ClinVar Miner

List of variants in gene BRCA1 reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2058
Download table as spreadsheet
HGVS dbSNP
NC_000017.11:g.(?_43044295)_(43045802_?)del
NC_000017.11:g.(?_43044295)_(43057135_?)del
NC_000017.11:g.(?_43044295)_(43099880_?)del
NC_000017.11:g.(?_43045658)_(43045822_?)del
NC_000017.11:g.(?_43045658)_(43047723_?)del
NC_000017.11:g.(?_43045658)_(43047723_?)dup
NC_000017.11:g.(?_43045658)_(43051137_?)del
NC_000017.11:g.(?_43045672)_(43047709_?)del
NC_000017.11:g.(?_43045672)_(43106539_?)del
NC_000017.11:g.(?_43045672)_(43115785_?)del
NC_000017.11:g.(?_43045672)_(43115785_?)dup
NC_000017.11:g.(?_43045678)_(43051117_?)del
NC_000017.11:g.(?_43047637)_(43099886_?)del
NC_000017.11:g.(?_43051057)_(43051123_?)del
NC_000017.11:g.(?_43057032)_(43057155_?)del
NC_000017.11:g.(?_43057032)_(43063971_?)dup
NC_000017.11:g.(?_43057046)_(43057141_?)del
NC_000017.11:g.(?_43057046)_(43057141_?)dup
NC_000017.11:g.(?_43057046)_(43074527_?)del
NC_000017.11:g.(?_43063313)_(43063971_?)dup
NC_000017.11:g.(?_43063327)_(43063379_?)del
NC_000017.11:g.(?_43067588)_(43076634_?)dup
NC_000017.11:g.(?_43067602)_(43076620_?)dup
NC_000017.11:g.(?_43070922)_(43076620_?)del
NC_000017.11:g.(?_43074325)_(43094866_?)del
NC_000017.11:g.(?_43074325)_(43115785_?)del
NC_000017.11:g.(?_43076488)_(43082575_?)dup
NC_000017.11:g.(?_43082384)_(43082595_?)del
NC_000017.11:g.(?_43082384)_(43082595_?)dup
NC_000017.11:g.(?_43082384)_(43106553_?)dup
NC_000017.11:g.(?_43082398)_(43106539_?)dup
NC_000017.11:g.(?_43090924)_(43106553_?)del
NC_000017.11:g.(?_43090938)_(43106539_?)del
NC_000017.11:g.(?_43095840)_(43106539_?)del
NC_000017.11:g.(?_43097238)_(43106539_?)dup
NC_000017.11:g.(?_43104116)_(43115785_?)del
NC_000017.11:g.(?_43106450)_(43106539_?)del
NC_000017.11:g.(?_43106450)_(43106539_?)dup
NC_000017.11:g.(?_43115720)_(43115785_?)dup
NG_005905.2:g.123838_133133del9296
NM_007294.3(BRCA1):c.(?_-1)_80+?del
NM_007294.3(BRCA1):c.(?_-1)_80+?dup
NM_007294.3(BRCA1):c.*1286C>T rs548275991
NM_007294.3(BRCA1):c.*291C>T rs878854928
NM_007294.3(BRCA1):c.*528G>C rs1060504556
NM_007294.3(BRCA1):c.*58C>T rs137892861
NM_007294.3(BRCA1):c.-16A>G rs777262055
NM_007294.3(BRCA1):c.-19-?_441+?dup
NM_007294.3(BRCA1):c.-19-?_5406+?dup
NM_007294.3(BRCA1):c.-19-?_80+?del
NM_007294.3(BRCA1):c.-19-?_80+?dup
NM_007294.3(BRCA1):c.1000C>A (p.Pro334Thr) rs1555592700
NM_007294.3(BRCA1):c.1001C>T (p.Pro334Leu) rs41286290
NM_007294.3(BRCA1):c.1005C>A (p.Ser335Arg) rs876660367
NM_007294.3(BRCA1):c.1008A>G (p.Thr336=) rs1060504568
NM_007294.3(BRCA1):c.1011dupA (p.Val340Glyfs) rs80357569
NM_007294.3(BRCA1):c.1012A>G (p.Lys338Glu) rs397508826
NM_007294.3(BRCA1):c.1016A>C (p.Lys339Thr) rs587781737
NM_007294.3(BRCA1):c.1017G>A (p.Lys339=) rs863224416
NM_007294.3(BRCA1):c.1021G>A (p.Asp341Asn) rs756987689
NM_007294.3(BRCA1):c.1022A>C (p.Asp341Ala)
NM_007294.3(BRCA1):c.1026G>A (p.Leu342=) rs1171571879
NM_007294.3(BRCA1):c.102delT (p.Val35Serfs) rs886039922
NM_007294.3(BRCA1):c.1031C>A (p.Ala344Asp)
NM_007294.3(BRCA1):c.1033G>T (p.Asp345Tyr) rs80356961
NM_007294.3(BRCA1):c.1036C>G (p.Pro346Ala) rs80357015
NM_007294.3(BRCA1):c.1036C>T (p.Pro346Ser) rs80357015
NM_007294.3(BRCA1):c.1038C>T (p.Pro346=) rs1555592618
NM_007294.3(BRCA1):c.1039C>T (p.Leu347=) rs1378561919
NM_007294.3(BRCA1):c.1041G>A (p.Leu347=) rs1555592609
NM_007294.3(BRCA1):c.1054G>A (p.Glu352Lys) rs80357472
NM_007294.3(BRCA1):c.1058_1062delGGAAT (p.Trp353Terfs) rs1555592576
NM_007294.3(BRCA1):c.105_134+1007del
NM_007294.3(BRCA1):c.1061A>G (p.Asn354Ser)
NM_007294.3(BRCA1):c.1061A>T (p.Asn354Ile) rs1555592577
NM_007294.3(BRCA1):c.1065G>A (p.Lys355=) rs41286292
NM_007294.3(BRCA1):c.1066C>T (p.Gln356Ter) rs80357215
NM_007294.3(BRCA1):c.1067A>G (p.Gln356Arg) rs1799950
NM_007294.3(BRCA1):c.106T>A (p.Ser36Thr) rs905812561
NM_007294.3(BRCA1):c.1075C>T (p.Pro359Ser) rs767666190
NM_007294.3(BRCA1):c.107C>A (p.Ser36Tyr) rs183557525
NM_007294.3(BRCA1):c.1081T>C (p.Ser361Pro) rs80356946
NM_007294.3(BRCA1):c.1082C>T (p.Ser361Leu) rs397508833
NM_007294.3(BRCA1):c.1086_1141del56 (p.Asn363Serfs) rs80359875
NM_007294.3(BRCA1):c.1091_1092delCT (p.Pro364Glnfs) rs1555592526
NM_007294.3(BRCA1):c.1092T>C (p.Pro364=) rs1555592521
NM_007294.3(BRCA1):c.1099A>G (p.Thr367Ala) rs878854929
NM_007294.3(BRCA1):c.10T>C (p.Ser4Pro) rs876658707
NM_007294.3(BRCA1):c.1105G>A (p.Asp369Asn) rs56056711
NM_007294.3(BRCA1):c.1106_1108delATG (p.Asp369del) rs80358325
NM_007294.3(BRCA1):c.1114T>A (p.Trp372Arg) rs1306111238
NM_007294.3(BRCA1):c.1114T>C (p.Trp372Arg) rs1306111238
NM_007294.3(BRCA1):c.1125A>G (p.Leu375=) rs1060504578
NM_007294.3(BRCA1):c.112_113delAA (p.Lys38Valfs) rs80357949
NM_007294.3(BRCA1):c.1134C>A (p.Ser378Arg) rs863224752
NM_007294.3(BRCA1):c.1135A>G (p.Ile379Val) rs864622723
NM_007294.3(BRCA1):c.1136T>C (p.Ile379Thr)
NM_007294.3(BRCA1):c.1137T>G (p.Ile379Met) rs56128296
NM_007294.3(BRCA1):c.1139A>C (p.Gln380Pro) rs876659193
NM_007294.3(BRCA1):c.1139A>G (p.Gln380Arg) rs876659193
NM_007294.3(BRCA1):c.1142A>G (p.Lys381Arg) rs1555592379
NM_007294.3(BRCA1):c.1148delA (p.Asn383Metfs) rs878854930
NM_007294.3(BRCA1):c.114G>A (p.Lys38=) rs1800062
NM_007294.3(BRCA1):c.1155G>T (p.Trp385Cys) rs876660558
NM_007294.3(BRCA1):c.1159T>A (p.Ser387Thr) rs876659403
NM_007294.3(BRCA1):c.116G>T (p.Cys39Phe) rs80357498
NM_007294.3(BRCA1):c.1175T>C (p.Leu392Pro) rs777305766
NM_007294.3(BRCA1):c.1175_1214del40 (p.Leu392Glnfs) rs80359874
NM_007294.3(BRCA1):c.1179_1180dup (p.Gly394Glufs) rs1555592304
NM_007294.3(BRCA1):c.117T>G (p.Cys39Trp) rs886040898
NM_007294.3(BRCA1):c.1187A>G (p.Asp396Gly) rs1555592280
NM_007294.3(BRCA1):c.1188delT (p.Asp396Glufs) rs397508845
NM_007294.3(BRCA1):c.1190delA (p.Asp397Alafs) rs748714307
NM_007294.3(BRCA1):c.1196A>G (p.His399Arg) rs587780794
NM_007294.3(BRCA1):c.1197T>C (p.His399=) rs1555592250
NM_007294.3(BRCA1):c.1201G>A (p.Gly401Arg) rs1555592242
NM_007294.3(BRCA1):c.1202G>A (p.Gly401Glu) rs397507184
NM_007294.3(BRCA1):c.1204delG (p.Glu402Serfs) rs80357859
NM_007294.3(BRCA1):c.1205A>T (p.Glu402Val) rs1555592216
NM_007294.3(BRCA1):c.120C>T (p.Asp40=) rs1060504580
NM_007294.3(BRCA1):c.1215A>G (p.Ser405=) rs786201517
NM_007294.3(BRCA1):c.121C>A (p.His41Asn) rs1060502353
NM_007294.3(BRCA1):c.121C>T (p.His41Tyr)
NM_007294.3(BRCA1):c.1222A>G (p.Lys408Glu) rs80357253
NM_007294.3(BRCA1):c.122A>G (p.His41Arg) rs80357276
NM_007294.3(BRCA1):c.122_134delACATATTTTGCAAinsT (p.His41_Lys45delinsLeu) rs1555599205
NM_007294.3(BRCA1):c.1230delT (p.Asp411Metfs) rs1555592108
NM_007294.3(BRCA1):c.1233T>G (p.Asp411Glu) rs80357024
NM_007294.3(BRCA1):c.1237T>C (p.Leu413=) rs574008372
NM_007294.3(BRCA1):c.123C>T (p.His41=) rs786202211
NM_007294.3(BRCA1):c.1240dupG (p.Asp414Glyfs) rs786204260
NM_007294.3(BRCA1):c.1241A>C (p.Asp414Ala) rs1555592086
NM_007294.3(BRCA1):c.1242C>T (p.Asp414=) rs372400428
NM_007294.3(BRCA1):c.1243G>A (p.Val415Ile) rs587782770
NM_007294.3(BRCA1):c.1243G>T (p.Val415Phe) rs587782770
NM_007294.3(BRCA1):c.1248A>G (p.Leu416=) rs1057522369
NM_007294.3(BRCA1):c.124A>G (p.Ile42Val) rs80357163
NM_007294.3(BRCA1):c.1250A>G (p.Asn417Ser) rs80357113
NM_007294.3(BRCA1):c.1255G>C (p.Val419Leu) rs876658873
NM_007294.3(BRCA1):c.1256T>G (p.Val419Gly) rs398122628
NM_007294.3(BRCA1):c.1258G>A (p.Asp420Asn)
NM_007294.3(BRCA1):c.1258G>T (p.Asp420Tyr) rs80357488
NM_007294.3(BRCA1):c.1259A>G (p.Asp420Gly) rs730881442
NM_007294.3(BRCA1):c.1264T>C (p.Tyr422His) rs764186025
NM_007294.3(BRCA1):c.1270G>C (p.Gly424Arg) rs763051683
NM_007294.3(BRCA1):c.1278A>G (p.Ser426=) rs1442003131
NM_007294.3(BRCA1):c.1285delA (p.Ile429Terfs)
NM_007294.3(BRCA1):c.1286T>C (p.Ile429Thr) rs775869160
NM_007294.3(BRCA1):c.1291T>A (p.Leu431Ile)
NM_007294.3(BRCA1):c.1292delT (p.Leu431Tyrfs) rs80357528
NM_007294.3(BRCA1):c.1294C>T (p.Leu432=) rs864622454
NM_007294.3(BRCA1):c.1308T>C (p.Pro436=) rs770279083
NM_007294.3(BRCA1):c.1315G>T (p.Ala439Ser) rs1064794098
NM_007294.3(BRCA1):c.1317T>C (p.Ala439=) rs1555591949
NM_007294.3(BRCA1):c.1329A>G (p.Lys443=) rs771892131
NM_007294.3(BRCA1):c.1336A>G (p.Arg446Gly) rs587781715
NM_007294.3(BRCA1):c.1339G>A (p.Val447Ile) rs587782784
NM_007294.3(BRCA1):c.133A>C (p.Lys45Gln) rs769650474
NM_007294.3(BRCA1):c.133_134+3delAAGTAinsT rs397508856
NM_007294.3(BRCA1):c.134+13G>A rs1555599185
NM_007294.3(BRCA1):c.134+15G>A rs863224417
NM_007294.3(BRCA1):c.134+18A>T rs1555599182
NM_007294.3(BRCA1):c.134+19T>C rs1060504590
NM_007294.3(BRCA1):c.134+2T>C rs80358131
NM_007294.3(BRCA1):c.134+3A>T rs80358064
NM_007294.3(BRCA1):c.1340_1341insG (p.His448Serfs) rs80357597
NM_007294.3(BRCA1):c.1342C>T (p.His448Tyr) rs786203578
NM_007294.3(BRCA1):c.134A>C (p.Lys45Thr) rs80356863
NM_007294.3(BRCA1):c.135-11A>G rs769549104
NM_007294.3(BRCA1):c.135-15_135-12delCTTT rs878854931
NM_007294.3(BRCA1):c.135-16T>G rs775525479
NM_007294.3(BRCA1):c.135-18T>G rs80358085
NM_007294.3(BRCA1):c.135-1G>A rs80358158
NM_007294.3(BRCA1):c.135-1G>C rs80358158
NM_007294.3(BRCA1):c.135-1G>T rs80358158
NM_007294.3(BRCA1):c.135-3T>C rs759417413
NM_007294.3(BRCA1):c.135-5T>C rs587781916
NM_007294.3(BRCA1):c.135-7T>C rs1555597333
NM_007294.3(BRCA1):c.135-8_135-2delATTTATA rs1555597329
NM_007294.3(BRCA1):c.135-?_441+?del
NM_007294.3(BRCA1):c.135-?_441+?dup
NM_007294.3(BRCA1):c.135-?_5193+?del
NM_007294.3(BRCA1):c.1355T>C (p.Val452Ala) rs878854932
NM_007294.3(BRCA1):c.1357G>C (p.Glu453Gln) rs768054411
NM_007294.3(BRCA1):c.1360_1361delAG (p.Ser454Terfs) rs80357969
NM_007294.3(BRCA1):c.1361G>A (p.Ser454Asn) rs80357181
NM_007294.3(BRCA1):c.1367T>C (p.Ile456Thr) rs80357360
NM_007294.3(BRCA1):c.1379T>G (p.Ile460Arg) rs398122634
NM_007294.3(BRCA1):c.1380dupA (p.Phe461Ilefs) rs80357714
NM_007294.3(BRCA1):c.1381T>C (p.Phe461Leu) rs62625300
NM_007294.3(BRCA1):c.1384G>A (p.Gly462Arg) rs80357221
NM_007294.3(BRCA1):c.1387_1390delAAAAinsGAAAG (p.Lys463Glufs) rs80357770
NM_007294.3(BRCA1):c.1389_1390delAAinsG (p.Thr464Profs) rs273897659
NM_007294.3(BRCA1):c.1392C>T (p.Thr464=) rs533802049
NM_007294.3(BRCA1):c.1397G>A (p.Arg466Gln) rs199540030
NM_007294.3(BRCA1):c.1398G>A (p.Arg466=) rs1060504571
NM_007294.3(BRCA1):c.1400A>G (p.Lys467Arg) rs876659316
NM_007294.3(BRCA1):c.1405G>A (p.Ala469Thr) rs397507187
NM_007294.3(BRCA1):c.1418A>G (p.Asn473Ser) rs80357057
NM_007294.3(BRCA1):c.1419C>T (p.Asn473=) rs777228325
NM_007294.3(BRCA1):c.141C>T (p.Cys47=) rs398122635
NM_007294.3(BRCA1):c.1423A>T (p.Ser475Cys) rs1064794047
NM_007294.3(BRCA1):c.1427A>G (p.His476Arg) rs55720177
NM_007294.3(BRCA1):c.1428T>C (p.His476=) rs1060504572
NM_007294.3(BRCA1):c.1434T>G (p.Thr478=) rs876658280
NM_007294.3(BRCA1):c.1439dupA (p.Asn480Lysfs) rs80357505
NM_007294.3(BRCA1):c.143delT (p.Met48Serfs) rs80357637
NM_007294.3(BRCA1):c.1441C>G (p.Leu481Val) rs1397842308
NM_007294.3(BRCA1):c.1444_1447delATTA (p.Ile482Terfs) rs80357801
NM_007294.3(BRCA1):c.1446_1448delTAT (p.Ile483del) rs80358327
NM_007294.3(BRCA1):c.1448T>C (p.Ile483Thr) rs80357489
NM_007294.3(BRCA1):c.144G>A (p.Met48Ile) rs587783040
NM_007294.3(BRCA1):c.1450G>A (p.Gly484Arg)
NM_007294.3(BRCA1):c.1456T>A (p.Phe486Ile) rs55906931
NM_007294.3(BRCA1):c.1456T>C (p.Phe486Leu) rs55906931
NM_007294.3(BRCA1):c.1459G>T (p.Val487Phe) rs369588942
NM_007294.3(BRCA1):c.1464T>C (p.Thr488=) rs1555591722
NM_007294.3(BRCA1):c.1470A>G (p.Pro490=) rs775032066
NM_007294.3(BRCA1):c.1478T>C (p.Ile493Thr) rs1555591707
NM_007294.3(BRCA1):c.1480C>T (p.Gln494Ter) rs80357010
NM_007294.3(BRCA1):c.1480dup (p.Gln494Profs) rs1555591706
NM_007294.3(BRCA1):c.1484A>C (p.Glu495Ala)
NM_007294.3(BRCA1):c.1486C>T (p.Arg496Cys) rs28897676
NM_007294.3(BRCA1):c.1487G>A (p.Arg496His) rs28897677
NM_007294.3(BRCA1):c.14C>T (p.Ala5Val)
NM_007294.3(BRCA1):c.1504_1508delTTAAA (p.Leu502Alafs) rs80357888
NM_007294.3(BRCA1):c.1505_1509delTAAAG (p.Leu502Serfs) rs876659139
NM_007294.3(BRCA1):c.1506A>G (p.Leu502=) rs786203671
NM_007294.3(BRCA1):c.1508A>G (p.Lys503Arg) rs62625304
NM_007294.3(BRCA1):c.1510C>T (p.Arg504Cys) rs80357445
NM_007294.3(BRCA1):c.1511G>A (p.Arg504His) rs56272539
NM_007294.3(BRCA1):c.1512dupT (p.Lys505Terfs) rs398122636
NM_007294.3(BRCA1):c.1524T>G (p.Pro508=) rs200616937
NM_007294.3(BRCA1):c.1530A>T (p.Ser510=) rs1555591599
NM_007294.3(BRCA1):c.1531G>A (p.Gly511Ser)
NM_007294.3(BRCA1):c.1533C>A (p.Gly511=) rs1280391272
NM_007294.3(BRCA1):c.1534C>G (p.Leu512Val) rs41286294
NM_007294.3(BRCA1):c.1534C>T (p.Leu512Phe) rs41286294
NM_007294.3(BRCA1):c.1538A>G (p.His513Arg) rs1356078500
NM_007294.3(BRCA1):c.154C>A (p.Leu52Ile) rs80357084
NM_007294.3(BRCA1):c.154C>T (p.Leu52Phe) rs80357084
NM_007294.3(BRCA1):c.1551delT (p.Phe517Leufs) rs80357630
NM_007294.3(BRCA1):c.1553T>C (p.Ile518Thr)
NM_007294.3(BRCA1):c.1558A>C (p.Lys520Gln) rs1555591572
NM_007294.3(BRCA1):c.155T>C (p.Leu52Pro) rs1060502346
NM_007294.3(BRCA1):c.1561G>A (p.Ala521Thr) rs80357122
NM_007294.3(BRCA1):c.1561_1564delGCAGinsTAAA (p.Ala521Ter) rs397508883
NM_007294.3(BRCA1):c.1567T>C (p.Leu523=) rs754398271
NM_007294.3(BRCA1):c.1568T>G (p.Leu523Trp) rs397508885
NM_007294.3(BRCA1):c.1571C>T (p.Ala524Val) rs80357333
NM_007294.3(BRCA1):c.1573G>A (p.Val525Ile) rs80357273
NM_007294.3(BRCA1):c.1576_1577delCA (p.Gln526Lysfs)
NM_007294.3(BRCA1):c.1580A>G (p.Lys527Arg) rs774959350
NM_007294.3(BRCA1):c.159C>T (p.Asn53=) rs1060504588
NM_007294.3(BRCA1):c.1601_1602delAG (p.Gln534Argfs) rs878854933
NM_007294.3(BRCA1):c.1603G>A (p.Gly535Arg) rs1555591488
NM_007294.3(BRCA1):c.1609A>G (p.Asn537Asp) rs398122639
NM_007294.3(BRCA1):c.160C>A (p.Gln54Lys) rs80356864
NM_007294.3(BRCA1):c.1616C>A (p.Thr539Lys) rs80357374
NM_007294.3(BRCA1):c.1616C>T (p.Thr539Met) rs80357374
NM_007294.3(BRCA1):c.1617G>A (p.Thr539=) rs372002119
NM_007294.3(BRCA1):c.1620G>C (p.Glu540Asp) rs1555591465
