ClinVar Miner

List of variants in gene BRCA1 reported as pathogenic by Breast Cancer Information Core (BIC) (BRCA1)

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 846
Download table as spreadsheet
HGVS dbSNP
L824X
NG_005905.2:g.139830_166277del
NM_007294.3(BRCA1):c.1008dupA (p.Glu337Argfs) rs67284603
NM_007294.3(BRCA1):c.1011dupA (p.Val340Glyfs) rs80357569
NM_007294.3(BRCA1):c.1018delG (p.Val340Terfs) rs80357774
NM_007294.3(BRCA1):c.101delC (p.Pro34Leufs) rs80357750
NM_007294.3(BRCA1):c.1045G>T (p.Glu349Ter) rs80357338
NM_007294.3(BRCA1):c.1054G>T (p.Glu352Ter) rs80357472
NM_007294.3(BRCA1):c.1058G>A (p.Trp353Ter) rs80356908
NM_007294.3(BRCA1):c.1059G>A (p.Trp353Ter) rs80356935
NM_007294.3(BRCA1):c.1066C>T (p.Gln356Ter) rs80357215
NM_007294.3(BRCA1):c.1067delA (p.Gln356Argfs) rs80357796
NM_007294.3(BRCA1):c.1072delC (p.Leu358Cysfs) rs80357836
NM_007294.3(BRCA1):c.1082_1092delCAGAGAATCCT (p.Ser361Terfs) rs80359880
NM_007294.3(BRCA1):c.1086_1087delGA (p.Asn363Serfs) rs80357897
NM_007294.3(BRCA1):c.1086_1141del56 (p.Asn363Serfs) rs80359875
NM_007294.3(BRCA1):c.1088delA (p.Asn363Ilefs) rs80357954
NM_007294.3(BRCA1):c.1101_1102insC (p.Glu368Argfs) rs80357665
NM_007294.3(BRCA1):c.1102G>T (p.Glu368Ter) rs80357139
NM_007294.3(BRCA1):c.1116G>A (p.Trp372Ter) rs80357468
NM_007294.3(BRCA1):c.1121_1123delCACinsT (p.Thr374Ilefs) rs273897652
NM_007294.3(BRCA1):c.1121delC (p.Thr374Asnfs) rs80357612
NM_007294.3(BRCA1):c.1127delA (p.Asn376Ilefs) rs80357821
NM_007294.3(BRCA1):c.1129dupA (p.Ser377Lysfs) rs80357776
NM_007294.3(BRCA1):c.112_113delAA (p.Lys38Valfs) rs80357949
NM_007294.3(BRCA1):c.1141A>T (p.Lys381Ter) rs80357385
NM_007294.3(BRCA1):c.1165delA (p.Ser389Valfs) rs80357985
NM_007294.3(BRCA1):c.1166delG (p.Ser389Metfs) rs273897653
NM_007294.3(BRCA1):c.1175_1214del40 (p.Leu392Glnfs) rs80359874
NM_007294.3(BRCA1):c.117_118delTG (p.Cys39Terfs) rs80357972
NM_007294.3(BRCA1):c.1193C>G (p.Ser398Ter) rs80357068
NM_007294.3(BRCA1):c.1204delG (p.Glu402Serfs) rs80357859
NM_007294.3(BRCA1):c.1214C>A (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1240_1246delGACGTTC (p.Asp414Terfs) rs80357964
NM_007294.3(BRCA1):c.1241dupA (p.Asp414Glufs) rs80357514
NM_007294.3(BRCA1):c.124delA (p.Ile42Tyrfs) rs80357943
NM_007294.3(BRCA1):c.1252G>T (p.Glu418Ter) rs80357083
NM_007294.3(BRCA1):c.1255delG (p.Val419Terfs) rs80357535
NM_007294.3(BRCA1):c.1265dupA (p.Tyr422Terfs) rs80357809
NM_007294.3(BRCA1):c.1266T>G (p.Tyr422Ter) rs80357417
NM_007294.3(BRCA1):c.1276delT (p.Ser426Glnfs) rs80357766
NM_007294.3(BRCA1):c.1287dupA (p.Asp430Argfs) rs80357576
NM_007294.3(BRCA1):c.1292T>G (p.Leu431Ter) rs80357346
NM_007294.3(BRCA1):c.1292dupT (p.Leu431Phefs) rs80357528
NM_007294.3(BRCA1):c.1297delG (p.Ala433Profs) rs80357794
NM_007294.3(BRCA1):c.130delT (p.Cys44Alafs) rs80357951
NM_007294.3(BRCA1):c.1319delT (p.Leu440Terfs) rs80357683
NM_007294.3(BRCA1):c.1323_1324delAT (p.Ile441Metfs) rs80357570
