rs80357336
NM_007294.3(BRCA1):c.5559C>G (p.Tyr1853Ter) rs80357336
NM_007294.3(BRCA1):c.5560del (p.Leu1854Terfs) rs886040306
NM_007294.3(BRCA1):c.5563delAins6
NM_007294.3(BRCA1):c.55C>T (p.Gln19Ter) rs397509299
NM_007294.3(BRCA1):c.569_570insAACG (p.Val191Thrfs) rs397509300
NM_007294.3(BRCA1):c.594-2A>C rs80358033
NM_007294.3(BRCA1):c.594-?_4484+?del
NM_007294.3(BRCA1):c.594_597delTGTG (p.Ser198Argfs) rs797045175
NM_007294.3(BRCA1):c.615dup (p.Gln206Thrfs)
NM_007294.3(BRCA1):c.616C>T (p.Gln206Ter) rs397509301
NM_007294.3(BRCA1):c.61delA (p.Ile21Serfs) rs273902778
NM_007294.3(BRCA1):c.624_625insAGGGATGAAATCAGGAACCA (p.Pro209Argfs)
NM_007294.3(BRCA1):c.625_626ins20 (p.?)
NM_007294.3(BRCA1):c.626del (p.Pro209Leufs) rs886040920
NM_007294.3(BRCA1):c.628C>T (p.Gln210Ter) rs879255495
NM_007294.3(BRCA1):c.62_65del (p.Ile21Lysfs) rs886040307
NM_007294.3(BRCA1):c.62dupT (p.Glu23Argfs) rs397509303
NM_007294.3(BRCA1):c.640del (p.Asp214Metfs) rs886040921
NM_007294.3(BRCA1):c.649delA (p.Ser217Valfs) rs878854963
NM_007294.3(BRCA1):c.64_65delTT (p.Leu22Argfs) rs397509304
NM_007294.3(BRCA1):c.64_65dupTT (p.Leu22Phefs) rs80357642
NM_007294.3(BRCA1):c.65T>A (p.Leu22Ter) rs80357438
NM_007294.3(BRCA1):c.65T>C (p.Leu22Ser) rs80357438
NM_007294.3(BRCA1):c.65_66insTA (p.Leu22Phefs)
NM_007294.3(BRCA1):c.65delT (p.Leu22Terfs) rs80357642
NM_007294.3(BRCA1):c.667_668delAA (p.Lys223Glyfs) rs80357537
NM_007294.3(BRCA1):c.668delA (p.Lys223Argfs) rs80357537
NM_007294.3(BRCA1):c.668dupA (p.Ala224Glyfs) rs80357537
NM_007294.3(BRCA1):c.66dupA (p.Glu23Argfs) rs80357783
NM_007294.3(BRCA1):c.670+1G>T rs398122706
NM_007294.3(BRCA1):c.670+1delG rs886040922
NM_007294.3(BRCA1):c.671-1G>A rs80358020
NM_007294.3(BRCA1):c.671-1G>T rs80358020
NM_007294.3(BRCA1):c.671-215_901del rs1555592870
NM_007294.3(BRCA1):c.671-26_1781del
NM_007294.3(BRCA1):c.671-2A>C rs80358108
NM_007294.3(BRCA1):c.671-2A>G rs80358108
NM_007294.3(BRCA1):c.671-2A>T rs80358108
NM_007294.3(BRCA1):c.671-?_4185+?del
NM_007294.3(BRCA1):c.671-?_4484+?del
NM_007294.3(BRCA1):c.671-?_4675+?del
NM_007294.3(BRCA1):c.676delT (p.Cys226Valfs) rs80357941
NM_007294.3(BRCA1):c.678T>A (p.Cys226Ter) rs397509308
NM_007294.3(BRCA1):c.678_679insC (p.Glu227Argfs) rs1555593321
NM_007294.3(BRCA1):c.679G>T (p.Glu227Ter) rs879255319
NM_007294.3(BRCA1):c.67_68insC (p.Glu23Alafs) rs1555600897
NM_007294.3(BRCA1):c.685delT (p.Ser229Leufs) rs80357824
NM_007294.3(BRCA1):c.688G>T (p.Glu230Ter) rs1555593310
NM_007294.3(BRCA1):c.689_692delAGAC (p.Glu230Glyfs) rs886040308
NM_007294.3(BRCA1):c.68_69delAG (p.Glu23Valfs) rs386833395
NM_007294.3(BRCA1):c.68_69dupAG (p.Cys24Serfs) rs80357914
NM_007294.3(BRCA1):c.68_70delAGT (p.Glu23_Cys24delinsGly) rs1555600876
NM_007294.3(BRCA1):c.68del (p.Glu23Glyfs) rs886040309
NM_007294.3(BRCA1):c.68dupA (p.Cys24Valfs) rs397509309
NM_007294.3(BRCA1):c.695dup (p.Asp232Glufs) rs1555593302
NM_007294.3(BRCA1):c.697_698delGT (p.Val233Asnfs) rs80357747
NM_007294.3(BRCA1):c.697_699delGTA (p.Val233del) rs1555593294
NM_007294.3(BRCA1):c.697delG (p.Val233Terfs) rs1555593298
NM_007294.3(BRCA1):c.69dup (p.Cys24Valfs) rs1555600893
NM_007294.3(BRCA1):c.700_704delACAAA (p.Thr234Tyrfs) rs1135401837
NM_007294.3(BRCA1):c.704del (p.Asn235Ilefs) rs886040310
NM_007294.3(BRCA1):c.706dup (p.Thr236Asnfs) rs1555593279
NM_007294.3(BRCA1):c.707del (p.Thr236Metfs) rs886040311
NM_007294.3(BRCA1):c.70T>C (p.Cys24Arg) rs80357410
NM_007294.3(BRCA1):c.70_71insA (p.Cys24Terfs) rs80357536
NM_007294.3(BRCA1):c.70_71insTGTC (p.Cys24Leufs) rs80357536
NM_007294.3(BRCA1):c.70_73dupTGTC (p.Pro25Leufs) rs397509310
NM_007294.3(BRCA1):c.70_80delTGTCCCATCTG (p.Cys24Serfs) rs80357696
NM_007294.3(BRCA1):c.715delC (p.His239Ilefs) rs879255294
NM_007294.3(BRCA1):c.718C>T (p.Gln240Ter) rs886040313
NM_007294.3(BRCA1):c.71_72del (p.Cys24Serfs) rs886040312
NM_007294.3(BRCA1):c.71_72insA (p.Cys24Terfs) rs1555600873
NM_007294.3(BRCA1):c.729_730insGTAACAAATACTGAACATCATCAACCCAGTA (p.Asn244Valfs) rs886040314
NM_007294.3(BRCA1):c.72_73delTC (p.Pro25Hisfs) rs397509311
NM_007294.3(BRCA1):c.72_73insGTCT (p.Pro25Valfs) rs1555600872
NM_007294.3(BRCA1):c.730_731insGTAACAAATACTGAACATCATCAACCCAGTA (p.Asn244Serfs) rs1555593246
NM_007294.3(BRCA1):c.731delA (p.Asn244Metfs)