NM_007294.3(BRCA1):c.1624A>G (p.Asn542Asp) rs1555591461
NM_007294.3(BRCA1):c.1631_1632delAAinsGG (p.Gln544Arg) rs1555591449
NM_007294.3(BRCA1):c.1638G>A (p.Met546Ile) rs1060502340
NM_007294.3(BRCA1):c.1639A>C (p.Asn547His) rs1060502351
NM_007294.3(BRCA1):c.1648A>C (p.Asn550His) rs56012641
NM_007294.3(BRCA1):c.1649A>G (p.Asn550Ser) rs1064795217
NM_007294.3(BRCA1):c.1654G>A (p.Gly552Ser) rs758598971
NM_007294.3(BRCA1):c.1662G>C (p.Glu554Asp) rs876659028
NM_007294.3(BRCA1):c.1666A>G (p.Lys556Glu)
NM_007294.3(BRCA1):c.1673_1674delAA (p.Lys558Argfs) rs80357600
NM_007294.3(BRCA1):c.1674delA (p.Gly559Valfs) rs80357600
NM_007294.3(BRCA1):c.1675G>A (p.Gly559Ser) rs1555591384
NM_007294.3(BRCA1):c.1684A>G (p.Ile562Val)
NM_007294.3(BRCA1):c.1685T>C (p.Ile562Thr) rs1555591375
NM_007294.3(BRCA1):c.1687C>T (p.Gln563Ter) rs80356898
NM_007294.3(BRCA1):c.1690A>T (p.Asn564Tyr) rs397507191
NM_007294.3(BRCA1):c.1700dupA (p.Asn567Lysfs) rs80357784
NM_007294.3(BRCA1):c.1701T>G (p.Asn567Lys) rs1555591359
NM_007294.3(BRCA1):c.1702C>T (p.Pro568Ser) rs755122577
NM_007294.3(BRCA1):c.1703C>T (p.Pro568Leu) rs80356910
NM_007294.3(BRCA1):c.1704T>C (p.Pro568=) rs587780795
NM_007294.3(BRCA1):c.1704T>G (p.Pro568=) rs587780795
NM_007294.3(BRCA1):c.1706A>T (p.Asn569Ile) rs1060502329
NM_007294.3(BRCA1):c.1709C>A (p.Pro570Gln) rs879254020
NM_007294.3(BRCA1):c.1710A>G (p.Pro570=) rs876659901
NM_007294.3(BRCA1):c.1711A>G (p.Ile571Val) rs1310719199
NM_007294.3(BRCA1):c.1712T>C (p.Ile571Thr) rs80357159
NM_007294.3(BRCA1):c.1713A>G (p.Ile571Met) rs552505690
NM_007294.3(BRCA1):c.1718C>T (p.Ser573Leu) rs876660434
NM_007294.3(BRCA1):c.171dupG (p.Pro58Alafs) rs80357660
NM_007294.3(BRCA1):c.1721T>C (p.Leu574Pro) rs1060502341
NM_007294.3(BRCA1):c.1723G>A (p.Glu575Lys) rs397508902
NM_007294.3(BRCA1):c.1724A>G (p.Glu575Gly) rs111539978
NM_007294.3(BRCA1):c.1731A>G (p.Glu577=) rs28897678
NM_007294.3(BRCA1):c.1745C>T (p.Thr582Met) rs786202386
NM_007294.3(BRCA1):c.1747A>G (p.Lys583Glu) rs80356928
NM_007294.3(BRCA1):c.1749A>G (p.Lys583=) rs876659580
NM_007294.3(BRCA1):c.1762A>G (p.Ser588Gly) rs1169162396
NM_007294.3(BRCA1):c.1769G>A (p.Ser590Asn) rs1060502349
NM_007294.3(BRCA1):c.1773A>G (p.Ile591Met)
NM_007294.3(BRCA1):c.1775G>A (p.Ser592Asn) rs786203044
NM_007294.3(BRCA1):c.1779T>C (p.Asn593=) rs1060504563
NM_007294.3(BRCA1):c.1785delA (p.Glu595Aspfs)
NM_007294.3(BRCA1):c.1788C>T (p.Leu596=) rs779253414
NM_007294.3(BRCA1):c.1789G>A (p.Glu597Lys) rs55650082
NM_007294.3(BRCA1):c.1792T>C (p.Leu598=) rs1060504554
NM_007294.3(BRCA1):c.1792T>G (p.Leu598Val)
NM_007294.3(BRCA1):c.1793T>A (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1794A>G (p.Leu598=) rs876659644
NM_007294.3(BRCA1):c.1797T>C (p.Asn599=) rs756211343
NM_007294.3(BRCA1):c.1799T>C (p.Ile600Thr) rs398122643
NM_007294.3(BRCA1):c.1799delT (p.Ile600Thrfs) rs878854934
NM_007294.3(BRCA1):c.179A>G (p.Gln60Arg) rs373655067
NM_007294.3(BRCA1):c.1802A>G (p.His601Arg) rs371631805
NM_007294.3(BRCA1):c.1807T>G (p.Ser603Ala) rs1555591208
NM_007294.3(BRCA1):c.1812delA (p.Ala605Hisfs) rs80357927
NM_007294.3(BRCA1):c.1814C>A (p.Ala605Glu) rs1555591195
NM_007294.3(BRCA1):c.181T>G (p.Cys61Gly) rs28897672
NM_007294.3(BRCA1):c.1823_1826delAGAA (p.Lys608Ilefs) rs80357585
NM_007294.3(BRCA1):c.1824_1826delGAA (p.Lys608del) rs587781614
NM_007294.3(BRCA1):c.1830G>A (p.Arg610=) rs587780796
NM_007294.3(BRCA1):c.1831delC (p.Leu611Terfs) rs397508913
NM_007294.3(BRCA1):c.1834A>G (p.Arg612Gly) rs80357245
NM_007294.3(BRCA1):c.1836dupG (p.Arg613Glufs) rs876660523
NM_007294.3(BRCA1):c.1837A>G (p.Arg613Gly) rs863224753
NM_007294.3(BRCA1):c.1838G>A (p.Arg613Lys) rs786203937
NM_007294.3(BRCA1):c.1839G>A (p.Arg613=) rs759157605
NM_007294.3(BRCA1):c.183T>C (p.Cys61=) rs895070717
NM_007294.3(BRCA1):c.1842G>A (p.Lys614=) rs760109939
NM_007294.3(BRCA1):c.1842G>T (p.Lys614Asn) rs760109939
NM_007294.3(BRCA1):c.1846_1848delTCT (p.Ser616del) rs80358329
NM_007294.3(BRCA1):c.1849A>G (p.Thr617Ala) rs45564238
NM_007294.3(BRCA1):c.1851C>G (p.Thr617=) rs1555591097
NM_007294.3(BRCA1):c.1854G>A (p.Arg618=) rs1060504585
NM_007294.3(BRCA1):c.1856A>G (p.His619Arg) rs771890863
NM_007294.3(BRCA1):c.185_190delCTTTAT (p.Pro62_Cys64delinsArg) rs1555597224
NM_007294.3(BRCA1):c.1865C>T (p.Ala622Val) rs56039126
NM_007294.3(BRCA1):c.1866G>A (p.Ala622=) rs1800064
NM_007294.3(BRCA1):c.1873C>T (p.Leu625=) rs769044421
NM_007294.3(BRCA1):c.1874_1877dupTAGT (p.Val627Serfs) rs80357516
NM_007294.3(BRCA1):c.1875A>G (p.Leu625=) rs786201429
NM_007294.3(BRCA1):c.1878A>G (p.Val626=) rs8176154
NM_007294.3(BRCA1):c.1879G>A (p.Val627Ile) rs80357425
NM_007294.3(BRCA1):c.1881C>T (p.Val627=) rs80356838
NM_007294.3(BRCA1):c.1881_1884delCAGT (p.Ser628Glufs) rs80357567
NM_007294.3(BRCA1):c.1882A>G (p.Ser628Gly) rs1555591000
NM_007294.3(BRCA1):c.188T>A (p.Leu63Ter) rs80357086
NM_007294.3(BRCA1):c.1892T>C (p.Leu631Pro)
NM_007294.3(BRCA1):c.1892dupT (p.Ser632Lysfs) rs80357932
NM_007294.3(BRCA1):c.1893A>C (p.Leu631=) rs80356834
NM_007294.3(BRCA1):c.1895G>A (p.Ser632Asn) rs80356983
NM_007294.3(BRCA1):c.1897C>T (p.Pro633Ser) rs80356902
NM_007294.3(BRCA1):c.1898C>T (p.Pro633Leu) rs398122647
NM_007294.3(BRCA1):c.189A>T (p.Leu63Phe) rs80356956
NM_007294.3(BRCA1):c.1905T>C (p.Asn635=) rs369373293
NM_007294.3(BRCA1):c.1907G>A (p.Cys636Tyr) rs398122649
NM_007294.3(BRCA1):c.1907G>C (p.Cys636Ser)
NM_007294.3(BRCA1):c.190T>G (p.Cys64Gly) rs80357064
NM_007294.3(BRCA1):c.1911T>C (p.Thr637=) rs62625305
NM_007294.3(BRCA1):c.191G>A (p.Cys64Tyr) rs55851803
NM_007294.3(BRCA1):c.191G>C (p.Cys64Ser) rs55851803
NM_007294.3(BRCA1):c.1920A>G (p.Gln640=) rs587782843
NM_007294.3(BRCA1):c.1922T>C (p.Ile641Thr) rs730881474
NM_007294.3(BRCA1):c.1923dupT (p.Asp642Terfs) rs878854935
NM_007294.3(BRCA1):c.1924G>C (p.Asp642His) rs80357344
NM_007294.3(BRCA1):c.1925A>G (p.Asp642Gly) rs786204049
NM_007294.3(BRCA1):c.1929T>G (p.Ser643Arg) rs1060502361
NM_007294.3(BRCA1):c.192T>G (p.Cys64Trp) rs587781632
NM_007294.3(BRCA1):c.1930T>A (p.Cys644Ser) rs753521391
NM_007294.3(BRCA1):c.1934C>A (p.Ser645Tyr) rs80357129
NM_007294.3(BRCA1):c.1934C>G (p.Ser645Cys) rs80357129
NM_007294.3(BRCA1):c.193A>G (p.Lys65Glu) rs756948486
NM_007294.3(BRCA1):c.1944A>G (p.Glu648=) rs876660781
NM_007294.3(BRCA1):c.1945G>C (p.Glu649Gln) rs80356907
NM_007294.3(BRCA1):c.1949T>C (p.Ile650Thr) rs1555590816
NM_007294.3(BRCA1):c.1949dupT (p.Lys652Glufs) rs879255480
NM_007294.3(BRCA1):c.1950A>T (p.Ile650=) rs1060504579
NM_007294.3(BRCA1):c.1953_1956delGAAA (p.Lys653Serfs) rs80357526
NM_007294.3(BRCA1):c.1959A>G (p.Lys653=) rs767530204
NM_007294.3(BRCA1):c.1960A>C (p.Lys654Gln)
NM_007294.3(BRCA1):c.1960A>T (p.Lys654Ter) rs80357355
NM_007294.3(BRCA1):c.1961delA (p.Lys654Serfs) rs80357522
NM_007294.3(BRCA1):c.1961dupA (p.Tyr655Valfs) rs80357522
NM_007294.3(BRCA1):c.1969C>A (p.Gln657Lys) rs397508926
NM_007294.3(BRCA1):c.1971A>G (p.Gln657=) rs28897679
NM_007294.3(BRCA1):c.1974G>C (p.Met658Ile) rs55678461
NM_007294.3(BRCA1):c.1975C>G (p.Pro659Ala) rs587776481
NM_007294.3(BRCA1):c.1979T>C (p.Val660Ala)
NM_007294.3(BRCA1):c.1981A>G (p.Arg661Gly) rs1555590724
NM_007294.3(BRCA1):c.1983G>A (p.Arg661=) rs869320788
NM_007294.3(BRCA1):c.198T>C (p.Asn66=) rs878854936
NM_007294.3(BRCA1):c.1998A>G (p.Leu666=) rs864622452
NM_007294.3(BRCA1):c.199G>T (p.Asp67Tyr) rs80357102
NM_007294.3(BRCA1):c.19C>A (p.Arg7Ser) rs80356994
NM_007294.3(BRCA1):c.19C>T (p.Arg7Cys) rs80356994
NM_007294.3(BRCA1):c.2001A>G (p.Gln667=) rs878854937
NM_007294.3(BRCA1):c.2002C>T (p.Leu668Phe) rs80357250
NM_007294.3(BRCA1):c.2008G>A (p.Glu670Lys) rs80357029
NM_007294.3(BRCA1):c.200A>T (p.Asp67Val) rs1060502331
NM_007294.3(BRCA1):c.2019delA (p.Glu673Aspfs) rs80357626
NM_007294.3(BRCA1):c.2021C>G (p.Pro674Arg) rs876660543
NM_007294.3(BRCA1):c.2022T>G (p.Pro674=) rs771519405
NM_007294.3(BRCA1):c.202A>G (p.Ile68Val) rs1555597195
NM_007294.3(BRCA1):c.202dupA (p.Ile68Asnfs) rs886039990
NM_007294.3(BRCA1):c.2033C>T (p.Ala678Val) rs1555590634
NM_007294.3(BRCA1):c.2035A>T (p.Lys679Ter) rs80357082
NM_007294.3(BRCA1):c.2037delGinsCC (p.Lys679Asnfs) rs397508932
NM_007294.3(BRCA1):c.2043T>G (p.Ser681Arg) rs143920945
NM_007294.3(BRCA1):c.2043dupT (p.Asn682Terfs) rs863224510
NM_007294.3(BRCA1):c.2048A>G (p.Lys683Arg) rs1060502357
NM_007294.3(BRCA1):c.2050C>T (p.Pro684Ser) rs397508934
NM_007294.3(BRCA1):c.2060A>C (p.Gln687Pro) rs28897680
NM_007294.3(BRCA1):c.2066dup (p.Ser689Argfs)
NM_007294.3(BRCA1):c.206C>T (p.Thr69Ile) rs273898675
NM_007294.3(BRCA1):c.2070_2071delAA (p.Arg691Thrfs) rs80357688
NM_007294.3(BRCA1):c.2071delA (p.Arg691Aspfs) rs80357688
NM_007294.3(BRCA1):c.2072G>C (p.Arg691Thr) rs1555590574
NM_007294.3(BRCA1):c.2077G>A (p.Asp693Asn) rs4986850
NM_007294.3(BRCA1):c.2083G>T (p.Asp695Tyr) rs28897681
NM_007294.3(BRCA1):c.2086A>G (p.Thr696Ala) rs80357441
NM_007294.3(BRCA1):c.2090T>C (p.Phe697Ser) rs730881476
NM_007294.3(BRCA1):c.2090dupT (p.Glu699Argfs) rs886039996
NM_007294.3(BRCA1):c.20G>A (p.Arg7His) rs144792613
NM_007294.3(BRCA1):c.2101A>T (p.Lys701Ter) rs876660282
NM_007294.3(BRCA1):c.2101_2102delAA (p.Lys701Valfs) rs431825389
NM_007294.3(BRCA1):c.2102A>G (p.Lys701Arg) rs876658307
NM_007294.3(BRCA1):c.2103G>A (p.Lys701=) rs273898677
NM_007294.3(BRCA1):c.2105dupT (p.Leu702Phefs) rs80357880
NM_007294.3(BRCA1):c.2109A>G (p.Thr703=) rs4986844
NM_007294.3(BRCA1):c.2110_2111delAA (p.Asn704Cysfs) rs80357814
NM_007294.3(BRCA1):c.2115A>G (p.Ala705=) rs1131692099
NM_007294.3(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.3(BRCA1):c.212+10T>G rs80358174
NM_007294.3(BRCA1):c.212+13G>A rs752088834
NM_007294.3(BRCA1):c.212+15A>G rs587780797
NM_007294.3(BRCA1):c.212+17T>C rs369461674
NM_007294.3(BRCA1):c.212+1G>T rs80358042
NM_007294.3(BRCA1):c.212+4T>C rs398122652
NM_007294.3(BRCA1):c.2123C>T (p.Ser708Phe) rs80357182
NM_007294.3(BRCA1):c.2125_2126insA (p.Phe709Tyrfs) rs80357871
NM_007294.3(BRCA1):c.2126T>G (p.Phe709Cys)
NM_007294.3(BRCA1):c.212G>C (p.Arg71Thr) rs80356913
NM_007294.3(BRCA1):c.213-11T>G rs80358061
NM_007294.3(BRCA1):c.213-12A>G rs80358163
NM_007294.3(BRCA1):c.213-14C>G rs1060502337
NM_007294.3(BRCA1):c.2130delTinsAA (p.Cys712Valfs) rs1060502332
NM_007294.3(BRCA1):c.2131A>C (p.Lys711Gln) rs747046197
NM_007294.3(BRCA1):c.2131_2132delAA (p.Lys711Valfs) rs398122653
NM_007294.3(BRCA1):c.2135G>T (p.Cys712Phe) rs1555590395
NM_007294.3(BRCA1):c.2138C>G (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2143_2155delACCAGTGAACTTAinsTCTTT (p.Thr715Serfs)
NM_007294.3(BRCA1):c.2155A>G (p.Lys719Glu) rs80357147
NM_007294.3(BRCA1):c.2155_2163delAAAGAATTT (p.Lys719_Phe721del) rs863224841
NM_007294.3(BRCA1):c.2157dupA (p.Glu720Argfs) rs80357715
NM_007294.3(BRCA1):c.2162_2163delTT (p.Phe721Cysfs) rs1555590319
NM_007294.3(BRCA1):c.2165T>C (p.Val722Ala) rs1555590311
NM_007294.3(BRCA1):c.2167A>G (p.Asn723Asp) rs4986845
NM_007294.3(BRCA1):c.2171C>T (p.Pro724Leu)
NM_007294.3(BRCA1):c.2174G>C (p.Ser725Thr) rs1555590284
NM_007294.3(BRCA1):c.2176_2177delCT (p.Leu726Serfs) rs397508945
NM_007294.3(BRCA1):c.217C>T (p.Leu73=) rs786201203
NM_007294.3(BRCA1):c.219A>G (p.Leu73=) rs876659123
NM_007294.3(BRCA1):c.21C>T (p.Arg7=) rs149402012
NM_007294.3(BRCA1):c.2203C>G (p.Leu735Val) rs587781781
NM_007294.3(BRCA1):c.2203C>T (p.Leu735=) rs587781781
NM_007294.3(BRCA1):c.2207A>C (p.Glu736Ala) rs397507196
NM_007294.3(BRCA1):c.2209delA (p.Thr737Glnfs) rs1060502333
NM_007294.3(BRCA1):c.220C>T (p.Gln74Ter) rs80357234
NM_007294.3(BRCA1):c.2210_2211delCA (p.Thr737Serfs) rs80357654
NM_007294.3(BRCA1):c.2211_2213delAGT (p.Val738del) rs1555590179
NM_007294.3(BRCA1):c.2214dupT (p.Lys739Terfs) rs80357574
NM_007294.3(BRCA1):c.2215A>C (p.Lys739Gln) rs56329598
NM_007294.3(BRCA1):c.2217A>C (p.Lys739Asn) rs200521980
NM_007294.3(BRCA1):c.2217A>G (p.Lys739=) rs200521980
NM_007294.3(BRCA1):c.2218G>C (p.Val740Leu) rs80357415
NM_007294.3(BRCA1):c.2218G>T (p.Val740Leu) rs80357415
NM_007294.3(BRCA1):c.2222C>T (p.Ser741Phe) rs80357051
NM_007294.3(BRCA1):c.2224A>G (p.Asn742Asp) rs876658733
NM_007294.3(BRCA1):c.2226_2227delTA (p.Asn742Lysfs) rs878854938
NM_007294.3(BRCA1):c.2228delA (p.Asn743Metfs) rs1555590121
NM_007294.3(BRCA1):c.222A>C (p.Gln74His) rs730881465
NM_007294.3(BRCA1):c.222A>G (p.Gln74=) rs730881465
NM_007294.3(BRCA1):c.2231C>A (p.Ala744Asp) rs786204220
NM_007294.3(BRCA1):c.2232T>C (p.Ala744=) rs4986846
NM_007294.3(BRCA1):c.2232T>G (p.Ala744=) rs4986846
NM_007294.3(BRCA1):c.2235_2236invAG (p.Glu745_Asp746delinsAspTyr)
NM_007294.3(BRCA1):c.2239C>T (p.Pro747Ser) rs1555590087
NM_007294.3(BRCA1):c.2241dupC (p.Lys748Glnfs) rs80357650
NM_007294.3(BRCA1):c.2245G>A (p.Asp749Asn) rs80357114
NM_007294.3(BRCA1):c.2245G>T (p.Asp749Tyr) rs80357114
NM_007294.3(BRCA1):c.2246A>T (p.Asp749Val) rs730881479
NM_007294.3(BRCA1):c.2252T>C (p.Met751Thr) rs587781684
NM_007294.3(BRCA1):c.2253G>C (p.Met751Ile) rs1555590040
NM_007294.3(BRCA1):c.2258G>A (p.Ser753Asn) rs878854939
NM_007294.3(BRCA1):c.2264A>G (p.Glu755Gly) rs922908090
NM_007294.3(BRCA1):c.2268G>C (p.Arg756Ser) rs80356884
NM_007294.3(BRCA1):c.2273T>A (p.Leu758Ter) rs1060502334
NM_007294.3(BRCA1):c.2286A>G (p.Arg762=) rs273898682
NM_007294.3(BRCA1):c.2286A>T (p.Arg762Ser) rs273898682
NM_007294.3(BRCA1):c.2292A>G (p.Val764=) rs1555589969
NM_007294.3(BRCA1):c.2296A>G (p.Ser766Gly) rs398122655
NM_007294.3(BRCA1):c.2297G>A (p.Ser766Asn)
NM_007294.3(BRCA1):c.2299A>G (p.Ser767Gly) rs80357194
NM_007294.3(BRCA1):c.2299A>T (p.Ser767Cys) rs80357194
NM_007294.3(BRCA1):c.2302A>G (p.Ser768Gly) rs398122656
NM_007294.3(BRCA1):c.2309C>A (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2311_2317delTTGGTAC (p.Pro773Leufs) rs1060502354
NM_007294.3(BRCA1):c.2314G>A (p.Val772Ile)
NM_007294.3(BRCA1):c.2315T>C (p.Val772Ala) rs80357467
NM_007294.3(BRCA1):c.2320G>T (p.Gly774Cys) rs1555589917