NM_007294.3(BRCA1):c.1326_1327insGT (p.Lys443Valfs) rs80357543
NM_007294.3(BRCA1):c.1333G>T (p.Glu445Ter) rs80356915
NM_007294.3(BRCA1):c.1335_1336delAA (p.Arg446Serfs) rs80357978
NM_007294.3(BRCA1):c.134+1G>C rs80358043
NM_007294.3(BRCA1):c.134+1G>T rs80358043
NM_007294.3(BRCA1):c.134+2T>C rs80358131
NM_007294.3(BRCA1):c.134+2T>G rs80358131
NM_007294.3(BRCA1):c.1340_1341insG (p.His448Serfs) rs80357597
NM_007294.3(BRCA1):c.135-1G>C rs80358158
NM_007294.3(BRCA1):c.135-2A>G rs80358065
NM_007294.3(BRCA1):c.1352C>A (p.Ser451Ter) rs80356891
NM_007294.3(BRCA1):c.1352C>G (p.Ser451Ter) rs80356891
NM_007294.3(BRCA1):c.1356delA (p.Glu453Argfs) rs80357939
NM_007294.3(BRCA1):c.1360_1361delAG (p.Ser454Terfs) rs80357969
NM_007294.3(BRCA1):c.1380dupA (p.Phe461Ilefs) rs80357714
NM_007294.3(BRCA1):c.1383delT (p.Phe461Leufs) rs80357879
NM_007294.3(BRCA1):c.1386delG (p.Thr464Profs) rs80357722
NM_007294.3(BRCA1):c.1387delAinsGG (p.Lys463Glyfs)
NM_007294.3(BRCA1):c.1389_1390delAAinsG (p.Thr464Profs) rs273897659
NM_007294.3(BRCA1):c.1390delA (p.Thr464Profs) rs80357770
NM_007294.3(BRCA1):c.1392dupC (p.Tyr465Leufs) rs80357592
NM_007294.3(BRCA1):c.1399A>T (p.Lys467Ter) rs80357279
NM_007294.3(BRCA1):c.139dupT (p.Cys47Leufs) rs80357734
NM_007294.3(BRCA1):c.1421T>G (p.Leu474Ter) rs80357490
NM_007294.3(BRCA1):c.1439dupA (p.Asn480Lysfs) rs80357505
NM_007294.3(BRCA1):c.143delT (p.Met48Serfs) rs80357637
NM_007294.3(BRCA1):c.1440_1441insA (p.Leu481Thrfs) rs80357778
NM_007294.3(BRCA1):c.1444_1447delATTA (p.Ile482Terfs) rs80357801
NM_007294.3(BRCA1):c.1444delA (p.Ile482Leufs) rs80357648
NM_007294.3(BRCA1):c.144delG (p.Met48Ilefs) rs80357682
NM_007294.3(BRCA1):c.1450G>T (p.Gly484Ter) rs80357304
NM_007294.3(BRCA1):c.1462dupA (p.Thr488Asnfs) rs80357599
NM_007294.3(BRCA1):c.1471C>T (p.Gln491Ter) rs62625303
NM_007294.3(BRCA1):c.1480C>T (p.Gln494Ter) rs80357010
NM_007294.3(BRCA1):c.1492delC (p.Leu498Serfs) rs80357527
NM_007294.3(BRCA1):c.1501_1504delAAAT (p.Lys501Terfs) rs80357632
NM_007294.3(BRCA1):c.1504_1508delTTAAA (p.Leu502Alafs) rs80357888
NM_007294.3(BRCA1):c.1508delA (p.Lys503Serfs) rs80357506
NM_007294.3(BRCA1):c.150delA (p.Lys50Asnfs) rs273897662
NM_007294.3(BRCA1):c.1510delC (p.Arg504Valfs) rs80357908
NM_007294.3(BRCA1):c.1511dupG (p.Lys505Terfs) rs80357817
NM_007294.3(BRCA1):c.1518delG (p.Arg507Aspfs) rs80357947
NM_007294.3(BRCA1):c.1523delC (p.Pro508Leufs) rs80357782
NM_007294.3(BRCA1):c.1529C>G (p.Ser510Ter) rs80357427
NM_007294.3(BRCA1):c.1530delA (p.Gly511Alafs) rs80357735
NM_007294.3(BRCA1):c.1551delT (p.Phe517Leufs) rs80357630
NM_007294.3(BRCA1):c.1556delA (p.Lys519Argfs) rs80357662
NM_007294.3(BRCA1):c.1561_1562delGCinsTA (p.Ala521Ter) rs273897663
NM_007294.3(BRCA1):c.1576C>T (p.Gln526Ter) rs80356984
NM_007294.3(BRCA1):c.1583_1589delCTCCTGA (p.Thr528Lysfs) rs80357613
NM_007294.3(BRCA1):c.1608_1611delTAAC (p.Asn537Lysfs) rs80357698