NM_007294.3(BRCA1):c.2329T>G (p.Tyr777Asp) rs397507199
NM_007294.3(BRCA1):c.2334C>T (p.Gly778=) rs777404687
NM_007294.3(BRCA1):c.2337_2338delTC (p.Gln780Glyfs) rs80357515
NM_007294.3(BRCA1):c.2338C>G (p.Gln780Glu) rs80356945
NM_007294.3(BRCA1):c.2338C>T (p.Gln780Ter) rs80356945
NM_007294.3(BRCA1):c.2339A>G (p.Gln780Arg) rs1410232200
NM_007294.3(BRCA1):c.2342A>C (p.Glu781Ala) rs587776482
NM_007294.3(BRCA1):c.2344A>G (p.Ser782Gly)
NM_007294.3(BRCA1):c.2345G>T (p.Ser782Ile)
NM_007294.3(BRCA1):c.2346T>A (p.Ser782Arg) rs1555589837
NM_007294.3(BRCA1):c.2346dupT (p.Ile783Tyrfs) rs886040027
NM_007294.3(BRCA1):c.2351C>T (p.Ser784Leu) rs55914168
NM_007294.3(BRCA1):c.2352G>A (p.Ser784=) rs372017932
NM_007294.3(BRCA1):c.2354T>A (p.Leu785Ter) rs397508961
NM_007294.3(BRCA1):c.2359dupG (p.Glu787Glyfs) rs80357739
NM_007294.3(BRCA1):c.2368A>G (p.Thr790Ala) rs41286298
NM_007294.3(BRCA1):c.2378dupA (p.Ala794Glyfs) rs864622536
NM_007294.3(BRCA1):c.2386_2387delACinsT (p.Thr796Terfs) rs876660305
NM_007294.3(BRCA1):c.2387C>T (p.Thr796Ile) rs80357364
NM_007294.3(BRCA1):c.2389_2390delGA (p.Glu797Thrfs) rs80357695
NM_007294.3(BRCA1):c.2392C>T (p.Pro798Ser) rs398122658
NM_007294.3(BRCA1):c.2393C>G (p.Pro798Arg)
NM_007294.3(BRCA1):c.2393C>T (p.Pro798Leu) rs876660005
NM_007294.3(BRCA1):c.2396A>G (p.Asn799Ser) rs587782027
NM_007294.3(BRCA1):c.2397T>A (p.Asn799Lys) rs80357203
NM_007294.3(BRCA1):c.2398_2401delAAAT (p.Lys800Valfs) rs786202684
NM_007294.3(BRCA1):c.2402G>A (p.Cys801Tyr)
NM_007294.3(BRCA1):c.2405T>G (p.Val802Gly) rs1555589737
NM_007294.3(BRCA1):c.2406_2409delGAGT (p.Gln804Valfs) rs80357674
NM_007294.3(BRCA1):c.2411_2412delAG (p.Gln804Leufs) rs80357664
NM_007294.3(BRCA1):c.2412G>A (p.Gln804=) rs55746541
NM_007294.3(BRCA1):c.2412G>C (p.Gln804His) rs55746541
NM_007294.3(BRCA1):c.2414G>A (p.Cys805Tyr) rs1060502352
NM_007294.3(BRCA1):c.2416G>A (p.Ala806Thr) rs80357144
NM_007294.3(BRCA1):c.2417C>T (p.Ala806Val) rs1555589705
NM_007294.3(BRCA1):c.2418delA (p.Ala807Hisfs) rs879255281
NM_007294.3(BRCA1):c.241C>G (p.Gln81Glu) rs80357350
NM_007294.3(BRCA1):c.241C>T (p.Gln81Ter) rs80357350
NM_007294.3(BRCA1):c.2425G>A (p.Glu809Lys) rs786204151
NM_007294.3(BRCA1):c.2426A>G (p.Glu809Gly) rs397507201
NM_007294.3(BRCA1):c.2428A>T (p.Asn810Tyr) rs28897682
NM_007294.3(BRCA1):c.2429dupA (p.Asn810Lysfs) rs397508967
NM_007294.3(BRCA1):c.2433delC (p.Lys812Argfs) rs80357524
NM_007294.3(BRCA1):c.2436G>A (p.Lys812=) rs1060502338
NM_007294.3(BRCA1):c.2437G>A (p.Gly813Arg)
NM_007294.3(BRCA1):c.243A>G (p.Gln81=) rs863224418
NM_007294.3(BRCA1):c.2443delA (p.Ile815Phefs) rs80357598
NM_007294.3(BRCA1):c.2447A>G (p.His816Arg) rs80357108
NM_007294.3(BRCA1):c.2450G>T (p.Gly817Val) rs1060502365
NM_007294.3(BRCA1):c.2456C>G (p.Ser819Cys) rs192655097
NM_007294.3(BRCA1):c.2457delC (p.Asp821Ilefs) rs80357669
NM_007294.3(BRCA1):c.2458A>G (p.Lys820Glu) rs56082113
NM_007294.3(BRCA1):c.2473G>T (p.Asp825Tyr) rs80357328
NM_007294.3(BRCA1):c.2475C>T (p.Asp825=) rs1060504581
NM_007294.3(BRCA1):c.2475delC (p.Asp825Glufs) rs80357970
NM_007294.3(BRCA1):c.2477C>A (p.Thr826Lys) rs28897683
NM_007294.3(BRCA1):c.247G>T (p.Val83Phe) rs1060502343
NM_007294.3(BRCA1):c.2481A>G (p.Glu827=) rs397508970
NM_007294.3(BRCA1):c.2483_2485delGCT (p.Gly828_Phe829delinsVal) rs80358331
NM_007294.3(BRCA1):c.2491T>G (p.Tyr831Asp) rs1060502350
NM_007294.3(BRCA1):c.2496A>T (p.Pro832=) rs767666029
NM_007294.3(BRCA1):c.2497T>C (p.Leu833=) rs887578121
NM_007294.3(BRCA1):c.2500G>C (p.Gly834Arg) rs786202215
NM_007294.3(BRCA1):c.2501G>A (p.Gly834Glu) rs757383244
NM_007294.3(BRCA1):c.2506delG (p.Glu836Lysfs) rs587780798
NM_007294.3(BRCA1):c.250G>T (p.Glu84Ter) rs398122661
NM_007294.3(BRCA1):c.2518A>C (p.Ser840Arg) rs377475866
NM_007294.3(BRCA1):c.2518A>G (p.Ser840Gly) rs377475866
NM_007294.3(BRCA1):c.2518A>T (p.Ser840Cys) rs377475866
NM_007294.3(BRCA1):c.2521C>T (p.Arg841Trp) rs1800709
NM_007294.3(BRCA1):c.2522G>A (p.Arg841Gln) rs80357337
NM_007294.3(BRCA1):c.2523G>A (p.Arg841=) rs773013395
NM_007294.3(BRCA1):c.2525A>G (p.Glu842Gly) rs28897684
NM_007294.3(BRCA1):c.2528C>G (p.Thr843Arg) rs1555589466
NM_007294.3(BRCA1):c.2548A>C (p.Ser850Arg) rs1555589429
NM_007294.3(BRCA1):c.2551G>T (p.Glu851Ter) rs398122662
NM_007294.3(BRCA1):c.2554C>G (p.Leu852Val) rs863224754
NM_007294.3(BRCA1):c.2555T>C (p.Leu852Pro) rs1555589415
NM_007294.3(BRCA1):c.2563C>A (p.Gln855Lys)
NM_007294.3(BRCA1):c.2563C>T (p.Gln855Ter) rs80357131
NM_007294.3(BRCA1):c.2564A>C (p.Gln855Pro) rs768001441
NM_007294.3(BRCA1):c.2564A>G (p.Gln855Arg) rs768001441
NM_007294.3(BRCA1):c.2564A>T (p.Gln855Leu) rs768001441
NM_007294.3(BRCA1):c.2566T>C (p.Tyr856His) rs80356892
NM_007294.3(BRCA1):c.2567A>G (p.Tyr856Cys) rs864622122
NM_007294.3(BRCA1):c.2577T>C (p.Asn859=) rs1555589344
NM_007294.3(BRCA1):c.2579C>T (p.Thr860Ile) rs1555589337
NM_007294.3(BRCA1):c.2580A>C (p.Thr860=) rs556684572
NM_007294.3(BRCA1):c.2583C>G (p.Phe861Leu)
NM_007294.3(BRCA1):c.2584A>G (p.Lys862Glu) rs80356927
NM_007294.3(BRCA1):c.2589_2594delTTCAAAinsATTCTTTT (p.Ser864Phefs)
NM_007294.3(BRCA1):c.258A>G (p.Leu86=) rs777491912
NM_007294.3(BRCA1):c.258A>T (p.Leu86=) rs777491912
NM_007294.3(BRCA1):c.2590T>G (p.Ser864Ala) rs80357285
NM_007294.3(BRCA1):c.2594delA (p.Lys865Serfs) rs80357756
NM_007294.3(BRCA1):c.2596C>T (p.Arg866Cys) rs41286300
NM_007294.3(BRCA1):c.2597G>A (p.Arg866His) rs80356911
NM_007294.3(BRCA1):c.2599C>T (p.Gln867Ter) rs886038001
NM_007294.3(BRCA1):c.259T>G (p.Leu87Val) rs80357091
NM_007294.3(BRCA1):c.2604A>C (p.Ser868=) rs864622491
NM_007294.3(BRCA1):c.2608G>A (p.Ala870Thr)
NM_007294.3(BRCA1):c.2609C>T (p.Ala870Val) rs1060502324
NM_007294.3(BRCA1):c.2612C>G (p.Pro871Arg) rs799917
NM_007294.3(BRCA1):c.2612delCinsTT (p.Pro871Leufs) rs397508986
NM_007294.3(BRCA1):c.2613G>A (p.Pro871=) rs587782608
NM_007294.3(BRCA1):c.2620A>C (p.Asn874His) rs1064795862
NM_007294.3(BRCA1):c.2625A>T (p.Pro875=) rs754222140
NM_007294.3(BRCA1):c.2630A>G (p.Asn877Ser) rs786203689
NM_007294.3(BRCA1):c.2630delA (p.Asn877Metfs) rs886038002
NM_007294.3(BRCA1):c.2634A>G (p.Ala878=) rs730881451
NM_007294.3(BRCA1):c.2635G>T (p.Glu879Ter) rs80357251
NM_007294.3(BRCA1):c.2643dup (p.Cys882Metfs)
NM_007294.3(BRCA1):c.2654T>A (p.Phe885Tyr)
NM_007294.3(BRCA1):c.2662C>T (p.His888Tyr) rs80357480
NM_007294.3(BRCA1):c.2666C>T (p.Ser889Phe) rs769712441
NM_007294.3(BRCA1):c.2668G>A (p.Gly890Arg) rs80357200
NM_007294.3(BRCA1):c.2669G>T (p.Gly890Val) rs80356874
NM_007294.3(BRCA1):c.2670G>T (p.Gly890=) rs786201677
NM_007294.3(BRCA1):c.2674T>C (p.Leu892=) rs137998759
NM_007294.3(BRCA1):c.2677A>T (p.Lys893Ter) rs80357170
NM_007294.3(BRCA1):c.2678A>G (p.Lys893Arg)
NM_007294.3(BRCA1):c.2679G>T (p.Lys893Asn) rs587781771
NM_007294.3(BRCA1):c.2679_2682delGAAA (p.Lys893Asnfs) rs80357596
NM_007294.3(BRCA1):c.267C>G (p.Ile89Met) rs80356963
NM_007294.3(BRCA1):c.2680_2687delAAACAAAG (p.Lys894Serfs) rs1555589143
NM_007294.3(BRCA1):c.2681_2682delAA (p.Lys894Thrfs) rs80357971
NM_007294.3(BRCA1):c.2706A>C (p.Glu902Asp) rs398122665
NM_007294.3(BRCA1):c.2706_2707dupAT (p.Cys903Tyrfs) rs80357717
NM_007294.3(BRCA1):c.270T>C (p.Ile90=) rs1555596670
NM_007294.3(BRCA1):c.2710G>C (p.Glu904Gln) rs80357035
NM_007294.3(BRCA1):c.2713C>T (p.Gln905Ter) rs397509002
NM_007294.3(BRCA1):c.2714A>G (p.Gln905Arg) rs397507203
NM_007294.3(BRCA1):c.271T>C (p.Cys91Arg) rs786203939
NM_007294.3(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.3(BRCA1):c.2726A>T (p.Asn909Ile) rs80357127
NM_007294.3(BRCA1):c.2726dupA (p.Asn909Lysfs) rs80357614
NM_007294.3(BRCA1):c.2727_2730delTCAA (p.Asn909Lysfs) rs80357605
NM_007294.3(BRCA1):c.2728C>G (p.Gln910Glu) rs397509004
NM_007294.3(BRCA1):c.2733A>G (p.Gly911=) rs1800740
NM_007294.3(BRCA1):c.2734A>C (p.Lys912Gln) rs1555589048
NM_007294.3(BRCA1):c.2735A>G (p.Lys912Arg) rs397507204
NM_007294.3(BRCA1):c.2739T>A (p.Asn913Lys) rs273899688
NM_007294.3(BRCA1):c.2742G>A (p.Glu914=) rs961042365
NM_007294.3(BRCA1):c.2744_2745delCT (p.Ser915Terfs) rs80357540
NM_007294.3(BRCA1):c.2747A>T (p.Asn916Ile) rs864622588
NM_007294.3(BRCA1):c.274G>C (p.Ala92Pro) rs863224755
NM_007294.3(BRCA1):c.2750T>C (p.Ile917Thr) rs587781492
NM_007294.3(BRCA1):c.2750T>G (p.Ile917Ser) rs587781492
NM_007294.3(BRCA1):c.2758G>A (p.Val920Ile) rs80357361
NM_007294.3(BRCA1):c.2758G>T (p.Val920Leu)
NM_007294.3(BRCA1):c.2763G>A (p.Gln921=) rs1057522511
NM_007294.3(BRCA1):c.2766delA (p.Val923Leufs) rs80357812
NM_007294.3(BRCA1):c.2773A>C (p.Ile925Leu) rs4986847
NM_007294.3(BRCA1):c.2773A>G (p.Ile925Val) rs4986847
NM_007294.3(BRCA1):c.2775C>T (p.Ile925=) rs786201104
NM_007294.3(BRCA1):c.2783G>A (p.Gly928Asp) rs202004680
NM_007294.3(BRCA1):c.2791G>T (p.Val931Leu) rs763639161
NM_007294.3(BRCA1):c.2798G>A (p.Gly933Asp) rs80356941
NM_007294.3(BRCA1):c.2798G>C (p.Gly933Ala) rs80356941
NM_007294.3(BRCA1):c.279_280delTCinsGAA (p.Phe93Leufs) rs1555596663
NM_007294.3(BRCA1):c.2800C>T (p.Gln934Ter) rs80357223
NM_007294.3(BRCA1):c.2806_2809delGATA (p.Asp936Serfs) rs80357832
NM_007294.3(BRCA1):c.2808T>G (p.Asp936Glu) rs730881485
NM_007294.3(BRCA1):c.2811G>A (p.Lys937=) rs876659271
NM_007294.3(BRCA1):c.2813C>T (p.Pro938Leu) rs1064793999
NM_007294.3(BRCA1):c.2814A>G (p.Pro938=) rs80356851
NM_007294.3(BRCA1):c.2815G>A (p.Val939Ile) rs1555588896
NM_007294.3(BRCA1):c.2816T>C (p.Val939Ala) rs1555588894
NM_007294.3(BRCA1):c.2830T>A (p.Cys944Ser) rs1064795603
NM_007294.3(BRCA1):c.2834_2836delGTAinsC (p.Ser945Thrfs) rs386134270
NM_007294.3(BRCA1):c.283_286delCTTG (p.Leu95Thrfs)
NM_007294.3(BRCA1):c.2841A>T (p.Lys947Asn) rs864622618
NM_007294.3(BRCA1):c.2845G>A (p.Gly949Ser)
NM_007294.3(BRCA1):c.2849C>T (p.Ser950Phe) rs1555588847
NM_007294.3(BRCA1):c.2860C>T (p.Leu954=) rs730881452
NM_007294.3(BRCA1):c.2862A>G (p.Leu954=) rs559190752
NM_007294.3(BRCA1):c.2865A>T (p.Ser955=) rs748285767
NM_007294.3(BRCA1):c.2866_2870delTCTCA (p.Ser956Valfs) rs80357819
NM_007294.3(BRCA1):c.2867C>G (p.Ser956Cys) rs1060502336
NM_007294.3(BRCA1):c.286G>C (p.Asp96His) rs80357110
NM_007294.3(BRCA1):c.2872T>C (p.Phe958Leu) rs80356878
NM_007294.3(BRCA1):c.287A>G (p.Asp96Gly) rs864622444
NM_007294.3(BRCA1):c.2882A>G (p.Asn961Ser) rs879254130
NM_007294.3(BRCA1):c.2883C>T (p.Asn961=) rs201190540
NM_007294.3(BRCA1):c.2884G>A (p.Glu962Lys) rs80356955
NM_007294.3(BRCA1):c.2885A>G (p.Glu962Gly)
NM_007294.3(BRCA1):c.2888C>T (p.Thr963Ile) rs730881443
NM_007294.3(BRCA1):c.288C>T (p.Asp96=) rs146085503
NM_007294.3(BRCA1):c.288_292delCACAGinsAACCTGT (p.Asp96Glufs) rs483353091
NM_007294.3(BRCA1):c.2892A>G (p.Gly964=) rs1060504553
NM_007294.3(BRCA1):c.2893C>G (p.Leu965Val) rs1060502344
NM_007294.3(BRCA1):c.2898T>C (p.Ile966=) rs786202249
NM_007294.3(BRCA1):c.2902_2903insTC (p.Pro968Leufs) rs398122670
NM_007294.3(BRCA1):c.2905A>G (p.Asn969Asp) rs587781641
NM_007294.3(BRCA1):c.2906A>G (p.Asn969Ser)
NM_007294.3(BRCA1):c.2909A>T (p.Lys970Ile) rs756559408
NM_007294.3(BRCA1):c.290C>G (p.Thr97Arg) rs431825393
NM_007294.3(BRCA1):c.2910A>C (p.Lys970Asn) rs431825394
NM_007294.3(BRCA1):c.2910A>G (p.Lys970=) rs431825394
NM_007294.3(BRCA1):c.2911C>G (p.His971Asp) rs80357478
NM_007294.3(BRCA1):c.2912_2913delAT (p.His971Argfs) rs878854940
NM_007294.3(BRCA1):c.2913T>C (p.His971=) rs786203804
NM_007294.3(BRCA1):c.2917C>A (p.Leu973Ile)
NM_007294.3(BRCA1):c.2922A>C (p.Leu974Phe) rs730881487
NM_007294.3(BRCA1):c.2930C>T (p.Pro977Leu) rs141465583
NM_007294.3(BRCA1):c.2933A>G (p.Tyr978Cys) rs863224756
NM_007294.3(BRCA1):c.2933dupA (p.Tyr978Terfs) rs878853292
NM_007294.3(BRCA1):c.2934T>G (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2935C>T (p.Arg979Cys) rs80356970
NM_007294.3(BRCA1):c.2936G>A (p.Arg979His) rs80356985
NM_007294.3(BRCA1):c.2940delA (p.Pro981Hisfs) rs80357876
NM_007294.3(BRCA1):c.2941C>A (p.Pro981Thr) rs1555588677
NM_007294.3(BRCA1):c.2943A>T (p.Pro981=) rs587780799
NM_007294.3(BRCA1):c.2959A>G (p.Lys987Glu) rs878854941
NM_007294.3(BRCA1):c.2963C>T (p.Ser988Leu) rs397507206
NM_007294.3(BRCA1):c.2980T>C (p.Cys994Arg) rs144853230
NM_007294.3(BRCA1):c.2985G>T (p.Lys995Asn) rs1555588591
NM_007294.3(BRCA1):c.2987A>G (p.Lys996Arg) rs786202898
NM_007294.3(BRCA1):c.2992C>G (p.Leu998Val) rs876659077
NM_007294.3(BRCA1):c.2998G>A (p.Glu1000Lys) rs80357124
NM_007294.3(BRCA1):c.2998_3003delGAGGAA (p.Glu1000_Glu1001del) rs80358333
NM_007294.3(BRCA1):c.2999A>G (p.Glu1000Gly) rs1060502330
NM_007294.3(BRCA1):c.2999delA (p.Glu1000Glyfs) rs80357991
NM_007294.3(BRCA1):c.3004A>G (p.Asn1002Asp) rs786202665
NM_007294.3(BRCA1):c.3005A>T (p.Asn1002Ile) rs1555588553
NM_007294.3(BRCA1):c.3005delA (p.Asn1002Thrfs) rs80357601
NM_007294.3(BRCA1):c.3008_3009delTT (p.Phe1003Terfs) rs80357617
NM_007294.3(BRCA1):c.301+12A>C rs863224757
NM_007294.3(BRCA1):c.301+19A>G rs864622737
NM_007294.3(BRCA1):c.301+1G>A rs587782173
NM_007294.3(BRCA1):c.301+1G>C rs587782173
NM_007294.3(BRCA1):c.301+2T>C
NM_007294.3(BRCA1):c.301+2dupT rs273899694
NM_007294.3(BRCA1):c.301+6T>C rs753859240
NM_007294.3(BRCA1):c.301+7G>A rs80358113
NM_007294.3(BRCA1):c.301+8T>C rs80358101
NM_007294.3(BRCA1):c.301+9T>C rs1060504587
NM_007294.3(BRCA1):c.3010G>C (p.Glu1004Gln) rs786202534
NM_007294.3(BRCA1):c.3012G>A (p.Glu1004=) rs786201784
NM_007294.3(BRCA1):c.302-10T>A rs747733248
NM_007294.3(BRCA1):c.302-10T>C rs747733248
NM_007294.3(BRCA1):c.302-11G>A rs1057521776
NM_007294.3(BRCA1):c.302-15C>G rs1057520871
NM_007294.3(BRCA1):c.302-2delA rs273899695
NM_007294.3(BRCA1):c.302-5T>A rs778668665
NM_007294.3(BRCA1):c.302-8T>C rs878854942
NM_007294.3(BRCA1):c.302-8T>G rs878854942
NM_007294.3(BRCA1):c.302-9A>G rs1389128798
NM_007294.3(BRCA1):c.3022A>G (p.Met1008Val) rs56321129
NM_007294.3(BRCA1):c.3024G>A (p.Met1008Ile) rs1800704
NM_007294.3(BRCA1):c.3027A>C (p.Ser1009=) rs1555588512
NM_007294.3(BRCA1):c.3029_3030delCT (p.Pro1010Argfs) rs80357510
NM_007294.3(BRCA1):c.3030T>G (p.Pro1010=) rs876660048
NM_007294.3(BRCA1):c.3033_3034delAA (p.Glu1013Asnfs)
NM_007294.3(BRCA1):c.3036A>C (p.Arg1012Ser)
NM_007294.3(BRCA1):c.303T>G (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.3041T>A (p.Met1014Lys) rs80357020
NM_007294.3(BRCA1):c.3041T>C (p.Met1014Thr) rs80357020
NM_007294.3(BRCA1):c.3044dupG (p.Asn1016Lysfs) rs80357746
NM_007294.3(BRCA1):c.3048T>G (p.Asn1016Lys) rs879255482
NM_007294.3(BRCA1):c.3048_3052dupTGAGA (p.Asn1018Metfs) rs80357856
NM_007294.3(BRCA1):c.3055A>G (p.Ile1019Val) rs80357311
NM_007294.3(BRCA1):c.305C>G (p.Ala102Gly) rs80357190
NM_007294.3(BRCA1):c.3060A>G (p.Pro1020=) rs781435355
NM_007294.3(BRCA1):c.3065C>T (p.Thr1022Ile) rs786202070
NM_007294.3(BRCA1):c.3066delA (p.Val1023Terfs) rs786202906
NM_007294.3(BRCA1):c.3071G>A (p.Ser1024Asn) rs757579891
NM_007294.3(BRCA1):c.3075A>C (p.Thr1025=) rs786201258
NM_007294.3(BRCA1):c.3082C>T (p.Arg1028Cys) rs80357049
NM_007294.3(BRCA1):c.3083G>A (p.Arg1028His) rs80357459
NM_007294.3(BRCA1):c.3083G>T (p.Arg1028Leu) rs80357459
NM_007294.3(BRCA1):c.3084_3094delTAATAACATTA (p.Asn1029Argfs) rs80357647
NM_007294.3(BRCA1):c.3091A>G (p.Ile1031Val) rs786203979
NM_007294.3(BRCA1):c.3092T>G (p.Ile1031Ser) rs863224758
NM_007294.3(BRCA1):c.3093T>A (p.Ile1031=) rs786204265
NM_007294.3(BRCA1):c.3103_3104delGT (p.Val1035Phefs) rs1555588392
NM_007294.3(BRCA1):c.3104T>C (p.Val1035Ala) rs1555588389
NM_007294.3(BRCA1):c.3106T>C (p.Phe1036Leu) rs766381694
NM_007294.3(BRCA1):c.3113A>C (p.Glu1038Ala) rs16941
NM_007294.3(BRCA1):c.3117delC (p.Ser1040Alafs) rs1555588361
NM_007294.3(BRCA1):c.3119G>A (p.Ser1040Asn) rs4986852
NM_007294.3(BRCA1):c.3119G>C (p.Ser1040Thr) rs4986852
NM_007294.3(BRCA1):c.3126C>G (p.Ser1042Arg) rs878854943
NM_007294.3(BRCA1):c.3129T>C (p.Asn1043=) rs1555588339
NM_007294.3(BRCA1):c.3130A>G (p.Ile1044Val) rs80357271
NM_007294.3(BRCA1):c.3135_3138delTGAA (p.Asn1045Lysfs)
NM_007294.3(BRCA1):c.314A>G (p.Tyr105Cys) rs28897673
NM_007294.3(BRCA1):c.3153T>C (p.Thr1051=) rs1057521053
NM_007294.3(BRCA1):c.3155A>G (p.Asn1052Ser) rs398122672
NM_007294.3(BRCA1):c.3161_3164dup (p.Ser1056Glyfs)
NM_007294.3(BRCA1):c.3170G>A (p.Ser1057Asn) rs587776487
NM_007294.3(BRCA1):c.3172_3192dup (p.Ser1064_Asp1065insIleAsnGluIleGlySerSer) rs1555588237
NM_007294.3(BRCA1):c.3173T>G (p.Ile1058Ser) rs1555588264
NM_007294.3(BRCA1):c.3178G>T (p.Glu1060Ter) rs80357424
NM_007294.3(BRCA1):c.3181A>G (p.Ile1061Val) rs876658975
NM_007294.3(BRCA1):c.3193dupG (p.Asp1065Glyfs) rs80357511
NM_007294.3(BRCA1):c.3194A>T (p.Asp1065Val) rs1555588228
NM_007294.3(BRCA1):c.319T>A (p.Phe107Ile) rs878854944
NM_007294.3(BRCA1):c.31G>C (p.Val11Leu) rs1555601019
NM_007294.3(BRCA1):c.3200A>G (p.Asn1067Ser) rs1555588214
NM_007294.3(BRCA1):c.3205delC (p.Gln1069Lysfs) rs886040103
NM_007294.3(BRCA1):c.3206A>C (p.Gln1069Pro) rs879254151
NM_007294.3(BRCA1):c.3206A>T (p.Gln1069Leu) rs879254151
NM_007294.3(BRCA1):c.3211G>A (p.Glu1071Lys) rs41293445
NM_007294.3(BRCA1):c.3213A>G (p.Glu1071=) rs528254652
NM_007294.3(BRCA1):c.3214delC (p.Leu1072Terfs) rs80357923
NM_007294.3(BRCA1):c.3217G>A (p.Gly1073Ser) rs878854945
NM_007294.3(BRCA1):c.3221G>C (p.Arg1074Thr) rs786202155
NM_007294.3(BRCA1):c.3223A>G (p.Asn1075Asp)
NM_007294.3(BRCA1):c.3227G>T (p.Arg1076Ile) rs80357313
NM_007294.3(BRCA1):c.3228_3229delAG (p.Gly1077Alafs) rs80357635
NM_007294.3(BRCA1):c.3230G>A (p.Gly1077Glu)
NM_007294.3(BRCA1):c.3238T>C (p.Leu1080=) rs754597283
NM_007294.3(BRCA1):c.3238T>G (p.Leu1080Val) rs754597283
NM_007294.3(BRCA1):c.3244G>A (p.Ala1082Thr)
NM_007294.3(BRCA1):c.3247A>C (p.Met1083Leu) rs397507213
NM_007294.3(BRCA1):c.3247A>G (p.Met1083Val) rs397507213
NM_007294.3(BRCA1):c.3250C>A (p.Leu1084Ile) rs879254009
NM_007294.3(BRCA1):c.3257T>G (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3260G>C (p.Gly1087Ala) rs80357172
NM_007294.3(BRCA1):c.3269A>G (p.Gln1090Arg) rs1555588045
NM_007294.3(BRCA1):c.3270A>G (p.Gln1090=) rs369925993
NM_007294.3(BRCA1):c.3270A>T (p.Gln1090His) rs369925993
NM_007294.3(BRCA1):c.328A>G (p.Lys110Glu) rs878854946
NM_007294.3(BRCA1):c.3296C>T (p.Pro1099Leu) rs80357201
NM_007294.3(BRCA1):c.329delA (p.Lys110Argfs) rs80357604
NM_007294.3(BRCA1):c.329dupA (p.Glu111Glyfs) rs80357604
NM_007294.3(BRCA1):c.3302G>A (p.Ser1101Asn) rs41293447
NM_007294.3(BRCA1):c.3306T>C (p.Asn1102=) rs876658664
NM_007294.3(BRCA1):c.3308G>T (p.Cys1103Phe) rs80357135
NM_007294.3(BRCA1):c.330G>A (p.Lys110=) rs878854947
NM_007294.3(BRCA1):c.3327A>C (p.Lys1109Asn) rs41293449
NM_007294.3(BRCA1):c.3327_3329delAAA (p.Lys1110del) rs80357575
NM_007294.3(BRCA1):c.3328_3330delAAG (p.Lys1110del) rs80358335
NM_007294.3(BRCA1):c.3329delA (p.Lys1110Serfs) rs80357575
NM_007294.3(BRCA1):c.3331C>T (p.Gln1111Ter) rs80357089
NM_007294.3(BRCA1):c.3331_3334delCAAG (p.Gln1111Asnfs) rs80357701
NM_007294.3(BRCA1):c.333A>C (p.Glu111Asp)
NM_007294.3(BRCA1):c.3344A>T (p.Glu1115Val) rs1555587933
NM_007294.3(BRCA1):c.3345A>C (p.Glu1115Asp) rs876658243
NM_007294.3(BRCA1):c.3354G>T (p.Gln1118His) rs80357334
NM_007294.3(BRCA1):c.3355A>T (p.Thr1119Ser) rs80356949
NM_007294.3(BRCA1):c.3356C>G (p.Thr1119Ser) rs863224759
NM_007294.3(BRCA1):c.3357T>A (p.Thr1119=) rs772383323
NM_007294.3(BRCA1):c.3358G>A (p.Val1120Ile) rs748894760
NM_007294.3(BRCA1):c.3361A>G (p.Asn1121Asp) rs876660526
NM_007294.3(BRCA1):c.3362A>G (p.Asn1121Ser) rs80356919
NM_007294.3(BRCA1):c.3367G>T (p.Asp1123Tyr) rs80356867
NM_007294.3(BRCA1):c.3368A>T (p.Asp1123Val) rs1555587851
NM_007294.3(BRCA1):c.3379T>C (p.Tyr1127His) rs1451089848
NM_007294.3(BRCA1):c.338A>G (p.Asn113Ser) rs587780800
NM_007294.3(BRCA1):c.3390A>G (p.Ser1130=) rs757237039
NM_007294.3(BRCA1):c.3392A>G (p.Asp1131Gly) rs1555587813
NM_007294.3(BRCA1):c.3394A>G (p.Asn1132Asp) rs530464947
NM_007294.3(BRCA1):c.3400G>T (p.Glu1134Ter) rs80357018
NM_007294.3(BRCA1):c.3401A>T (p.Glu1134Val) rs762744684
NM_007294.3(BRCA1):c.3401_3405delAACAG (p.Glu1134Alafs) rs1555587781
NM_007294.3(BRCA1):c.3403C>G (p.Gln1135Glu) rs80357136
NM_007294.3(BRCA1):c.3406C>A (p.Pro1136Thr) rs431825395
NM_007294.3(BRCA1):c.3409A>G (p.Met1137Val) rs771479616
NM_007294.3(BRCA1):c.3410T>C (p.Met1137Thr) rs80357297
NM_007294.3(BRCA1):c.3411G>A (p.Met1137Ile) rs786202900
NM_007294.3(BRCA1):c.3416G>T (p.Ser1139Ile) rs80357228
NM_007294.3(BRCA1):c.3418A>G (p.Ser1140Gly) rs2227945
NM_007294.3(BRCA1):c.3418_3420delAGT (p.Ser1140del) rs80358337
NM_007294.3(BRCA1):c.341C>G (p.Ser114Cys) rs786202620
NM_007294.3(BRCA1):c.3423T>C (p.His1141=) rs863224419
NM_007294.3(BRCA1):c.3424G>T (p.Ala1142Ser)
NM_007294.3(BRCA1):c.3428C>G (p.Ser1143Cys) rs80357434
NM_007294.3(BRCA1):c.3432G>A (p.Gln1144=) rs80356922
NM_007294.3(BRCA1):c.3433G>T (p.Val1145Phe) rs431825396
NM_007294.3(BRCA1):c.3435T>C (p.Val1145=) rs786201222
NM_007294.3(BRCA1):c.3436_3439delTGTT (p.Cys1146Leufs) rs397509067
NM_007294.3(BRCA1):c.3437G>A (p.Cys1146Tyr) rs80357247
NM_007294.3(BRCA1):c.343C>A (p.Pro115Thr) rs1468589409
NM_007294.3(BRCA1):c.3440C>A (p.Ser1147Tyr) rs876660757
NM_007294.3(BRCA1):c.3448C>T (p.Pro1150Ser) rs80357272
NM_007294.3(BRCA1):c.3454G>A (p.Asp1152Asn) rs80357175
NM_007294.3(BRCA1):c.3460T>A (p.Leu1154Ile)
NM_007294.3(BRCA1):c.3466G>A (p.Asp1156Asn) rs1064793302
NM_007294.3(BRCA1):c.3468T>C (p.Asp1156=) rs864622146
NM_007294.3(BRCA1):c.3476T>A (p.Ile1159Lys)
NM_007294.3(BRCA1):c.3477_3480delAAAG (p.Ile1159Metfs) rs80357781
NM_007294.3(BRCA1):c.3481G>T (p.Glu1161Ter) rs786203438
NM_007294.3(BRCA1):c.3481_3491delGAAGATACTAG (p.Glu1161Phefs) rs80357877
NM_007294.3(BRCA1):c.3485delA (p.Asp1162Valfs) rs80357509
NM_007294.3(BRCA1):c.3495T>C (p.Phe1165=) rs1555587585
NM_007294.3(BRCA1):c.3496G>C (p.Ala1166Pro) rs745418679
NM_007294.3(BRCA1):c.3506A>G (p.Asp1169Gly)
NM_007294.3(BRCA1):c.3511A>T (p.Lys1171Ter) rs730882164
NM_007294.3(BRCA1):c.3518G>A (p.Ser1173Asn) rs746949187
NM_007294.3(BRCA1):c.3524_3526delCTG (p.Ala1175del) rs1555587557
NM_007294.3(BRCA1):c.3526G>A (p.Val1176Ile)
NM_007294.3(BRCA1):c.3532A>G (p.Ser1178Gly)
NM_007294.3(BRCA1):c.3533G>A (p.Ser1178Asn) rs1294360179
NM_007294.3(BRCA1):c.3535A>C (p.Lys1179Gln) rs587782188
NM_007294.3(BRCA1):c.3540C>T (p.Ser1180=) rs928545955
NM_007294.3(BRCA1):c.3541G>A (p.Val1181Ile) rs56336919
NM_007294.3(BRCA1):c.3543_3544insGA (p.Gln1182Aspfs) rs1555587537
NM_007294.3(BRCA1):c.3548A>G (p.Lys1183Arg) rs16942
NM_007294.3(BRCA1):c.3548A>T (p.Lys1183Ile) rs16942
NM_007294.3(BRCA1):c.354A>G (p.Leu118=) rs1320340280
NM_007294.3(BRCA1):c.3555G>T (p.Glu1185Asp) rs587779368
NM_007294.3(BRCA1):c.3556C>T (p.Leu1186Phe) rs1555587505
NM_007294.3(BRCA1):c.3557T>A (p.Leu1186His)
NM_007294.3(BRCA1):c.3560G>A (p.Ser1187Asn) rs80356975
NM_007294.3(BRCA1):c.3565A>T (p.Ser1189Cys)
NM_007294.3(BRCA1):c.3569C>T (p.Pro1190Leu) rs755209182
NM_007294.3(BRCA1):c.3571delA (p.Ser1191Alafs) rs886040145
NM_007294.3(BRCA1):c.3572G>A (p.Ser1191Asn) rs878854948
NM_007294.3(BRCA1):c.3573C>T (p.Ser1191=) rs864622080
NM_007294.3(BRCA1):c.3576T>C (p.Pro1192=) rs766447664
NM_007294.3(BRCA1):c.3580A>G (p.Thr1194Ala) rs369982706
NM_007294.3(BRCA1):c.3583C>G (p.His1195Asp) rs876659903
NM_007294.3(BRCA1):c.3584A>G (p.His1195Arg) rs28897685
NM_007294.3(BRCA1):c.3587C>T (p.Thr1196Ile) rs80356944
NM_007294.3(BRCA1):c.3588A>G (p.Thr1196=) rs876658595
NM_007294.3(BRCA1):c.3595G>T (p.Ala1199Ser) rs1555587437
NM_007294.3(BRCA1):c.3596C>T (p.Ala1199Val) rs587782458
NM_007294.3(BRCA1):c.3597T>A (p.Ala1199=) rs1555587434
NM_007294.3(BRCA1):c.3598C>T (p.Gln1200Ter) rs62625307
NM_007294.3(BRCA1):c.3600G>C (p.Gln1200His) rs56214134
NM_007294.3(BRCA1):c.3600G>T (p.Gln1200His) rs56214134
NM_007294.3(BRCA1):c.3601G>A (p.Gly1201Ser) rs55725337
NM_007294.3(BRCA1):c.3603T>C (p.Gly1201=) rs80356830
NM_007294.3(BRCA1):c.3607C>T (p.Arg1203Ter) rs62625308
NM_007294.3(BRCA1):c.3608G>A (p.Arg1203Gln) rs55930959
NM_007294.3(BRCA1):c.3616G>T (p.Ala1206Ser) rs1555587407
NM_007294.3(BRCA1):c.3619A>G (p.Lys1207Glu) rs80357455
NM_007294.3(BRCA1):c.3620A>T (p.Lys1207Met) rs1555587402
NM_007294.3(BRCA1):c.3625T>G (p.Leu1209Val) rs273900711
NM_007294.3(BRCA1):c.3627dupA (p.Glu1210Argfs) rs80357729
NM_007294.3(BRCA1):c.3629A>G (p.Glu1210Gly) rs1060502347
NM_007294.3(BRCA1):c.362A>G (p.Glu121Gly) rs1555596419
NM_007294.3(BRCA1):c.3632C>G (p.Ser1211Cys) rs1555587377
NM_007294.3(BRCA1):c.3635C>G (p.Ser1212Ter) rs886038021
NM_007294.3(BRCA1):c.3636A>G (p.Ser1212=) rs148038877
NM_007294.3(BRCA1):c.363A>G (p.Glu121=) rs1060504552
NM_007294.3(BRCA1):c.3640G>A (p.Glu1214Lys) rs80356923
NM_007294.3(BRCA1):c.3641delA (p.Glu1214Glyfs)
NM_007294.3(BRCA1):c.3648_3652delATCTA (p.Ser1217Terfs) rs1555587333
NM_007294.3(BRCA1):c.3648dupA (p.Ser1217Ilefs) rs80357902
NM_007294.3(BRCA1):c.3649T>C (p.Ser1217Pro) rs273900712
NM_007294.3(BRCA1):c.3650C>G (p.Ser1217Cys) rs398122676
NM_007294.3(BRCA1):c.3652A>G (p.Ser1218Gly) rs80356894
NM_007294.3(BRCA1):c.3655G>A (p.Glu1219Lys) rs80356921
NM_007294.3(BRCA1):c.3657G>C (p.Glu1219Asp) rs80356876
NM_007294.3(BRCA1):c.3661G>T (p.Glu1221Ter) rs80357310
NM_007294.3(BRCA1):c.3666G>C (p.Glu1222Asp) rs1555587312
NM_007294.3(BRCA1):c.3667C>T (p.Leu1223Phe) rs1555587309
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.366T>G (p.Val122=) rs190900046
NM_007294.3(BRCA1):c.3672C>G (p.Pro1224=) rs1555587298
NM_007294.3(BRCA1):c.3672delC (p.Cys1225Alafs) rs398122677
NM_007294.3(BRCA1):c.3673T>G (p.Cys1225Gly) rs1382025345
NM_007294.3(BRCA1):c.3684C>T (p.His1228=) rs786201623
NM_007294.3(BRCA1):c.3685T>C (p.Leu1229=) rs767958299
NM_007294.3(BRCA1):c.3691T>C (p.Phe1231Leu) rs41293451
NM_007294.3(BRCA1):c.3699A>G (p.Lys1233=) rs368690455
NM_007294.3(BRCA1):c.36A>G (p.Gln12=) rs763230080
NM_007294.3(BRCA1):c.3700G>C (p.Val1234Leu) rs763354142
NM_007294.3(BRCA1):c.3700_3704delGTAAA (p.Val1234Glnfs) rs80357609
NM_007294.3(BRCA1):c.3707A>G (p.Asn1236Ser) rs863224760
NM_007294.3(BRCA1):c.3708T>G (p.Asn1236Lys) rs28897687
NM_007294.3(BRCA1):c.370A>C (p.Ile124Leu) rs80357448
NM_007294.3(BRCA1):c.3710T>C (p.Ile1237Thr) rs876660883
NM_007294.3(BRCA1):c.3711A>G (p.Ile1237Met) rs80357388
NM_007294.3(BRCA1):c.3713C>T (p.Pro1238Leu) rs28897688
NM_007294.3(BRCA1):c.3717T>A (p.Ser1239=) rs730881453
NM_007294.3(BRCA1):c.3718C>T (p.Gln1240Ter) rs80356903
NM_007294.3(BRCA1):c.3720G>C (p.Gln1240His) rs876658341
NM_007294.3(BRCA1):c.3722C>A (p.Ser1241Tyr) rs80357143
NM_007294.3(BRCA1):c.3724A>G (p.Thr1242Ala) rs80357037
NM_007294.3(BRCA1):c.3726T>C (p.Thr1242=) rs1060504567
NM_007294.3(BRCA1):c.3726dup (p.Arg1243Terfs)
NM_007294.3(BRCA1):c.3734G>A (p.Ser1245Asn) rs1060502348
NM_007294.3(BRCA1):c.3737C>A (p.Thr1246Asn) rs878854949
NM_007294.3(BRCA1):c.3738C>T (p.Thr1246=) rs778655093
NM_007294.3(BRCA1):c.3739G>A (p.Val1247Ile) rs80357191
NM_007294.3(BRCA1):c.3747C>T (p.Thr1249=) rs587780801
NM_007294.3(BRCA1):c.3748G>A (p.Glu1250Lys) rs28897686
NM_007294.3(BRCA1):c.3748G>T (p.Glu1250Ter) rs28897686
NM_007294.3(BRCA1):c.3750G>A (p.Glu1250=) rs145903082
NM_007294.3(BRCA1):c.3750G>C (p.Glu1250Asp) rs145903082
NM_007294.3(BRCA1):c.3750G>T (p.Glu1250Asp) rs145903082
NM_007294.3(BRCA1):c.3756G>A (p.Leu1252=) rs752122039
NM_007294.3(BRCA1):c.3756_3759delGTCT (p.Ser1253Argfs) rs80357868
NM_007294.3(BRCA1):c.3758C>G (p.Ser1253Cys) rs397509100
NM_007294.3(BRCA1):c.3759T>G (p.Ser1253=) rs80356852
NM_007294.3(BRCA1):c.3759dupT (p.Lys1254Terfs) rs80357687
NM_007294.3(BRCA1):c.3760A>G (p.Lys1254Glu) rs80357362
NM_007294.3(BRCA1):c.3761_3762insTT (p.Lys1254Asnfs) rs80357928
NM_007294.3(BRCA1):c.3764dupA (p.Asn1255Lysfs) rs80357848
NM_007294.3(BRCA1):c.3768A>G (p.Thr1256=) rs786202803
NM_007294.3(BRCA1):c.3769G>A (p.Glu1257Lys)
NM_007294.3(BRCA1):c.3770_3771delAG (p.Glu1257Glyfs) rs80357579
NM_007294.3(BRCA1):c.3772G>A (p.Glu1258Lys)
NM_007294.3(BRCA1):c.3776A>C (p.Asn1259Thr) rs483353090