NM_007294.3(BRCA1):c.160C>T (p.Gln54Ter) rs80356864
NM_007294.3(BRCA1):c.1612C>T (p.Gln538Ter) rs80356893
NM_007294.3(BRCA1):c.1621C>T (p.Gln541Ter) rs80356904
NM_007294.3(BRCA1):c.1630C>T (p.Gln544Ter) rs80356952
NM_007294.3(BRCA1):c.1636_1654del19 (p.Met546Valfs) rs80359881
NM_007294.3(BRCA1):c.1637_1685del49ins5
NM_007294.3(BRCA1):c.1649delA (p.Asn550Ilefs) rs80357619
NM_007294.3(BRCA1):c.165_166dupGA (p.Lys56Argfs) rs80357550
NM_007294.3(BRCA1):c.1674delA (p.Gly559Valfs) rs80357600
NM_007294.3(BRCA1):c.1695dupG (p.Lys566Glufs) rs273897664
NM_007294.3(BRCA1):c.1700dupA (p.Asn567Lysfs) rs80357784
NM_007294.3(BRCA1):c.1713_1717delAGAAT (p.Glu572Thrfs) rs80357640
NM_007294.3(BRCA1):c.171delG (p.Pro58Leufs) rs80357660
NM_007294.3(BRCA1):c.1729_1730delGA (p.Glu577Ilefs) rs80357834
NM_007294.3(BRCA1):c.1747A>T (p.Lys583Ter) rs80356928
NM_007294.3(BRCA1):c.1757delC (p.Pro586Leufs) rs80357723
NM_007294.3(BRCA1):c.1772delT (p.Ile591Lysfs) rs80357901
NM_007294.3(BRCA1):c.1789G>T (p.Glu597Ter) rs55650082
NM_007294.3(BRCA1):c.178C>T (p.Gln60Ter) rs80357471
NM_007294.3(BRCA1):c.1793T>A (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1793T>G (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.179delA (p.Gln60Argfs) rs80357591
NM_007294.3(BRCA1):c.1812delA (p.Ala605Hisfs) rs80357927
NM_007294.3(BRCA1):c.1819A>T (p.Lys607Ter) rs80357220
NM_007294.3(BRCA1):c.1823_1826delAGAA (p.Lys608Ilefs) rs80357585
NM_007294.3(BRCA1):c.1826delA (p.Asn609Ilefs) rs80357736
NM_007294.3(BRCA1):c.1837delA (p.Arg613Glyfs) rs80357652
NM_007294.3(BRCA1):c.1840A>T (p.Lys614Ter) rs80357282
NM_007294.3(BRCA1):c.1870G>T (p.Glu624Ter) rs80356950
NM_007294.3(BRCA1):c.1874_1877dupTAGT (p.Val627Serfs) rs80357516
NM_007294.3(BRCA1):c.1881_1884delCAGT (p.Ser628Glufs) rs80357567
NM_007294.3(BRCA1):c.188T>A (p.Leu63Ter) rs80357086
NM_007294.3(BRCA1):c.1892dupT (p.Ser632Lysfs) rs80357932
NM_007294.3(BRCA1):c.1893_1894insT (p.Ser632Terfs) rs80357768
NM_007294.3(BRCA1):c.1898delC (p.Pro633Hisfs) rs80357851
NM_007294.3(BRCA1):c.189dupA (p.Cys64Metfs) rs273897665
NM_007294.3(BRCA1):c.1912G>T (p.Glu638Ter) rs80357005
NM_007294.3(BRCA1):c.1912delG (p.Glu638Asnfs) rs80357933
NM_007294.3(BRCA1):c.1916T>A (p.Leu639Ter) rs80357267
NM_007294.3(BRCA1):c.191G>A (p.Cys64Tyr) rs55851803
NM_007294.3(BRCA1):c.1945G>T (p.Glu649Ter) rs80356907
NM_007294.3(BRCA1):c.1952dupA (p.Lys652Glufs) rs80357885
NM_007294.3(BRCA1):c.1953_1956delGAAA (p.Lys653Serfs) rs80357526
NM_007294.3(BRCA1):c.1953dupG (p.Lys652Glufs) rs80357753
NM_007294.3(BRCA1):c.195delG (p.Asn66Metfs) rs80357869
NM_007294.3(BRCA1):c.1960A>T (p.Lys654Ter) rs80357355
NM_007294.3(BRCA1):c.1960_1961delAA (p.Lys654Valfs) rs80357522
NM_007294.3(BRCA1):c.1961delA (p.Lys654Serfs) rs80357522
NM_007294.3(BRCA1):c.1961dupA (p.Tyr655Valfs) rs80357522
NM_007294.3(BRCA1):c.1996delC (p.Leu666Tyrfs) rs80357922
NM_007294.3(BRCA1):c.1999C>T (p.Gln667Ter) rs80356889