NM_007294.3(BRCA1):c.3783A>G (p.Leu1261=) rs80356831
NM_007294.3(BRCA1):c.3784T>C (p.Ser1262Pro) rs1011096937
NM_007294.3(BRCA1):c.3787T>C (p.Leu1263=) rs1057523961
NM_007294.3(BRCA1):c.378A>G (p.Gln126=) rs786201256
NM_007294.3(BRCA1):c.3791A>G (p.Lys1264Arg) rs1555587039
NM_007294.3(BRCA1):c.3793A>C (p.Asn1265His) rs1060502364
NM_007294.3(BRCA1):c.3797G>C (p.Ser1266Thr) rs80357160
NM_007294.3(BRCA1):c.3800T>C (p.Leu1267Ser) rs587782190
NM_007294.3(BRCA1):c.3800T>G (p.Leu1267Ter) rs587782190
NM_007294.3(BRCA1):c.3804T>C (p.Asn1268=) rs140588714
NM_007294.3(BRCA1):c.380G>A (p.Ser127Asn) rs80357189
NM_007294.3(BRCA1):c.380G>T (p.Ser127Ile) rs80357189
NM_007294.3(BRCA1):c.3810C>T (p.Cys1270=) rs886040166
NM_007294.3(BRCA1):c.3812G>C (p.Ser1271Thr)
NM_007294.3(BRCA1):c.3815A>G (p.Asn1272Ser) rs772703445
NM_007294.3(BRCA1):c.3817C>T (p.Gln1273Ter) rs80357208
NM_007294.3(BRCA1):c.3818A>G (p.Gln1273Arg) rs431825400
NM_007294.3(BRCA1):c.3822A>C (p.Val1274=) rs372396487
NM_007294.3(BRCA1):c.3823A>G (p.Ile1275Val) rs80357280
NM_007294.3(BRCA1):c.3825delA (p.Leu1276Trpfs) rs1555586983
NM_007294.3(BRCA1):c.3826T>C (p.Leu1276=) rs876659178
NM_007294.3(BRCA1):c.382A>G (p.Met128Val) rs864622124
NM_007294.3(BRCA1):c.3834G>A (p.Lys1278=) rs876660942
NM_007294.3(BRCA1):c.3835G>A (p.Ala1279Thr) rs80357036
NM_007294.3(BRCA1):c.3836C>T (p.Ala1279Val) rs1555586967
NM_007294.3(BRCA1):c.3841C>T (p.Gln1281Ter) rs80356866
NM_007294.3(BRCA1):c.3845A>T (p.Glu1282Val) rs80357217
NM_007294.3(BRCA1):c.3858_3861delTGAG (p.Ser1286Argfs) rs80357842
NM_007294.3(BRCA1):c.385G>A (p.Gly129Ser) rs1555596362
NM_007294.3(BRCA1):c.385G>T (p.Gly129Cys) rs1555596362
NM_007294.3(BRCA1):c.3868A>G (p.Lys1290Glu) rs80357254
NM_007294.3(BRCA1):c.3868A>T (p.Lys1290Ter) rs80357254
NM_007294.3(BRCA1):c.3869A>C (p.Lys1290Thr) rs431825401
NM_007294.3(BRCA1):c.3869_3870delAA (p.Lys1290Metfs) rs80357918
NM_007294.3(BRCA1):c.3874delT (p.Ser1292Leufs) rs587780802
NM_007294.3(BRCA1):c.3875C>G (p.Ser1292Cys)
NM_007294.3(BRCA1):c.3877G>C (p.Ala1293Pro) rs397507223
NM_007294.3(BRCA1):c.3878C>A (p.Ala1293Asp) rs80357213
NM_007294.3(BRCA1):c.3889T>A (p.Ser1297Thr) rs1450793674
NM_007294.3(BRCA1):c.3891T>C (p.Ser1297=) rs1555586847
NM_007294.3(BRCA1):c.3893C>G (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3896A>G (p.Gln1299Arg) rs876660866
NM_007294.3(BRCA1):c.3897G>A (p.Gln1299=) rs398122678
NM_007294.3(BRCA1):c.3900C>T (p.Cys1300=) rs730881454
NM_007294.3(BRCA1):c.3901A>T (p.Ser1301Cys) rs786203580
NM_007294.3(BRCA1):c.3902G>A (p.Ser1301Asn) rs1057519496
NM_007294.3(BRCA1):c.3903T>A (p.Ser1301Arg) rs273900719
NM_007294.3(BRCA1):c.390C>A (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.3910G>T (p.Glu1304Ter) rs886038028
NM_007294.3(BRCA1):c.3914A>T (p.Asp1305Val) rs431825402
NM_007294.3(BRCA1):c.3916_3917delTT (p.Leu1306Aspfs) rs80357678
NM_007294.3(BRCA1):c.3928dupA (p.Thr1310Asnfs) rs886040176
NM_007294.3(BRCA1):c.3929C>A (p.Thr1310Lys) rs80357257
NM_007294.3(BRCA1):c.3929C>G (p.Thr1310Arg) rs80357257
NM_007294.3(BRCA1):c.3929C>T (p.Thr1310Ile) rs80357257
NM_007294.3(BRCA1):c.3931A>G (p.Asn1311Asp) rs864622233
NM_007294.3(BRCA1):c.3937C>T (p.Gln1313Ter) rs80357318
NM_007294.3(BRCA1):c.3938A>G (p.Gln1313Arg) rs765729710
NM_007294.3(BRCA1):c.3944C>G (p.Pro1315Arg) rs80357500
NM_007294.3(BRCA1):c.3951G>A (p.Leu1317=) rs1060504566
NM_007294.3(BRCA1):c.3954dup (p.Gly1319Trpfs) rs1135401870
NM_007294.3(BRCA1):c.3955G>A (p.Gly1319Ser) rs431825403
NM_007294.3(BRCA1):c.3965A>C (p.Lys1322Thr) rs80357042
NM_007294.3(BRCA1):c.3965A>G (p.Lys1322Arg) rs80357042
NM_007294.3(BRCA1):c.3967C>T (p.Gln1323Ter) rs80357262
NM_007294.3(BRCA1):c.396C>A (p.Asn132Lys) rs80357413
NM_007294.3(BRCA1):c.3970A>T (p.Met1324Leu) rs587782241
NM_007294.3(BRCA1):c.3975G>A (p.Arg1325=) rs761424661
NM_007294.3(BRCA1):c.3976C>T (p.His1326Tyr)
NM_007294.3(BRCA1):c.3980A>G (p.Gln1327Arg) rs730881444
NM_007294.3(BRCA1):c.3988A>T (p.Ser1330Cys) rs1555586688
NM_007294.3(BRCA1):c.3990C>T (p.Ser1330=) rs876660808
NM_007294.3(BRCA1):c.3992A>G (p.Gln1331Arg) rs1060502363
NM_007294.3(BRCA1):c.3993G>A (p.Gln1331=) rs70953658
NM_007294.3(BRCA1):c.3998T>C (p.Val1333Ala) rs1135401872
NM_007294.3(BRCA1):c.3G>A (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.3G>T (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.4009G>C (p.Asp1337His) rs886041144
NM_007294.3(BRCA1):c.4014G>A (p.Lys1338=) rs1555586655
NM_007294.3(BRCA1):c.4017A>G (p.Glu1339=) rs1555586645
NM_007294.3(BRCA1):c.4018T>C (p.Leu1340=) rs786201646
NM_007294.3(BRCA1):c.4021G>A (p.Val1341Ile) rs762908108
NM_007294.3(BRCA1):c.4027G>T (p.Asp1343Tyr) rs1160287128
NM_007294.3(BRCA1):c.4028A>T (p.Asp1343Val) rs775339017
NM_007294.3(BRCA1):c.4031A>G (p.Asp1344Gly) rs55639854
NM_007294.3(BRCA1):c.4035delA (p.Glu1346Lysfs) rs80357711
NM_007294.3(BRCA1):c.4036G>A (p.Glu1346Lys) rs80357407
NM_007294.3(BRCA1):c.4039A>G (p.Arg1347Gly) rs28897689
NM_007294.3(BRCA1):c.4039A>T (p.Arg1347Ter) rs28897689
NM_007294.3(BRCA1):c.4041_4042delAG (p.Gly1348Asnfs) rs80357727
NM_007294.3(BRCA1):c.4045A>G (p.Thr1349Ala) rs80357231
NM_007294.3(BRCA1):c.4046C>G (p.Thr1349Arg) rs80357345
NM_007294.3(BRCA1):c.4046C>T (p.Thr1349Met) rs80357345
NM_007294.3(BRCA1):c.4047G>A (p.Thr1349=) rs758515222
NM_007294.3(BRCA1):c.4047G>T (p.Thr1349=) rs758515222
NM_007294.3(BRCA1):c.4048G>C (p.Gly1350Arg) rs748674194
NM_007294.3(BRCA1):c.4048G>T (p.Gly1350Cys) rs748674194
NM_007294.3(BRCA1):c.4049G>T (p.Gly1350Val) rs1433564897
NM_007294.3(BRCA1):c.4055A>T (p.Glu1352Val) rs879254228
NM_007294.3(BRCA1):c.4063A>G (p.Asn1355Asp) rs876660530
NM_007294.3(BRCA1):c.4064_4066delATCinsT (p.Asn1355Ilefs) rs1060502345
NM_007294.3(BRCA1):c.4065_4068delTCAA (p.Asn1355Lysfs) rs80357508
NM_007294.3(BRCA1):c.406dupA (p.Arg136Lysfs) rs80357709
NM_007294.3(BRCA1):c.4072G>T (p.Glu1358Ter) rs397509136
NM_007294.3(BRCA1):c.4073A>G (p.Glu1358Gly) rs397507225
NM_007294.3(BRCA1):c.4075C>G (p.Gln1359Glu) rs80357456
NM_007294.3(BRCA1):c.4081A>C (p.Met1361Leu) rs80357218
NM_007294.3(BRCA1):c.4083G>A (p.Met1361Ile) rs374192364
NM_007294.3(BRCA1):c.4084G>A (p.Asp1362Asn)
NM_007294.3(BRCA1):c.4088C>T (p.Ser1363Leu) rs398122680
NM_007294.3(BRCA1):c.4092C>T (p.Asn1364=) rs786201566
NM_007294.3(BRCA1):c.4096+11C>T rs1060504551
NM_007294.3(BRCA1):c.4096+18T>C rs1057523237
NM_007294.3(BRCA1):c.4096+1G>A rs80358178
NM_007294.3(BRCA1):c.4096+3A>G rs80358015
NM_007294.3(BRCA1):c.4096+5T>A rs1555586462
NM_007294.3(BRCA1):c.4096+6G>A rs776270258
NM_007294.3(BRCA1):c.4096+7G>A rs1060504565
NM_007294.3(BRCA1):c.4096G>C (p.Gly1366Arg) rs431825405
NM_007294.3(BRCA1):c.4097-10G>A rs80358057
NM_007294.3(BRCA1):c.4097-11T>C rs80358072
NM_007294.3(BRCA1):c.4097-15T>C rs1060504586
NM_007294.3(BRCA1):c.4097-16G>A rs1555586303
NM_007294.3(BRCA1):c.4097-20C>T rs80358169
NM_007294.3(BRCA1):c.4097-6T>C rs1555586284
NM_007294.3(BRCA1):c.410T>C (p.Leu137Pro) rs751078452
NM_007294.3(BRCA1):c.4110_4111delTG (p.Gly1371Valfs) rs80357529
NM_007294.3(BRCA1):c.4111G>C (p.Gly1371Arg) rs774593602
NM_007294.3(BRCA1):c.4113G>A (p.Gly1371=) rs147448807
NM_007294.3(BRCA1):c.4113G>T (p.Gly1371=) rs147448807
NM_007294.3(BRCA1):c.4113delG (p.Cys1372Valfs) rs80357861
NM_007294.3(BRCA1):c.4115G>A (p.Cys1372Tyr) rs55848034
NM_007294.3(BRCA1):c.4117G>T (p.Glu1373Ter) rs80357259
NM_007294.3(BRCA1):c.411dup (p.Leu138Serfs) rs886040205
NM_007294.3(BRCA1):c.4121G>A (p.Ser1374Asn)
NM_007294.3(BRCA1):c.4122_4123delTG (p.Ser1374Argfs) rs80357691
NM_007294.3(BRCA1):c.4123G>A (p.Glu1375Lys) rs80357397
NM_007294.3(BRCA1):c.4127C>G (p.Thr1376Arg) rs80356986
NM_007294.3(BRCA1):c.4128_4129delAA (p.Ser1377Argfs) rs80357921
NM_007294.3(BRCA1):c.4129A>G (p.Ser1377Gly) rs730881491
NM_007294.3(BRCA1):c.4131C>T (p.Ser1377=) rs80356871
NM_007294.3(BRCA1):c.4132G>A (p.Val1378Ile) rs28897690
NM_007294.3(BRCA1):c.413T>C (p.Leu138Pro) rs200449040
NM_007294.3(BRCA1):c.4144T>A (p.Cys1382Ser) rs786202106
NM_007294.3(BRCA1):c.4146C>T (p.Cys1382=) rs1057517574
NM_007294.3(BRCA1):c.4150G>A (p.Gly1384Arg) rs1555586146
NM_007294.3(BRCA1):c.415C>T (p.Gln139Ter) rs80357372
NM_007294.3(BRCA1):c.4161_4162delTC (p.Gln1388Glufs) rs80357565
NM_007294.3(BRCA1):c.4165_4166delAG (p.Ser1389Terfs) rs80357572
NM_007294.3(BRCA1):c.4168G>A (p.Asp1390Asn) rs752300203
NM_007294.3(BRCA1):c.4169A>G (p.Asp1390Gly) rs1165149350
NM_007294.3(BRCA1):c.416A>G (p.Gln139Arg) rs786202213
NM_007294.3(BRCA1):c.4172T>G (p.Ile1391Ser) rs397509146
NM_007294.3(BRCA1):c.4175T>C (p.Leu1392Ser)
NM_007294.3(BRCA1):c.4178C>G (p.Thr1393Ser) rs1555586071
NM_007294.3(BRCA1):c.4179C>T (p.Thr1393=) rs753735698
NM_007294.3(BRCA1):c.4180A>C (p.Thr1394Pro) rs1555586062
NM_007294.3(BRCA1):c.4181C>T (p.Thr1394Ile) rs397507226
NM_007294.3(BRCA1):c.4182T>C (p.Thr1394=) rs864622540
NM_007294.3(BRCA1):c.4184A>G (p.Gln1395Arg) rs80356972
NM_007294.3(BRCA1):c.4185+10G>A rs80358104
NM_007294.3(BRCA1):c.4185+10G>C rs80358104
NM_007294.3(BRCA1):c.4185+12G>A rs1453378073
NM_007294.3(BRCA1):c.4185+14G>C rs762153716
NM_007294.3(BRCA1):c.4185+16G>C rs774646943
NM_007294.3(BRCA1):c.4185+2_4185+22del21insA rs273900724
NM_007294.3(BRCA1):c.4185+5A>G rs766330646
NM_007294.3(BRCA1):c.4185+9C>T rs80358034
NM_007294.3(BRCA1):c.4186-19C>T rs80358016
NM_007294.3(BRCA1):c.4186-2A>G rs878854950
NM_007294.3(BRCA1):c.4186-?_4357+?dup172
NM_007294.3(BRCA1):c.4186-?_4675+?del
NM_007294.3(BRCA1):c.4186-?_5193+?del
NM_007294.3(BRCA1):c.4186C>A (p.Gln1396Lys) rs80357011
NM_007294.3(BRCA1):c.4193A>G (p.Asp1398Gly) rs761640584
NM_007294.3(BRCA1):c.4195delA (p.Thr1399Profs)
NM_007294.3(BRCA1):c.4196_4197delCCinsT (p.Thr1399Ilefs)
NM_007294.3(BRCA1):c.4197C>G (p.Thr1399=) rs876659552
NM_007294.3(BRCA1):c.4204C>T (p.His1402Tyr) rs80357365
NM_007294.3(BRCA1):c.4205A>C (p.His1402Pro) rs80356882
NM_007294.3(BRCA1):c.4209C>T (p.Asn1403=) rs786201224
NM_007294.3(BRCA1):c.420T>C (p.Ser140=) rs730881448
NM_007294.3(BRCA1):c.4213A>G (p.Ile1405Val) rs80357353
NM_007294.3(BRCA1):c.4222C>T (p.Gln1408Ter) rs80356989
NM_007294.3(BRCA1):c.4223A>C (p.Gln1408Pro) rs1555584227
NM_007294.3(BRCA1):c.4225C>T (p.Gln1409Ter) rs886040218
NM_007294.3(BRCA1):c.423A>G (p.Glu141=) rs777102216
NM_007294.3(BRCA1):c.4241T>C (p.Leu1414Pro) rs878854951
NM_007294.3(BRCA1):c.4242A>G (p.Leu1414=) rs1057521982
NM_007294.3(BRCA1):c.4243G>A (p.Glu1415Lys) rs1057519558
NM_007294.3(BRCA1):c.4243G>C (p.Glu1415Gln) rs1057519558
NM_007294.3(BRCA1):c.4245A>G (p.Glu1415=) rs41293453
NM_007294.3(BRCA1):c.4249G>A (p.Val1417Met) rs1029805420
NM_007294.3(BRCA1):c.4251G>A (p.Val1417=) rs777057839
NM_007294.3(BRCA1):c.4255G>C (p.Glu1419Gln) rs80357309
NM_007294.3(BRCA1):c.425C>A (p.Pro142His) rs55971303
NM_007294.3(BRCA1):c.4261C>T (p.His1421Tyr) rs80357013
NM_007294.3(BRCA1):c.4262A>G (p.His1421Arg) rs80357079
NM_007294.3(BRCA1):c.4265G>A (p.Gly1422Glu) rs747364414
NM_007294.3(BRCA1):c.4266G>A (p.Gly1422=) rs1555584142
NM_007294.3(BRCA1):c.4269C>T (p.Ser1423=) rs786202278
NM_007294.3(BRCA1):c.426C>T (p.Pro142=) rs542687218
NM_007294.3(BRCA1):c.427G>A (p.Glu143Lys) rs80356991
NM_007294.3(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.3(BRCA1):c.4288C>G (p.Pro1430Ala) rs80357466
NM_007294.3(BRCA1):c.4292C>T (p.Ser1431Phe) rs748839289
NM_007294.3(BRCA1):c.4297A>G (p.Ile1433Val) rs541512953
NM_007294.3(BRCA1):c.429A>C (p.Glu143Asp) rs397507228
NM_007294.3(BRCA1):c.42C>T (p.Val14=) rs80356827
NM_007294.3(BRCA1):c.4310C>T (p.Ser1437Phe) rs1555584083
NM_007294.3(BRCA1):c.4315C>T (p.Leu1439Phe) rs781260818
NM_007294.3(BRCA1):c.4327C>G (p.Arg1443Gly) rs41293455
NM_007294.3(BRCA1):c.4327C>T (p.Arg1443Ter) rs41293455
NM_007294.3(BRCA1):c.4332T>C (p.Asn1444=) rs752824502
NM_007294.3(BRCA1):c.4335_4338dupAGAA (p.Gln1447Argfs) rs397509164
NM_007294.3(BRCA1):c.4337A>C (p.Glu1446Ala) rs1273755215
NM_007294.3(BRCA1):c.4338A>T (p.Glu1446Asp) rs1555584018
NM_007294.3(BRCA1):c.4339C>A (p.Gln1447Lys) rs80357067
NM_007294.3(BRCA1):c.4342A>G (p.Ser1448Gly) rs80357486
NM_007294.3(BRCA1):c.4344C>T (p.Ser1448=) rs1250691798
NM_007294.3(BRCA1):c.4347A>G (p.Thr1449=) rs80356840
NM_007294.3(BRCA1):c.4352A>G (p.Glu1451Gly) rs949793708
NM_007294.3(BRCA1):c.4353A>G (p.Glu1451=) rs786202387
NM_007294.3(BRCA1):c.4354A>T (p.Lys1452Ter) rs398122685
NM_007294.3(BRCA1):c.4357+14G>T rs760989937
NM_007294.3(BRCA1):c.4357+16C>A rs1060504577
NM_007294.3(BRCA1):c.4357+16C>T rs1060504577
NM_007294.3(BRCA1):c.4357+17A>G rs80358180
NM_007294.3(BRCA1):c.4357+19A>C rs772281432
NM_007294.3(BRCA1):c.4357+1G>A rs80358027
NM_007294.3(BRCA1):c.4357+2T>G rs80358152
NM_007294.3(BRCA1):c.4357+5G>A rs1555583976
NM_007294.3(BRCA1):c.4357+5_4357+6delGT rs864622119
NM_007294.3(BRCA1):c.4357+7A>G rs431825407
NM_007294.3(BRCA1):c.4358-10C>T rs80358111
NM_007294.3(BRCA1):c.4358-7T>C rs1555582733
NM_007294.3(BRCA1):c.4358-9C>T rs1057521549
NM_007294.3(BRCA1):c.4358-?_4484+?del
NM_007294.3(BRCA1):c.4358-?_5074+?del
NM_007294.3(BRCA1):c.4358-?_5277+?del
NM_007294.3(BRCA1):c.4361T>C (p.Val1454Ala) rs587782606
NM_007294.3(BRCA1):c.4368T>G (p.Thr1456=) rs1171220106
NM_007294.3(BRCA1):c.4370C>A (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4379delG (p.Ser1460Ilefs) rs786203149
NM_007294.3(BRCA1):c.437C>T (p.Ser146Phe) rs1060502358
NM_007294.3(BRCA1):c.4380T>C (p.Ser1460=) rs786203100
NM_007294.3(BRCA1):c.4382G>C (p.Ser1461Thr) rs1555582692
NM_007294.3(BRCA1):c.4382_4388dup (p.Tyr1463Terfs)
NM_007294.3(BRCA1):c.4384G>A (p.Glu1462Lys) rs141255461
NM_007294.3(BRCA1):c.4389C>A (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4390C>A (p.Pro1464Thr) rs1259139517
NM_007294.3(BRCA1):c.4391_4393delCTAinsTT (p.Pro1464Leufs) rs273900730
NM_007294.3(BRCA1):c.4392T>A (p.Pro1464=) rs794727102
NM_007294.3(BRCA1):c.4396A>T (p.Ser1466Cys) rs1064794830
NM_007294.3(BRCA1):c.439T>C (p.Leu147=) rs794727800
NM_007294.3(BRCA1):c.4402A>C (p.Asn1468His) rs80357022
NM_007294.3(BRCA1):c.441+13G>A rs1057520408
NM_007294.3(BRCA1):c.441+17T>C rs368415464
NM_007294.3(BRCA1):c.441+17delT rs730881449
NM_007294.3(BRCA1):c.441+18C>T rs371973519
NM_007294.3(BRCA1):c.441+19_441+20delTT rs764884677
NM_007294.3(BRCA1):c.441+2_441+6dupTAAAA rs1555596276
NM_007294.3(BRCA1):c.441+6dup rs1060504561
NM_007294.3(BRCA1):c.4410A>T (p.Glu1470Asp) rs80357075
NM_007294.3(BRCA1):c.4412G>T (p.Gly1471Val) rs587782708
NM_007294.3(BRCA1):c.4417T>C (p.Ser1473Pro) rs398122686
NM_007294.3(BRCA1):c.4419T>A (p.Ser1473=) rs730881455
NM_007294.3(BRCA1):c.441G>C (p.Leu147Phe) rs748876625
NM_007294.3(BRCA1):c.442-10T>A
NM_007294.3(BRCA1):c.442-10T>C rs200991398
NM_007294.3(BRCA1):c.442-1G>T rs1351019392
NM_007294.3(BRCA1):c.442-22_442-13delTGTTCTTTAC rs879254224
NM_007294.3(BRCA1):c.442-3T>C rs8176139
NM_007294.3(BRCA1):c.442-3T>G rs8176139
NM_007294.3(BRCA1):c.442-?_4357+?del
NM_007294.3(BRCA1):c.442-?_547+?(2)
NM_007294.3(BRCA1):c.442-?_547+?del
NM_007294.3(BRCA1):c.442-?_593+?del
NM_007294.3(BRCA1):c.4422T>C (p.Ala1474=) rs756281673
NM_007294.3(BRCA1):c.442C>A (p.Gln148Lys) rs876659614
NM_007294.3(BRCA1):c.4441G>A (p.Ala1481Thr) rs1135401828
NM_007294.3(BRCA1):c.4445A>T (p.Asp1482Val) rs757726297
NM_007294.3(BRCA1):c.4447A>C (p.Ser1483Arg) rs1555582583
NM_007294.3(BRCA1):c.4454C>T (p.Thr1485Ile) rs80356870
NM_007294.3(BRCA1):c.4456A>T (p.Ser1486Cys) rs397507232
NM_007294.3(BRCA1):c.445delG (p.Glu149Lysfs) rs1060502327
NM_007294.3(BRCA1):c.446A>C (p.Glu149Ala) rs397507233
NM_007294.3(BRCA1):c.4471C>A (p.Pro1491Thr) rs111034213
NM_007294.3(BRCA1):c.4474G>T (p.Gly1492Ter) rs863224511
NM_007294.3(BRCA1):c.4477G>A (p.Val1493Met) rs949577051
NM_007294.3(BRCA1):c.4480G>A (p.Glu1494Lys) rs80357148
NM_007294.3(BRCA1):c.4481A>G (p.Glu1494Gly) rs758779691
NM_007294.3(BRCA1):c.4484+14A>G rs80358022
NM_007294.3(BRCA1):c.4484+15T>C rs760275914
NM_007294.3(BRCA1):c.4484+16G>A rs1369751677
NM_007294.3(BRCA1):c.4484+1G>A rs80358063
NM_007294.3(BRCA1):c.4484+4A>G
NM_007294.3(BRCA1):c.4484G>T (p.Arg1495Met) rs80357389
NM_007294.3(BRCA1):c.4485-10A>G rs863224420
NM_007294.3(BRCA1):c.4485-18T>A rs80358000
NM_007294.3(BRCA1):c.4485-2A>C
NM_007294.3(BRCA1):c.4485-2A>G rs80358054
NM_007294.3(BRCA1):c.4485-2A>T rs80358054
NM_007294.3(BRCA1):c.4485-8C>T rs397507234
NM_007294.3(BRCA1):c.4485-?_4675+?del
NM_007294.3(BRCA1):c.4485-?_4986+?del
NM_007294.3(BRCA1):c.4493delC (p.Pro1498Leufs) rs398122687
NM_007294.3(BRCA1):c.4503C>A (p.Cys1501Ter) rs747539984
NM_007294.3(BRCA1):c.4503C>T (p.Cys1501=) rs747539984
NM_007294.3(BRCA1):c.4505C>A (p.Pro1502Gln) rs56335406
NM_007294.3(BRCA1):c.4508C>G (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4512A>G (p.Leu1504=) rs1555582056
NM_007294.3(BRCA1):c.4514A>T (p.Asp1505Val)
NM_007294.3(BRCA1):c.4520G>C (p.Arg1507Thr) rs80357470
NM_007294.3(BRCA1):c.4521G>A (p.Arg1507=) rs1435385135
NM_007294.3(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.3(BRCA1):c.4533C>A (p.His1511Gln)
NM_007294.3(BRCA1):c.4534A>T (p.Ser1512Cys) rs80357137
NM_007294.3(BRCA1):c.4535G>T (p.Ser1512Ile) rs1800744
NM_007294.3(BRCA1):c.4541C>T (p.Ser1514Phe) rs863224761
NM_007294.3(BRCA1):c.4544G>A (p.Gly1515Glu) rs398122688
NM_007294.3(BRCA1):c.4545G>T (p.Gly1515=) rs755731300
NM_007294.3(BRCA1):c.4550T>C (p.Leu1517Pro) rs1555581980
NM_007294.3(BRCA1):c.4552C>A (p.Gln1518Lys) rs80356881
NM_007294.3(BRCA1):c.4552C>G (p.Gln1518Glu) rs80356881
NM_007294.3(BRCA1):c.4555A>G (p.Asn1519Asp)
NM_007294.3(BRCA1):c.4557T>C (p.Asn1519=) rs876659243
NM_007294.3(BRCA1):c.456_457delCA (p.Ser153Cysfs) rs80357882
NM_007294.3(BRCA1):c.4573C>T (p.Gln1525Ter) rs886040237
NM_007294.3(BRCA1):c.4574_4575delAA (p.Gln1525Argfs) rs80357813
NM_007294.3(BRCA1):c.4576G>A (p.Glu1526Lys) rs878853294
NM_007294.3(BRCA1):c.457A>C (p.Ser153Arg) rs28897674
NM_007294.3(BRCA1):c.457A>G (p.Ser153Gly) rs28897674
NM_007294.3(BRCA1):c.4581G>A (p.Glu1527=) rs1060504560
NM_007294.3(BRCA1):c.45dup (p.Asn16Terfs)
NM_007294.3(BRCA1):c.4600G>A (p.Val1534Met) rs55815649
NM_007294.3(BRCA1):c.4609_4610insCC (p.Gln1537Profs) rs886038035
NM_007294.3(BRCA1):c.460_467delGTCCAACT (p.Val154Leufs) rs1060502362
NM_007294.3(BRCA1):c.4610A>G (p.Gln1537Arg) rs70953659
NM_007294.3(BRCA1):c.4611_4612insG (p.Gln1538Alafs) rs80357915
NM_007294.3(BRCA1):c.4612C>T (p.Gln1538Ter) rs80356992
NM_007294.3(BRCA1):c.4616T>C (p.Leu1539Pro) rs377629427
NM_007294.3(BRCA1):c.4616dup (p.Glu1540Glyfs) rs1555581874
NM_007294.3(BRCA1):c.4618_4621delGAAGinsAAA (p.Glu1540Lysfs) rs886040240
NM_007294.3(BRCA1):c.4625C>G (p.Ser1542Cys) rs41293457
NM_007294.3(BRCA1):c.4629G>A (p.Gly1543=) rs1555581858
NM_007294.3(BRCA1):c.4635C>G (p.His1545Gln) rs373686790
NM_007294.3(BRCA1):c.4635C>T (p.His1545=) rs373686790
NM_007294.3(BRCA1):c.4636G>A (p.Asp1546Asn) rs28897691
NM_007294.3(BRCA1):c.4639T>A (p.Leu1547Met) rs730881492
NM_007294.3(BRCA1):c.463C>G (p.Gln155Glu) rs80357180
NM_007294.3(BRCA1):c.4641G>T (p.Leu1547Phe) rs864622265
NM_007294.3(BRCA1):c.4643C>T (p.Thr1548Met) rs273900737
NM_007294.3(BRCA1):c.4644G>A (p.Thr1548=) rs28897692
NM_007294.3(BRCA1):c.4647A>C (p.Glu1549Asp) rs1371814796
NM_007294.3(BRCA1):c.4649C>T (p.Thr1550Ile) rs80357076
NM_007294.3(BRCA1):c.4653T>C (p.Ser1551=) rs587780863
NM_007294.3(BRCA1):c.4654T>C (p.Tyr1552His) rs1265352633
NM_007294.3(BRCA1):c.4654_4655insC (p.Tyr1552Serfs) rs1555581824
NM_007294.3(BRCA1):c.4656C>G (p.Tyr1552Ter) rs80357151
NM_007294.3(BRCA1):c.465A>C (p.Gln155His) rs864622260
NM_007294.3(BRCA1):c.465A>T (p.Gln155His) rs864622260
NM_007294.3(BRCA1):c.4665G>A (p.Arg1555=) rs878854952
NM_007294.3(BRCA1):c.4669G>C (p.Asp1557His) rs80356906
NM_007294.3(BRCA1):c.4669G>T (p.Asp1557Tyr) rs80356906
NM_007294.3(BRCA1):c.466C>A (p.Leu156Ile) rs587778115
NM_007294.3(BRCA1):c.466C>T (p.Leu156Phe) rs587778115
NM_007294.3(BRCA1):c.4672C>G (p.Leu1558Val) rs1555581794
NM_007294.3(BRCA1):c.4675+11A>G rs750095985
NM_007294.3(BRCA1):c.4675+17_4675+18delTGinsCT rs1555581770
NM_007294.3(BRCA1):c.4675+1G>A rs80358044
NM_007294.3(BRCA1):c.4675+1G>T rs80358044
NM_007294.3(BRCA1):c.4675+20A>G rs780870669
NM_007294.3(BRCA1):c.4675+3A>G rs80358082
NM_007294.3(BRCA1):c.4675+7T>C rs273900739
NM_007294.3(BRCA1):c.4676-11A>G rs80358088
NM_007294.3(BRCA1):c.4676-16C>G rs80358067
NM_007294.3(BRCA1):c.4676-1G>A rs80358008
NM_007294.3(BRCA1):c.4676-1G>C rs80358008
NM_007294.3(BRCA1):c.4676-2A>C rs80358096
NM_007294.3(BRCA1):c.4676-2A>G rs80358096
NM_007294.3(BRCA1):c.4676-7C>T rs80358005
NM_007294.3(BRCA1):c.4676-8C>G rs80358021
NM_007294.3(BRCA1):c.4676-?_4986+?del
NM_007294.3(BRCA1):c.4676-?_5074+?del
NM_007294.3(BRCA1):c.4676_4678delAGG (p.Glu1559del) rs1555581108
NM_007294.3(BRCA1):c.4679G>T (p.Gly1560Val) rs564757581
NM_007294.3(BRCA1):c.4682C>A (p.Thr1561Asn) rs56158747
NM_007294.3(BRCA1):c.4682C>T (p.Thr1561Ile) rs56158747
NM_007294.3(BRCA1):c.4683C>G (p.Thr1561=) rs878853265
NM_007294.3(BRCA1):c.4683C>T (p.Thr1561=) rs878853265
NM_007294.3(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.3(BRCA1):c.468C>G (p.Leu156=) rs748923729
NM_007294.3(BRCA1):c.4691T>C (p.Leu1564Pro) rs56119278
NM_007294.3(BRCA1):c.4693G>A (p.Glu1565Lys) rs863224762
NM_007294.3(BRCA1):c.4697C>A (p.Ser1566Tyr) rs1060502325
NM_007294.3(BRCA1):c.4697C>G (p.Ser1566Cys)
NM_007294.3(BRCA1):c.469_470insAT (p.Ser157Tyrfs) rs1555594935
NM_007294.3(BRCA1):c.4709dupT (p.Phe1571Leufs) rs864622132
NM_007294.3(BRCA1):c.470_471delCT (p.Ser157Terfs) rs80357887
NM_007294.3(BRCA1):c.4717G>C (p.Asp1573His)
NM_007294.3(BRCA1):c.4725T>G (p.Pro1575=) rs878854953
NM_007294.3(BRCA1):c.4726G>A (p.Glu1576Lys) rs1060502355
NM_007294.3(BRCA1):c.4729T>C (p.Ser1577Pro) rs80356909
NM_007294.3(BRCA1):c.4730C>A (p.Ser1577Tyr) rs273901741
NM_007294.3(BRCA1):c.4735C>G (p.Pro1579Ala) rs145466894
NM_007294.3(BRCA1):c.4737T>C (p.Pro1579=) rs878854954
NM_007294.3(BRCA1):c.4748G>A (p.Arg1583Lys) rs752624544
NM_007294.3(BRCA1):c.4750G>T (p.Ala1584Ser) rs80357070
NM_007294.3(BRCA1):c.4751C>T (p.Ala1584Val) rs1060502323
NM_007294.3(BRCA1):c.4764T>C (p.Ala1588=) rs753651115
NM_007294.3(BRCA1):c.4765C>T (p.Arg1589Cys) rs80357002
NM_007294.3(BRCA1):c.4766G>A (p.Arg1589His) rs80357341
NM_007294.3(BRCA1):c.4771G>A (p.Gly1591Ser) rs587782825
NM_007294.3(BRCA1):c.4772G>A (p.Gly1591Asp) rs1555580956
NM_007294.3(BRCA1):c.4775A>G (p.Asn1592Ser) rs786203699
NM_007294.3(BRCA1):c.4776C>G (p.Asn1592Lys) rs761925468
NM_007294.3(BRCA1):c.4783T>C (p.Ser1595Pro) rs1325644035
NM_007294.3(BRCA1):c.478G>A (p.Gly160Arg) rs62625285
NM_007294.3(BRCA1):c.4801A>C (p.Lys1601Gln) rs80357303
NM_007294.3(BRCA1):c.4803A>G (p.Lys1601=) rs886037794
NM_007294.3(BRCA1):c.4807_4821delCCCCAATTGAAAGTT (p.Pro1603_Val1607del) rs397507238
NM_007294.3(BRCA1):c.4808C>T (p.Pro1603Leu) rs1064794054
NM_007294.3(BRCA1):c.4812A>G (p.Gln1604=) rs28897693
NM_007294.3(BRCA1):c.4813T>C (p.Leu1605=) rs80356833
NM_007294.3(BRCA1):c.4815G>A (p.Leu1605=) rs1060504589
NM_007294.3(BRCA1):c.4816A>G (p.Lys1606Glu) rs80356943
NM_007294.3(BRCA1):c.4828dup (p.Ser1610Phefs) rs1555580854
NM_007294.3(BRCA1):c.482C>T (p.Thr161Ile) rs876660138
NM_007294.3(BRCA1):c.4837A>G (p.Ser1613Gly) rs1799966
NM_007294.3(BRCA1):c.4837A>T (p.Ser1613Cys) rs1799966
NM_007294.3(BRCA1):c.483T>C (p.Thr161=) rs1060504575
NM_007294.3(BRCA1):c.4840C>T (p.Pro1614Ser) rs70953660
NM_007294.3(BRCA1):c.4841C>T (p.Pro1614Leu) rs766305255
NM_007294.3(BRCA1):c.4843G>A (p.Ala1615Thr) rs80356987
NM_007294.3(BRCA1):c.4845T>C (p.Ala1615=) rs144588397
NM_007294.3(BRCA1):c.4851T>C (p.Ala1617=) rs786202627
NM_007294.3(BRCA1):c.4858A>G (p.Thr1620Ala) rs8176219
NM_007294.3(BRCA1):c.4860T>C (p.Thr1620=) rs750938749
NM_007294.3(BRCA1):c.4862A>C (p.Asp1621Ala) rs1555580777
NM_007294.3(BRCA1):c.4868C>G (p.Ala1623Gly) rs80356862
NM_007294.3(BRCA1):c.4871G>A (p.Gly1624Glu) rs1555580767
NM_007294.3(BRCA1):c.4881A>G (p.Ala1627=) rs1425743425
NM_007294.3(BRCA1):c.4883T>C (p.Met1628Thr) rs4986854
NM_007294.3(BRCA1):c.488G>C (p.Arg163Thr) rs1369043501
NM_007294.3(BRCA1):c.4891dupA (p.Ser1631Lysfs) rs80357656
NM_007294.3(BRCA1):c.4894G>A (p.Val1632Met) rs770193975
NM_007294.3(BRCA1):c.4897A>C (p.Ser1633Arg) rs1555580711
NM_007294.3(BRCA1):c.4902G>A (p.Arg1634=) rs746199881
NM_007294.3(BRCA1):c.4903G>C (p.Glu1635Gln)
NM_007294.3(BRCA1):c.490delA (p.Thr164Leufs) rs863224512
NM_007294.3(BRCA1):c.4910C>T (p.Pro1637Leu) rs80357048
NM_007294.3(BRCA1):c.4914A>G (p.Glu1638=) rs786201216
NM_007294.3(BRCA1):c.4917G>A (p.Leu1639=) rs1060504558
NM_007294.3(BRCA1):c.4934G>C (p.Arg1645Thr) rs70953661
NM_007294.3(BRCA1):c.4935G>C (p.Arg1645Ser) rs80357373
NM_007294.3(BRCA1):c.4936delG (p.Val1646Serfs) rs80357653
NM_007294.3(BRCA1):c.4941delC (p.Asn1647Lysfs) rs80357905
NM_007294.3(BRCA1):c.4945_4947delAGAinsTTTT (p.Arg1649Phefs) rs397509207
NM_007294.3(BRCA1):c.4954A>T (p.Met1652Leu)
NM_007294.3(BRCA1):c.4955T>C (p.Met1652Thr) rs80356968
NM_007294.3(BRCA1):c.4956G>A (p.Met1652Ile) rs1799967
NM_007294.3(BRCA1):c.4959G>A (p.Val1653=) rs878854955
NM_007294.3(BRCA1):c.495G>A (p.Leu165=) rs745321499
NM_007294.3(BRCA1):c.4964_4982del19 (p.Ser1655Tyrfs) rs80359876
NM_007294.3(BRCA1):c.4971G>C (p.Leu1657=) rs786202058
NM_007294.3(BRCA1):c.4981G>A (p.Glu1661Lys) rs80357401
NM_007294.3(BRCA1):c.4986+13A>C rs5031012
NM_007294.3(BRCA1):c.4986+13A>G
NM_007294.3(BRCA1):c.4986+17G>A rs1555580584
NM_007294.3(BRCA1):c.4986+3G>C rs80358023
NM_007294.3(BRCA1):c.4986+4A>C rs80358087
NM_007294.3(BRCA1):c.4986+4A>T rs80358087
NM_007294.3(BRCA1):c.4986+5G>A rs397509211
NM_007294.3(BRCA1):c.4986+6T>C rs80358086
NM_007294.3(BRCA1):c.4987-11T>C rs80358170
NM_007294.3(BRCA1):c.4987-14T>A rs1555579832
NM_007294.3(BRCA1):c.4987-1G>A rs730881495
NM_007294.3(BRCA1):c.4987-20A>G rs80358035
NM_007294.3(BRCA1):c.4987-2A>C rs397509212
NM_007294.3(BRCA1):c.4987-3C>G rs397509213
NM_007294.3(BRCA1):c.4987-?_5074+?del
NM_007294.3(BRCA1):c.4987-?_5193+?del
NM_007294.3(BRCA1):c.4988T>A (p.Met1663Lys) rs80357205
NM_007294.3(BRCA1):c.4991T>C (p.Leu1664Pro) rs80357314
NM_007294.3(BRCA1):c.4992C>T (p.Leu1664=) rs142459158
NM_007294.3(BRCA1):c.4993G>A (p.Val1665Met) rs80357169
NM_007294.3(BRCA1):c.4996_4997dupTA (p.Lys1667Thrfs) rs1555579782
NM_007294.3(BRCA1):c.5005G>T (p.Ala1669Ser) rs80357087
NM_007294.3(BRCA1):c.5017_5019delCAC (p.His1673del) rs80358343
NM_007294.3(BRCA1):c.5022C>T (p.Ile1674=) rs786203868
NM_007294.3(BRCA1):c.5024C>T (p.Thr1675Ile) rs150729791
NM_007294.3(BRCA1):c.5030_5033delCTAA (p.Thr1677Ilefs) rs80357580
NM_007294.3(BRCA1):c.5035_5039delCTAAT (p.Leu1679Tyrfs) rs80357623
NM_007294.3(BRCA1):c.5036T>C (p.Leu1679Pro) rs760038328
NM_007294.3(BRCA1):c.5041A>C (p.Thr1681Pro) rs876659314
NM_007294.3(BRCA1):c.5050_5051delAC (p.Thr1684Tyrfs) rs879255283
NM_007294.3(BRCA1):c.5052T>C (p.Thr1684=) rs760922019
NM_007294.3(BRCA1):c.5053A>G (p.Thr1685Ala) rs80356890
NM_007294.3(BRCA1):c.5055T>G (p.Thr1685=) rs1060504555
NM_007294.3(BRCA1):c.5056C>T (p.His1686Tyr) rs1555579648
NM_007294.3(BRCA1):c.5057A>G (p.His1686Arg) rs730882166
NM_007294.3(BRCA1):c.5058T>C (p.His1686=) rs397509218
NM_007294.3(BRCA1):c.505C>T (p.Gln169Ter) rs80357133
NM_007294.3(BRCA1):c.5062_5064delGTT (p.Val1688del) rs80358344
NM_007294.3(BRCA1):c.5065A>G (p.Met1689Val) rs1555579619
NM_007294.3(BRCA1):c.5066T>G (p.Met1689Arg) rs80357061
NM_007294.3(BRCA1):c.5068A>C (p.Lys1690Gln) rs397507239
NM_007294.3(BRCA1):c.506A>C (p.Gln169Pro) rs587780803
NM_007294.3(BRCA1):c.5072C>A (p.Thr1691Lys) rs80357034
NM_007294.3(BRCA1):c.5072C>T (p.Thr1691Ile) rs80357034
NM_007294.3(BRCA1):c.5073A>C (p.Thr1691=) rs80356853
NM_007294.3(BRCA1):c.5073A>G (p.Thr1691=) rs80356853
NM_007294.3(BRCA1):c.5074+12A>T rs1555579565
NM_007294.3(BRCA1):c.5074+14C>T rs370299792
NM_007294.3(BRCA1):c.5074+16T>C rs746775027
NM_007294.3(BRCA1):c.5074+1G>A rs80358053
NM_007294.3(BRCA1):c.5074+2T>C rs80358089
NM_007294.3(BRCA1):c.5074+4T>C
NM_007294.3(BRCA1):c.5074+5A>T rs431825411
NM_007294.3(BRCA1):c.5074+6C>G rs80358032
NM_007294.3(BRCA1):c.5074G>C (p.Asp1692His) rs80187739
NM_007294.3(BRCA1):c.5075-11T>C rs1060504582
NM_007294.3(BRCA1):c.5075-18G>A rs1060504564
NM_007294.3(BRCA1):c.5075-19A>G rs1555578694
NM_007294.3(BRCA1):c.5075-6C>A rs397507240
NM_007294.3(BRCA1):c.5075-9A>C rs80358059
NM_007294.3(BRCA1):c.5075-9A>G rs80358059
NM_007294.3(BRCA1):c.5075-9A>T rs80358059
NM_007294.3(BRCA1):c.5075-?_5193+?del
NM_007294.3(BRCA1):c.5075-?_5193+?dup119
NM_007294.3(BRCA1):c.5075-?_5277+?dup203
NM_007294.3(BRCA1):c.5075A>T (p.Asp1692Val) rs397509222
NM_007294.3(BRCA1):c.5080G>A (p.Glu1694Lys)
NM_007294.3(BRCA1):c.5080G>T (p.Glu1694Ter) rs80356896
NM_007294.3(BRCA1):c.5081A>G (p.Glu1694Gly)
NM_007294.3(BRCA1):c.5086G>A (p.Val1696Met) rs80357125
NM_007294.3(BRCA1):c.5086G>T (p.Val1696Leu) rs80357125
NM_007294.3(BRCA1):c.5088G>A (p.Val1696=) rs878854956
NM_007294.3(BRCA1):c.508C>T (p.Arg170Trp) rs80357325
NM_007294.3(BRCA1):c.5090G>A (p.Cys1697Tyr) rs397507241
NM_007294.3(BRCA1):c.5095C>A (p.Arg1699=) rs55770810
NM_007294.3(BRCA1):c.5095C>T (p.Arg1699Trp) rs55770810
NM_007294.3(BRCA1):c.5096G>A (p.Arg1699Gln) rs41293459
NM_007294.3(BRCA1):c.5098A>C (p.Thr1700Pro) rs397509227
NM_007294.3(BRCA1):c.509G>A (p.Arg170Gln) rs80357264
NM_007294.3(BRCA1):c.5100A>G (p.Thr1700=) rs45519437
NM_007294.3(BRCA1):c.5101C>A (p.Leu1701Met) rs910555398
NM_007294.3(BRCA1):c.5102_5103delTG (p.Leu1701Glnfs) rs80357608
NM_007294.3(BRCA1):c.5103G>A (p.Leu1701=) rs1060504591
NM_007294.3(BRCA1):c.5106A>G (p.Lys1702=) rs1060504574
NM_007294.3(BRCA1):c.5106delA (p.Lys1702Asnfs) rs80357553
NM_007294.3(BRCA1):c.5107T>C (p.Tyr1703His) rs863224763
NM_007294.3(BRCA1):c.5109T>C (p.Tyr1703=) rs80356974
NM_007294.3(BRCA1):c.5109T>G (p.Tyr1703Ter) rs80356974
NM_007294.3(BRCA1):c.5110T>C (p.Phe1704Leu) rs1555578599
NM_007294.3(BRCA1):c.5113C>G (p.Leu1705Val) rs80356858
NM_007294.3(BRCA1):c.5114T>G (p.Leu1705Arg) rs397507242
NM_007294.3(BRCA1):c.5116G>A (p.Gly1706Arg) rs886040864
NM_007294.3(BRCA1):c.5117G>C (p.Gly1706Ala) rs80356860
NM_007294.3(BRCA1):c.5120T>C (p.Ile1707Thr) rs1064796143
NM_007294.3(BRCA1):c.5122G>A (p.Ala1708Thr) rs397507243
NM_007294.3(BRCA1):c.5123C>A (p.Ala1708Glu) rs28897696
NM_007294.3(BRCA1):c.5123C>T (p.Ala1708Val) rs28897696
NM_007294.3(BRCA1):c.5124G>A (p.Ala1708=) rs1057520432
NM_007294.3(BRCA1):c.5125G>A (p.Gly1709Arg) rs886038197
NM_007294.3(BRCA1):c.5129G>A (p.Gly1710Glu) rs398122691
NM_007294.3(BRCA1):c.5129delG (p.Gly1710Glufs) rs1135401829
NM_007294.3(BRCA1):c.512dupT (p.Gln172Thrfs) rs587781487
NM_007294.3(BRCA1):c.5131A>C (p.Lys1711Gln) rs886040272
NM_007294.3(BRCA1):c.5136G>A (p.Trp1712Ter) rs80357418
NM_007294.3(BRCA1):c.5137delG (p.Val1713Terfs) rs80357997
NM_007294.3(BRCA1):c.5137dup (p.Val1713Glyfs) rs80357997
NM_007294.3(BRCA1):c.5138T>C (p.Val1713Ala) rs80357132
NM_007294.3(BRCA1):c.5142T>G (p.Val1714=) rs749319480
NM_007294.3(BRCA1):c.5147A>G (p.Tyr1716Cys) rs587782456
NM_007294.3(BRCA1):c.514delC (p.Gln172Asnfs) rs80357872
NM_007294.3(BRCA1):c.5152+10A>G rs80358114
NM_007294.3(BRCA1):c.5152+11T>C rs1060504584
NM_007294.3(BRCA1):c.5152+15A>G rs750905289
NM_007294.3(BRCA1):c.5152+1G>C rs80358094
NM_007294.3(BRCA1):c.5152+1G>T rs80358094
NM_007294.3(BRCA1):c.5152+20T>A rs376836050
NM_007294.3(BRCA1):c.5152+2dupT rs397509231
NM_007294.3(BRCA1):c.5152+5G>C rs80358165
NM_007294.3(BRCA1):c.5152+6T>C rs80358074
NM_007294.3(BRCA1):c.5152+7A>G rs80358046
NM_007294.3(BRCA1):c.5152+9A>T rs1060504576
NM_007294.3(BRCA1):c.5153-13A>G rs45471406
NM_007294.3(BRCA1):c.5153-1G>C rs80358137
NM_007294.3(BRCA1):c.5153-2A>G rs786202545
NM_007294.3(BRCA1):c.5153-2delA rs273901746
NM_007294.3(BRCA1):c.5153-3T>C rs375639469
NM_007294.3(BRCA1):c.5153-6C>A rs80358129
NM_007294.3(BRCA1):c.5153-8C>A rs1060504570
NM_007294.3(BRCA1):c.5155_5158dup (p.Thr1720Serfs) rs1555578402
NM_007294.3(BRCA1):c.5155_5159delGTGACinsAAA (p.Val1719Lysfs) rs1555578398
NM_007294.3(BRCA1):c.5157G>A (p.Val1719=) rs28897697
NM_007294.3(BRCA1):c.5157G>T (p.Val1719=) rs28897697
NM_007294.3(BRCA1):c.5158A>G (p.Thr1720Ala) rs56195342
NM_007294.3(BRCA1):c.515A>G (p.Gln172Arg) rs1555594863
NM_007294.3(BRCA1):c.5161C>G (p.Gln1721Glu) rs878854957
NM_007294.3(BRCA1):c.5165C>A (p.Ser1722Tyr) rs80357104
NM_007294.3(BRCA1):c.5165C>T (p.Ser1722Phe) rs80357104
NM_007294.3(BRCA1):c.5167A>G (p.Ile1723Val) rs1426821558
NM_007294.3(BRCA1):c.5168T>C (p.Ile1723Thr) rs1064793533
NM_007294.3(BRCA1):c.5175A>C (p.Glu1725Asp) rs191373374
NM_007294.3(BRCA1):c.5175A>G (p.Glu1725=) rs191373374
NM_007294.3(BRCA1):c.5176A>T (p.Arg1726Ter)
NM_007294.3(BRCA1):c.5177G>C (p.Arg1726Thr) rs786203547
NM_007294.3(BRCA1):c.5177G>T (p.Arg1726Ile) rs786203547
NM_007294.3(BRCA1):c.5179A>T (p.Lys1727Ter) rs80357347
NM_007294.3(BRCA1):c.5182dup (p.Met1728Asnfs)
NM_007294.3(BRCA1):c.5185C>T (p.Leu1729=) rs1207677103
NM_007294.3(BRCA1):c.5191G>A (p.Glu1731Lys) rs397507244
NM_007294.3(BRCA1):c.5191G>T (p.Glu1731Ter) rs397507244
NM_007294.3(BRCA1):c.5193+20A>G
NM_007294.3(BRCA1):c.5193+3A>G rs1060502326
NM_007294.3(BRCA1):c.5193+3_5193+15del rs273901752
NM_007294.3(BRCA1):c.5193+6T>C rs1555578283
NM_007294.3(BRCA1):c.5193G>A (p.Glu1731=) rs876660702
NM_007294.3(BRCA1):c.5194-12G>A rs80358079
NM_007294.3(BRCA1):c.5194-14T>A
NM_007294.3(BRCA1):c.5194-17T>C rs768462633
NM_007294.3(BRCA1):c.5194-18G>T rs80358090
NM_007294.3(BRCA1):c.5194-1_5197delinsTATT rs1555576990
NM_007294.3(BRCA1):c.5198A>G (p.Asp1733Gly) rs80357270
NM_007294.3(BRCA1):c.5200T>A (p.Phe1734Ile) rs80356957
NM_007294.3(BRCA1):c.5202delT (p.Phe1734Leufs) rs876659867
NM_007294.3(BRCA1):c.5205A>T (p.Glu1735Asp) rs431825412
NM_007294.3(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.3(BRCA1):c.520C>T (p.Gln174Ter)
NM_007294.3(BRCA1):c.5211A>G (p.Arg1737=) rs1555576963
NM_007294.3(BRCA1):c.5211_5212delAG (p.Gly1738Argfs) rs1555576959
NM_007294.3(BRCA1):c.5212G>A (p.Gly1738Arg) rs80356937
NM_007294.3(BRCA1):c.5213G>A (p.Gly1738Glu) rs80357450
NM_007294.3(BRCA1):c.5216A>G (p.Asp1739Gly) rs80357227
NM_007294.3(BRCA1):c.5225A>G (p.Asn1742Ser) rs864622104
NM_007294.3(BRCA1):c.522A>G (p.Gln174=) rs765432756
NM_007294.3(BRCA1):c.5231G>A (p.Arg1744Lys)
NM_007294.3(BRCA1):c.5232_5238delAAACCACinsGTCCAAAGCGAG (p.Asn1745Serfs) rs483353071
NM_007294.3(BRCA1):c.5236C>G (p.His1746Asp) rs80357146
NM_007294.3(BRCA1):c.523A>G (p.Lys175Glu)
NM_007294.3(BRCA1):c.5242G>C (p.Gly1748Arg) rs397507245
NM_007294.3(BRCA1):c.5242G>T (p.Gly1748Cys) rs397507245
NM_007294.3(BRCA1):c.5246C>T (p.Pro1749Leu) rs80357462
NM_007294.3(BRCA1):c.5251C>T (p.Arg1751Ter) rs80357123
NM_007294.3(BRCA1):c.5252G>A (p.Arg1751Gln) rs80357442
NM_007294.3(BRCA1):c.5252G>T (p.Arg1751Leu) rs80357442
NM_007294.3(BRCA1):c.5259A>T (p.Arg1753Ser) rs771577266
NM_007294.3(BRCA1):c.5259delA (p.Glu1754Asnfs) rs80357925
NM_007294.3(BRCA1):c.5260G>C (p.Glu1754Gln) rs80357432
NM_007294.3(BRCA1):c.5260G>T (p.Glu1754Ter) rs80357432
NM_007294.3(BRCA1):c.5264C>T (p.Ser1755Phe) rs1555576858
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs397507247
NM_007294.3(BRCA1):c.5267A>G (p.Gln1756Arg)
NM_007294.3(BRCA1):c.5269G>A (p.Asp1757Asn) rs863224764
NM_007294.3(BRCA1):c.5269G>C (p.Asp1757His) rs863224764
NM_007294.3(BRCA1):c.5274A>G (p.Arg1758=) rs758739620
NM_007294.3(BRCA1):c.5275_5276delAAinsTG (p.Lys1759Trp) rs786204116
NM_007294.3(BRCA1):c.5277+15C>A rs535279193
NM_007294.3(BRCA1):c.5277+15C>T rs535279193
NM_007294.3(BRCA1):c.5277+17C>G rs749918224
NM_007294.3(BRCA1):c.5277+17C>T rs749918224
NM_007294.3(BRCA1):c.5277+1G>A rs80358150
NM_007294.3(BRCA1):c.5277+1G>T rs80358150
NM_007294.3(BRCA1):c.5277+1_5277+6del rs1060502356
NM_007294.3(BRCA1):c.5277+1delG rs273901754
NM_007294.3(BRCA1):c.5277+20G>A rs766950602
NM_007294.3(BRCA1):c.5277+9C>G rs1356169081
NM_007294.3(BRCA1):c.5278-14C>G rs80358105
NM_007294.3(BRCA1):c.5278-16T>C rs1555575747
NM_007294.3(BRCA1):c.5278-1G>A rs80358099
NM_007294.3(BRCA1):c.5278-20C>T rs193149108
NM_007294.3(BRCA1):c.5278-?_5406+?del
NM_007294.3(BRCA1):c.5278-?_5406+?dup129
NM_007294.3(BRCA1):c.5278-?_5467+?del
NM_007294.3(BRCA1):c.527C>T (p.Thr176Met) rs587782747
NM_007294.3(BRCA1):c.5280C>A (p.Ile1760=) rs750040616
NM_007294.3(BRCA1):c.5288G>T (p.Gly1763Val) rs80357007
NM_007294.3(BRCA1):c.5289G>A (p.Gly1763=) rs1022076404
NM_007294.3(BRCA1):c.528G>A (p.Thr176=) rs34545365
NM_007294.3(BRCA1):c.5297T>G (p.Ile1766Ser) rs80357463
NM_007294.3(BRCA1):c.5304C>T (p.Cys1768=) rs138493864
NM_007294.3(BRCA1):c.5306A>G (p.Tyr1769Cys) rs397509257
NM_007294.3(BRCA1):c.5309G>C (p.Gly1770Ala) rs863224765
NM_007294.3(BRCA1):c.5310G>A (p.Gly1770=) rs273901761
NM_007294.3(BRCA1):c.5310G>C (p.Gly1770=) rs273901761
NM_007294.3(BRCA1):c.5315T>G (p.Phe1772Cys) rs1555575700
NM_007294.3(BRCA1):c.5318C>T (p.Thr1773Ile) rs80357428
NM_007294.3(BRCA1):c.5319dupC (p.Asn1774Glnfs) rs80357823
NM_007294.3(BRCA1):c.531dupT (p.Val178Cysfs) rs864622350
NM_007294.3(BRCA1):c.5324T>G (p.Met1775Arg) rs41293463
NM_007294.3(BRCA1):c.5326C>T (p.Pro1776Ser) rs1800757
NM_007294.3(BRCA1):c.5327C>A (p.Pro1776His) rs398122695
NM_007294.3(BRCA1):c.5327C>T (p.Pro1776Leu) rs398122695
NM_007294.3(BRCA1):c.5328C>T (p.Pro1776=) rs759867616
NM_007294.3(BRCA1):c.5330C>T (p.Thr1777Ile) rs398122696
NM_007294.3(BRCA1):c.5332+13G>T rs372391060
NM_007294.3(BRCA1):c.5332+15G>C rs80358148
NM_007294.3(BRCA1):c.5332+19C>G rs774813458
NM_007294.3(BRCA1):c.5332+1G>A rs80358041
NM_007294.3(BRCA1):c.5332+20C>A rs1057521961
NM_007294.3(BRCA1):c.5332+20C>G rs1057521961
NM_007294.3(BRCA1):c.5332+2T>C rs80358182
NM_007294.3(BRCA1):c.5332+3A>G rs766614917
NM_007294.3(BRCA1):c.5332G>A (p.Asp1778Asn) rs80357112
NM_007294.3(BRCA1):c.5333-1G>T rs80358126
NM_007294.3(BRCA1):c.5333-8C>T rs80358084
NM_007294.3(BRCA1):c.5333-?_5406+?del
NM_007294.3(BRCA1):c.5333A>G (p.Asp1778Gly) rs80357041
NM_007294.3(BRCA1):c.5334T>C (p.Asp1778=) rs754152768
NM_007294.3(BRCA1):c.5335delC (p.Gln1779Asnfs) rs80357590
NM_007294.3(BRCA1):c.5339T>A (p.Leu1780Gln) rs80357474
NM_007294.3(BRCA1):c.5339T>C (p.Leu1780Pro) rs80357474
NM_007294.3(BRCA1):c.5347A>C (p.Met1783Leu) rs80357012
NM_007294.3(BRCA1):c.5347A>G (p.Met1783Val) rs80357012
NM_007294.3(BRCA1):c.5348T>C (p.Met1783Thr) rs55808233
NM_007294.3(BRCA1):c.5350G>A (p.Val1784Ile) rs1060502328
NM_007294.3(BRCA1):c.5353C>T (p.Gln1785Ter) rs80356969
NM_007294.3(BRCA1):c.5356C>T (p.Leu1786=) rs1555575167
NM_007294.3(BRCA1):c.5357T>C (p.Leu1786Pro) rs398122697
NM_007294.3(BRCA1):c.5359_5363delTGTGGinsAGTGA (p.Cys1787_Gly1788delinsSerAsp) rs786203663
NM_007294.3(BRCA1):c.535T>C (p.Tyr179His) rs587781761
NM_007294.3(BRCA1):c.5363G>C (p.Gly1788Ala) rs80357069
NM_007294.3(BRCA1):c.5363G>T (p.Gly1788Val) rs80357069
NM_007294.3(BRCA1):c.5365G>A (p.Ala1789Thr) rs80357078
NM_007294.3(BRCA1):c.5365_5366delGCinsA (p.Ala1789Ilefs) rs1555575142
NM_007294.3(BRCA1):c.536A>G (p.Tyr179Cys) rs56187033
NM_007294.3(BRCA1):c.536_547+165del rs1555594718
NM_007294.3(BRCA1):c.5371G>T (p.Val1791Leu) rs145758886
NM_007294.3(BRCA1):c.5372T>C (p.Val1791Ala) rs864622244
NM_007294.3(BRCA1):c.5374G>A (p.Val1792Met)
NM_007294.3(BRCA1):c.5376G>A (p.Val1792=) rs1060504569
NM_007294.3(BRCA1):c.5383C>T (p.Leu1795Phe) rs878854958
NM_007294.3(BRCA1):c.5387C>A (p.Ser1796Ter) rs80357055
NM_007294.3(BRCA1):c.5388A>G (p.Ser1796=) rs373810778
NM_007294.3(BRCA1):c.53T>G (p.Met18Arg) rs80356929
NM_007294.3(BRCA1):c.5402G>A (p.Gly1801Asp) rs531210457
NM_007294.3(BRCA1):c.5406+17C>T rs1057522773
NM_007294.3(BRCA1):c.5406+33A>T rs80358092
NM_007294.3(BRCA1):c.5406+4_5406+7delAGTA rs1555575073
NM_007294.3(BRCA1):c.5406+5G>T rs80358073
NM_007294.3(BRCA1):c.5406+6T>A rs1555575074
NM_007294.3(BRCA1):c.5406+7A>G rs397509280
NM_007294.3(BRCA1):c.5406+8T>C rs55946644
NM_007294.3(BRCA1):c.5406+9T>C rs80358040
NM_007294.3(BRCA1):c.5406A>C (p.Thr1802=) rs879255493
NM_007294.3(BRCA1):c.5407-25T>A rs758780152
NM_007294.3(BRCA1):c.5407-4C>G rs876660347
NM_007294.3(BRCA1):c.5407-9G>A rs551078372
NM_007294.3(BRCA1):c.5407-9G>C rs551078372
NM_007294.3(BRCA1):c.5407-?_*(1_?)del
NM_007294.3(BRCA1):c.5411T>A (p.Val1804Asp) rs80356920
NM_007294.3(BRCA1):c.5412C>T (p.Val1804=) rs730881456
NM_007294.3(BRCA1):c.5415C>T (p.His1805=) rs1060504559
NM_007294.3(BRCA1):c.5423T>A (p.Val1808Glu) rs80357358
NM_007294.3(BRCA1):c.5425G>A (p.Val1809Ile) rs28897698
NM_007294.3(BRCA1):c.5427dup (p.Val1810Cysfs) rs1555574739
NM_007294.3(BRCA1):c.5429T>C (p.Val1810Ala) rs80357451
NM_007294.3(BRCA1):c.5430G>A (p.Val1810=) rs786201582
NM_007294.3(BRCA1):c.5432A>G (p.Gln1811Arg) rs80357040
NM_007294.3(BRCA1):c.543A>G (p.Glu181=) rs397507250
NM_007294.3(BRCA1):c.5444G>A (p.Trp1815Ter) rs80356962
NM_007294.3(BRCA1):c.5444G>C (p.Trp1815Ser)
NM_007294.3(BRCA1):c.544T>A (p.Leu182Met) rs1060502339
NM_007294.3(BRCA1):c.5456A>G (p.Asn1819Ser) rs80357286
NM_007294.3(BRCA1):c.5467+1G>A rs80358145
NM_007294.3(BRCA1):c.5467+5G>T
NM_007294.3(BRCA1):c.5467+8G>A rs80358062
NM_007294.3(BRCA1):c.5468-10C>A rs8176316
NM_007294.3(BRCA1):c.5468-10_5468-9delCT rs273902770
NM_007294.3(BRCA1):c.5468-18T>A rs80358157
NM_007294.3(BRCA1):c.5468-1G>A rs80358048
NM_007294.3(BRCA1):c.5468-2A>G rs398122699
NM_007294.3(BRCA1):c.5468-5T>G
NM_007294.3(BRCA1):c.547+14G>A rs932782447
NM_007294.3(BRCA1):c.547+14delG rs273902771
NM_007294.3(BRCA1):c.547+1G>A rs80358030
NM_007294.3(BRCA1):c.547+1G>C rs80358030
NM_007294.3(BRCA1):c.547+2T>A rs80358047
NM_007294.3(BRCA1):c.547+7G>A rs772583635
NM_007294.3(BRCA1):c.547+7G>C rs772583635
NM_007294.3(BRCA1):c.5470A>G (p.Ile1824Val) rs587782026
NM_007294.3(BRCA1):c.5470_5477delATTGGGCA (p.Ile1824Aspfs) rs80357973
NM_007294.3(BRCA1):c.5473G>A (p.Gly1825Arg) rs398122700
NM_007294.3(BRCA1):c.548-10A>T rs878854959
NM_007294.3(BRCA1):c.548-13G>T rs80358115
NM_007294.3(BRCA1):c.548-16G>A rs80358171
NM_007294.3(BRCA1):c.548-16G>T rs80358171
NM_007294.3(BRCA1):c.548-17G>T rs80358014
NM_007294.3(BRCA1):c.548-18T>G rs397507251
NM_007294.3(BRCA1):c.548-18delT rs398122701
NM_007294.3(BRCA1):c.548-18dup rs398122701
NM_007294.3(BRCA1):c.548-3T>C rs397507252
NM_007294.3(BRCA1):c.548-3delT rs398122353
NM_007294.3(BRCA1):c.548-9delA rs273902774
NM_007294.3(BRCA1):c.548-?_4185+?del
NM_007294.3(BRCA1):c.548-?_5074+?dup
NM_007294.3(BRCA1):c.5481G>A (p.Met1827Ile) rs587782432
NM_007294.3(BRCA1):c.5482T>G (p.Cys1828Gly) rs1060502342
NM_007294.3(BRCA1):c.5485G>A (p.Glu1829Lys) rs869320789
NM_007294.3(BRCA1):c.5485dupG (p.Glu1829Glyfs) rs768401297
NM_007294.3(BRCA1):c.5492C>G (p.Pro1831Arg) rs587782778
NM_007294.3(BRCA1):c.5497G>A (p.Val1833Met) rs80357268
NM_007294.3(BRCA1):c.549A>C (p.Gly183=) rs1555594077
NM_007294.3(BRCA1):c.5501C>T (p.Thr1834Ile) rs730881500
NM_007294.3(BRCA1):c.5503C>T (p.Arg1835Ter) rs41293465
NM_007294.3(BRCA1):c.5503dupC (p.Arg1835Profs) rs397509291
NM_007294.3(BRCA1):c.5504G>A (p.Arg1835Gln) rs273902776
NM_007294.3(BRCA1):c.5504G>C (p.Arg1835Pro) rs273902776
NM_007294.3(BRCA1):c.5506G>A (p.Glu1836Lys) rs80356942
NM_007294.3(BRCA1):c.5511G>T (p.Trp1837Cys) rs80356914
NM_007294.3(BRCA1):c.5512G>A (p.Val1838Met) rs730881501
NM_007294.3(BRCA1):c.5512G>T (p.Val1838Leu) rs730881501
NM_007294.3(BRCA1):c.5514G>T (p.Val1838=) rs786201248
NM_007294.3(BRCA1):c.5518G>A (p.Asp1840Asn)
NM_007294.3(BRCA1):c.551C>T (p.Ser184Phe) rs878854961
NM_007294.3(BRCA1):c.5521delA (p.Ser1841Valfs) rs80357721
NM_007294.3(BRCA1):c.5522G>C (p.Ser1841Thr) rs80357368
NM_007294.3(BRCA1):c.5523T>C (p.Ser1841=) rs878854960
NM_007294.3(BRCA1):c.5525delT (p.Val1842Glufs) rs864622220
NM_007294.3(BRCA1):c.5528C>A (p.Ala1843Glu) rs730881447
NM_007294.3(BRCA1):c.5528C>T (p.Ala1843Val) rs730881447
NM_007294.3(BRCA1):c.5538G>A (p.Gln1846=) rs80356849
NM_007294.3(BRCA1):c.5540G>T (p.Cys1847Phe)
NM_007294.3(BRCA1):c.5541C>T (p.Cys1847=) rs397509295
NM_007294.3(BRCA1):c.5550G>A (p.Leu1850=) rs786201502
NM_007294.3(BRCA1):c.5550G>C (p.Leu1850=) rs786201502
NM_007294.3(BRCA1):c.5558dupA (p.Tyr1853Terfs) rs80357629
NM_007294.3(BRCA1):c.5562G>A (p.Leu1854=) rs786201648
NM_007294.3(BRCA1):c.5565_5573delACCCCAGAT (p.Gln1857_Pro1859del) rs397507253
NM_007294.3(BRCA1):c.5566C>A (p.Pro1856Thr) rs80357274
NM_007294.3(BRCA1):c.5566C>T (p.Pro1856Ser) rs80357274
NM_007294.3(BRCA1):c.5568C>G (p.Pro1856=) rs876659994
NM_007294.3(BRCA1):c.5569delC (p.Gln1857Argfs) rs886039675
NM_007294.3(BRCA1):c.556T>G (p.Ser186Ala) rs397509298
NM_007294.3(BRCA1):c.5571_5579delGATCCCCCA (p.Gln1857_Pro1859del) rs775417240
NM_007294.3(BRCA1):c.5572A>C (p.Ile1858Leu) rs765656957
NM_007294.3(BRCA1):c.5572A>T (p.Ile1858Phe) rs765656957
NM_007294.3(BRCA1):c.5573T>C (p.Ile1858Thr) rs755427809
NM_007294.3(BRCA1):c.5574C>G (p.Ile1858Met) rs876659941
NM_007294.3(BRCA1):c.5575C>A (p.Pro1859Thr) rs1555574342
NM_007294.3(BRCA1):c.5575C>T (p.Pro1859Ser) rs1555574342
NM_007294.3(BRCA1):c.5576C>G (p.Pro1859Arg) rs80357322
NM_007294.3(BRCA1):c.5578dupC (p.His1860Profs) rs397507254
NM_007294.3(BRCA1):c.557C>A (p.Ser186Tyr) rs55688530
NM_007294.3(BRCA1):c.5585A>G (p.His1862Arg) rs80357183
NM_007294.3(BRCA1):c.5585A>T (p.His1862Leu) rs80357183
NM_007294.3(BRCA1):c.5586C>T (p.His1862=) rs774127304
NM_007294.3(BRCA1):c.5587T>G (p.Tyr1863Asp) rs763740623
NM_007294.3(BRCA1):c.564A>G (p.Glu188=) rs768065826
NM_007294.3(BRCA1):c.570C>T (p.Thr190=) rs201536070
NM_007294.3(BRCA1):c.571G>A (p.Val191Ile) rs80357090
NM_007294.3(BRCA1):c.576T>C (p.Asn192=) rs1555594046
NM_007294.3(BRCA1):c.577A>G (p.Lys193Glu) rs878854962
NM_007294.3(BRCA1):c.587A>T (p.Tyr196Phe) rs1555594039
NM_007294.3(BRCA1):c.591C>T (p.Cys197=) rs1799965
NM_007294.3(BRCA1):c.593+15A>G rs587780804
NM_007294.3(BRCA1):c.593+16C>A rs773139281
NM_007294.3(BRCA1):c.593+16C>G rs773139281
NM_007294.3(BRCA1):c.593+16C>T rs773139281
NM_007294.3(BRCA1):c.593+3G>A rs80358013
NM_007294.3(BRCA1):c.593+4delA rs1555594036
NM_007294.3(BRCA1):c.593+8A>G rs863224421
NM_007294.3(BRCA1):c.593+9A>G rs80358133
NM_007294.3(BRCA1):c.593+9_593+10delAA rs1555594025
NM_007294.3(BRCA1):c.593+9_593+12delAAGA rs753624573
NM_007294.3(BRCA1):c.594-12T>G rs1555593633
NM_007294.3(BRCA1):c.594-15G>C rs80358102
NM_007294.3(BRCA1):c.594-16dupT rs1555593635
NM_007294.3(BRCA1):c.594-18T>C rs864622306
NM_007294.3(BRCA1):c.594-20A>G rs80358017
NM_007294.3(BRCA1):c.594-2A>C rs80358033
NM_007294.3(BRCA1):c.594-4A>G rs80358081
NM_007294.3(BRCA1):c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC rs1555593640
NM_007294.3(BRCA1):c.605A>C (p.Gln202Pro) rs1060502366
NM_007294.3(BRCA1):c.60A>C (p.Lys20Asn) rs202168814
NM_007294.3(BRCA1):c.612G>C (p.Leu204Phe) rs80357394
NM_007294.3(BRCA1):c.615dup (p.Gln206Thrfs)
NM_007294.3(BRCA1):c.626C>T (p.Pro209Leu) rs201596327
NM_007294.3(BRCA1):c.628C>T (p.Gln210Ter) rs879255495
NM_007294.3(BRCA1):c.638G>A (p.Arg213Lys)
NM_007294.3(BRCA1):c.640G>A (p.Asp214Asn) rs786203797
NM_007294.3(BRCA1):c.640G>T (p.Asp214Tyr) rs786203797
NM_007294.3(BRCA1):c.641A>G (p.Asp214Gly) rs55680408
NM_007294.3(BRCA1):c.646A>G (p.Ile216Val) rs398122704
NM_007294.3(BRCA1):c.649delA (p.Ser217Valfs) rs878854963
NM_007294.3(BRCA1):c.650G>C (p.Ser217Thr) rs774284145
NM_007294.3(BRCA1):c.652T>C (p.Leu218=) rs765950064
NM_007294.3(BRCA1):c.654G>A (p.Leu218=) rs1555593548
NM_007294.3(BRCA1):c.659C>G (p.Ser220Cys) rs431825418
NM_007294.3(BRCA1):c.65T>C (p.Leu22Ser) rs80357438
NM_007294.3(BRCA1):c.65_66insTA (p.Leu22Phefs)
NM_007294.3(BRCA1):c.668delA (p.Lys223Argfs) rs80357537
NM_007294.3(BRCA1):c.66dupA (p.Glu23Argfs) rs80357783
NM_007294.3(BRCA1):c.670+10A>G rs1060504562
NM_007294.3(BRCA1):c.670+12G>A rs560661816
NM_007294.3(BRCA1):c.670+16G>A rs199916228
NM_007294.3(BRCA1):c.670+16G>T rs199916228
NM_007294.3(BRCA1):c.670+1G>T rs398122706
NM_007294.3(BRCA1):c.670+1delG rs886040922
NM_007294.3(BRCA1):c.670+5T>C rs1030987340
NM_007294.3(BRCA1):c.670+7G>A rs80358167
NM_007294.3(BRCA1):c.670+8C>T rs80358050
NM_007294.3(BRCA1):c.670G>A (p.Ala224Thr) rs431825419
NM_007294.3(BRCA1):c.671-12delG rs273902781
NM_007294.3(BRCA1):c.671-13delT rs8176152
NM_007294.3(BRCA1):c.671-15T>A rs80358058
NM_007294.3(BRCA1):c.671-18A>T rs746016001
NM_007294.3(BRCA1):c.671-2A>T rs80358108
NM_007294.3(BRCA1):c.671-6T>G rs878854964
NM_007294.3(BRCA1):c.671-8A>G rs80358144
NM_007294.3(BRCA1):c.671C>T (p.Ala224Val) rs1060502335
NM_007294.3(BRCA1):c.672T>G (p.Ala224=) rs1064794486
NM_007294.3(BRCA1):c.676delT (p.Cys226Valfs) rs80357941
NM_007294.3(BRCA1):c.685delT (p.Ser229Leufs) rs80357824
NM_007294.3(BRCA1):c.689_692delAGAC (p.Glu230Glyfs) rs886040308
NM_007294.3(BRCA1):c.68_69delAG (p.Glu23Valfs) rs386833395
NM_007294.3(BRCA1):c.692C>T (p.Thr231Met) rs80357001
NM_007294.3(BRCA1):c.693G>A (p.Thr231=) rs62625298
NM_007294.3(BRCA1):c.694G>A (p.Asp232Asn) rs55975699
NM_007294.3(BRCA1):c.695A>T (p.Asp232Val) rs398122708
NM_007294.3(BRCA1):c.697_698delGT (p.Val233Asnfs) rs80357747
NM_007294.3(BRCA1):c.69G>A (p.Glu23=) rs766004110
NM_007294.3(BRCA1):c.69G>C (p.Glu23Asp) rs766004110
NM_007294.3(BRCA1):c.6T>C (p.Asp2=) rs754763517
NM_007294.3(BRCA1):c.704A>G (p.Asn235Ser) rs1555593283
NM_007294.3(BRCA1):c.70_80delTGTCCCATCTG (p.Cys24Serfs) rs80357696
NM_007294.3(BRCA1):c.716A>T (p.His239Leu) rs80357396
NM_007294.3(BRCA1):c.733G>T (p.Asp245Tyr) rs147519994
NM_007294.3(BRCA1):c.734A>T (p.Asp245Val) rs80356865
NM_007294.3(BRCA1):c.736T>G (p.Leu246Val) rs28897675
NM_007294.3(BRCA1):c.738G>A (p.Leu246=) rs768416164
NM_007294.3(BRCA1):c.742A>G (p.Thr248Ala) rs879255288
NM_007294.3(BRCA1):c.744delC (p.Thr249Leufs) rs1060502360
NM_007294.3(BRCA1):c.74C>T (p.Pro25Leu) rs876660096
NM_007294.3(BRCA1):c.754delC (p.Arg252Valfs) rs1555593195
NM_007294.3(BRCA1):c.755G>A (p.Arg252His) rs80357138
NM_007294.3(BRCA1):c.756T>C (p.Arg252=) rs786201338
NM_007294.3(BRCA1):c.75C>T (p.Pro25=) rs80356839
NM_007294.3(BRCA1):c.765G>A (p.Glu255=) rs62625299
NM_007294.3(BRCA1):c.766A>T (p.Arg256Trp) rs587781833
NM_007294.3(BRCA1):c.767G>A (p.Arg256Lys) rs11658785
NM_007294.3(BRCA1):c.768G>A (p.Arg256=) rs746067447
NM_007294.3(BRCA1):c.773C>G (p.Pro258Arg) rs80357225
NM_007294.3(BRCA1):c.779dup (p.Tyr261Valfs)
NM_007294.3(BRCA1):c.788G>A (p.Gly263Asp) rs397509319
NM_007294.3(BRCA1):c.788dupG (p.Ser264Terfs) rs886040319
NM_007294.3(BRCA1):c.795T>C (p.Ser265=) rs201441987
NM_007294.3(BRCA1):c.796_807delGTTTCAAACTTGinsA (p.Val266Thrfs) rs1064792958
NM_007294.3(BRCA1):c.799T>C (p.Ser267Pro) rs587781496
NM_007294.3(BRCA1):c.80+14A>G rs1555600851
NM_007294.3(BRCA1):c.80+15G>C rs771594437
NM_007294.3(BRCA1):c.80+17G>A rs540373654
NM_007294.3(BRCA1):c.80+1G>T rs80358010
NM_007294.3(BRCA1):c.80+4A>T rs80358003
NM_007294.3(BRCA1):c.80+5G>C rs80358045
NM_007294.3(BRCA1):c.804C>T (p.Asn268=) rs771076131
NM_007294.3(BRCA1):c.807G>A (p.Leu269=) rs149867679
NM_007294.3(BRCA1):c.80G>T (p.Cys27Phe) rs1064793052
NM_007294.3(BRCA1):c.81-11delT rs273902788
NM_007294.3(BRCA1):c.81-12C>G rs80358055
NM_007294.3(BRCA1):c.81-12delC rs273902789
NM_007294.3(BRCA1):c.81-12dupC rs273902789
NM_007294.3(BRCA1):c.81-13C>A rs56328013
NM_007294.3(BRCA1):c.81-13C>G rs56328013
NM_007294.3(BRCA1):c.81-13C>T rs56328013
NM_007294.3(BRCA1):c.81-14C>T rs80358006
NM_007294.3(BRCA1):c.81-16C>A rs1057520829
NM_007294.3(BRCA1):c.81-17C>A rs757442952
NM_007294.3(BRCA1):c.81-17C>G rs757442952
NM_007294.3(BRCA1):c.81-18C>A rs864622534
NM_007294.3(BRCA1):c.81-1G>A rs80358018
NM_007294.3(BRCA1):c.81-2A>C rs397509326
NM_007294.3(BRCA1):c.81-6T>C rs80358179
NM_007294.3(BRCA1):c.81-9C>A
NM_007294.3(BRCA1):c.81-9C>G rs80358127
NM_007294.3(BRCA1):c.81-?_134+?del
NM_007294.3(BRCA1):c.81-?_4986+?del
NM_007294.3(BRCA1):c.811G>A (p.Val271Met) rs80357244
NM_007294.3(BRCA1):c.811G>C (p.Val271Leu) rs80357244
NM_007294.3(BRCA1):c.811G>T (p.Val271Leu) rs80357244
NM_007294.3(BRCA1):c.812T>C (p.Val271Ala) rs753099787
NM_007294.3(BRCA1):c.815_824dupAGCCATGTGG (p.Thr276Alafs) rs387906563
NM_007294.3(BRCA1):c.81T>C (p.Cys27=) rs587780805
NM_007294.3(BRCA1):c.823G>A (p.Gly275Ser) rs8176153
NM_007294.3(BRCA1):c.824G>A (p.Gly275Asp) rs397509327
NM_007294.3(BRCA1):c.825C>T (p.Gly275=) rs397509328
NM_007294.3(BRCA1):c.827C>A (p.Thr276Lys) rs80357436
NM_007294.3(BRCA1):c.827C>G (p.Thr276Arg) rs80357436
NM_007294.3(BRCA1):c.828A>G (p.Thr276=) rs186274774
NM_007294.3(BRCA1):c.834T>G (p.Thr278=) rs762956862
NM_007294.3(BRCA1):c.837T>C (p.His279=) rs775477245
NM_007294.3(BRCA1):c.843_846delCTCA (p.Ser282Tyrfs) rs80357919
NM_007294.3(BRCA1):c.84G>A (p.Leu28=) rs1555599278
NM_007294.3(BRCA1):c.862delA (p.Ser288Alafs) rs886040327
NM_007294.3(BRCA1):c.869T>C (p.Leu290Ser)
NM_007294.3(BRCA1):c.86A>G (p.Glu29Gly) rs773841328
NM_007294.3(BRCA1):c.875delT (p.Leu292Profs) rs886037981
NM_007294.3(BRCA1):c.878C>G (p.Thr293Ser)
NM_007294.3(BRCA1):c.881A>G (p.Lys294Arg) rs1555592934
NM_007294.3(BRCA1):c.884A>G (p.Asp295Gly) rs772684048
NM_007294.3(BRCA1):c.885C>T (p.Asp295=) rs1060504557
NM_007294.3(BRCA1):c.885_888delCAGA (p.Asp295Glufs) rs1060502359
NM_007294.3(BRCA1):c.889A>G (p.Met297Val) rs80357196
NM_007294.3(BRCA1):c.891G>A (p.Met297Ile) rs80357103
NM_007294.3(BRCA1):c.893_894delAT (p.Asn298Serfs) rs1555592891
NM_007294.3(BRCA1):c.898G>A (p.Glu300Lys) rs886040330
NM_007294.3(BRCA1):c.89T>A (p.Leu30Ter) rs397509331
NM_007294.3(BRCA1):c.900A>C (p.Glu300Asp) rs80356861
NM_007294.3(BRCA1):c.902A>G (p.Lys301Arg) rs878854965
NM_007294.3(BRCA1):c.914G>A (p.Cys305Tyr) rs751124745
NM_007294.3(BRCA1):c.918T>C (p.Asn306=) rs1555592835
NM_007294.3(BRCA1):c.919A>G (p.Lys307Glu) rs1216516227
NM_007294.3(BRCA1):c.922A>G (p.Ser308Gly) rs55767801
NM_007294.3(BRCA1):c.922_924delAGCinsT (p.Ser308Terfs) rs397509335
NM_007294.3(BRCA1):c.923G>A (p.Ser308Asn) rs561998108
NM_007294.3(BRCA1):c.923G>C (p.Ser308Thr) rs561998108
NM_007294.3(BRCA1):c.927A>G (p.Lys309=) rs757936216
NM_007294.3(BRCA1):c.941C>T (p.Ala314Val) rs863224766
NM_007294.3(BRCA1):c.946A>G (p.Ser316Gly) rs55874646
NM_007294.3(BRCA1):c.951A>G (p.Gln317=) rs759419385
NM_007294.3(BRCA1):c.952_1015del64 (p.His318Argfs) rs80359872
NM_007294.3(BRCA1):c.953A>G (p.His318Arg)
NM_007294.3(BRCA1):c.954delT (p.His318Glnfs)
NM_007294.3(BRCA1):c.962G>A (p.Trp321Ter) rs80357292
NM_007294.3(BRCA1):c.963G>A (p.Trp321Ter) rs886040335
NM_007294.3(BRCA1):c.964G>A (p.Ala322Thr) rs80357252
NM_007294.3(BRCA1):c.964G>C (p.Ala322Pro) rs80357252
NM_007294.3(BRCA1):c.969A>T (p.Gly323=) rs45586033
NM_007294.3(BRCA1):c.975G>A (p.Lys325=) rs786201624
NM_007294.3(BRCA1):c.97G>C (p.Glu33Gln) rs80357066
NM_007294.3(BRCA1):c.97G>T (p.Glu33Ter) rs80357066
NM_007294.3(BRCA1):c.981A>G (p.Thr327=) rs1800063
NM_007294.3(BRCA1):c.981_982delAT (p.Cys328Terfs) rs80357772
NM_007294.3(BRCA1):c.982T>C (p.Cys328Arg) rs748156170
NM_007294.3(BRCA1):c.982T>G (p.Cys328Gly)
NM_007294.3(BRCA1):c.985A>T (p.Asn329Tyr) rs786203732
NM_007294.3(BRCA1):c.987T>C (p.Asn329=) rs774849810
NM_007294.3(BRCA1):c.98A>C (p.Glu33Ala) rs876660844
NM_007294.3(BRCA1):c.990T>C (p.Asp330=) rs978690648
NM_007294.3(BRCA1):c.994C>T (p.Arg332Trp) rs80357176
NM_007294.3(BRCA1):c.995G>A (p.Arg332Gln) rs80357464
NM_007294.3(BRCA1):c.997A>G (p.Thr333Ala) rs786201634
NM_007299.3(BRCA1):c.1865_1868delGAAA rs80357867
NM_007299.3(BRCA1):c.2021-1442G>C rs397509275
NM_007299.3(BRCA1):c.787+11_787+12delTT rs80357724

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.