NM_007294.3(BRCA1):c.19_47del29 (p.Arg7Cysfs) rs80359871
NM_007294.3(BRCA1):c.1A>G (p.Met1Val) rs80357287
NM_007294.3(BRCA1):c.2001dupA (p.Leu668Thrfs) rs80357521
NM_007294.3(BRCA1):c.2017G>T (p.Glu673Ter) rs80357391
NM_007294.3(BRCA1):c.2017delG (p.Glu673Asnfs) rs80357638
NM_007294.3(BRCA1):c.2019delA (p.Glu673Aspfs) rs80357626
NM_007294.3(BRCA1):c.2035A>T (p.Lys679Ter) rs80357082
NM_007294.3(BRCA1):c.2038_2039insCC (p.Lys680Thrfs) rs80357940
NM_007294.3(BRCA1):c.2059C>T (p.Gln687Ter) rs273898674
NM_007294.3(BRCA1):c.205dupA (p.Thr69Asnfs) rs273898673
NM_007294.3(BRCA1):c.2070_2071delAA (p.Arg691Thrfs) rs80357688
NM_007294.3(BRCA1):c.2071delA (p.Arg691Aspfs) rs80357688
NM_007294.3(BRCA1):c.2074delC (p.His692Metfs) rs80357554
NM_007294.3(BRCA1):c.2077_2078insTA (p.Asp693Valfs) rs80357595
NM_007294.3(BRCA1):c.2079_2080delCA (p.Asp693Glufs) rs80357773
NM_007294.3(BRCA1):c.2105T>G (p.Leu702Ter) rs80357298
NM_007294.3(BRCA1):c.2105dupT (p.Leu702Phefs) rs80357880
NM_007294.3(BRCA1):c.2110_2111delAA (p.Asn704Cysfs) rs80357814
NM_007294.3(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.3(BRCA1):c.212+1G>A rs80358042
NM_007294.3(BRCA1):c.212+1G>C rs80358042
NM_007294.3(BRCA1):c.212+1G>T rs80358042
NM_007294.3(BRCA1):c.212+2T>C rs80358026
NM_007294.3(BRCA1):c.2125_2126insA (p.Phe709Tyrfs) rs80357871
NM_007294.3(BRCA1):c.212G>A (p.Arg71Lys) rs80356913
NM_007294.3(BRCA1):c.213-11T>G rs80358061
NM_007294.3(BRCA1):c.213-12A>G rs80358163
NM_007294.3(BRCA1):c.213-1G>A rs80358146
NM_007294.3(BRCA1):c.213-3C>G rs80358119
NM_007294.3(BRCA1):c.2138C>G (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2142delT (p.Asn714Lysfs) rs273898679
NM_007294.3(BRCA1):c.2157dupA (p.Glu720Argfs) rs80357715
NM_007294.3(BRCA1):c.2158G>T (p.Glu720Ter) rs80356875
NM_007294.3(BRCA1):c.2176delC (p.Leu726Phefs) rs80357668
NM_007294.3(BRCA1):c.2188G>T (p.Glu730Ter) rs80357058
NM_007294.3(BRCA1):c.2188_2201delGAAAAAGAAGAGAA (p.Glu730Thrfs) rs273898681
NM_007294.3(BRCA1):c.2188dupG (p.Glu730Glyfs) rs80357566
NM_007294.3(BRCA1):c.2194G>T (p.Glu732Ter) rs80357426
NM_007294.3(BRCA1):c.2197_2201delGAGAA (p.Glu733Thrfs) rs80357507
NM_007294.3(BRCA1):c.2199delG (p.Lys734Asnfs) rs80357944
NM_007294.3(BRCA1):c.2202delA (p.Lys734Asnfs) rs80357982
NM_007294.3(BRCA1):c.2203delC (p.Leu735Terfs) rs80357936
NM_007294.3(BRCA1):c.2206delG (p.Glu736Lysfs) rs80357860
NM_007294.3(BRCA1):c.220C>T (p.Gln74Ter) rs80357234
NM_007294.3(BRCA1):c.2210_2211delCA (p.Thr737Serfs) rs80357654
NM_007294.3(BRCA1):c.2210delC (p.Thr737Lysfs) rs80357793
NM_007294.3(BRCA1):c.2214delT (p.Val740Cysfs) rs80357574
NM_007294.3(BRCA1):c.2215A>T (p.Lys739Ter) rs56329598
NM_007294.3(BRCA1):c.2215_2216insCT (p.Lys739Thrfs) rs80357930
NM_007294.3(BRCA1):c.2217dupA (p.Val740Serfs) rs80357802
NM_007294.3(BRCA1):c.2236dupG (p.Asp746Glyfs) rs80357909
NM_007294.3(BRCA1):c.2241delC (p.Asp749Ilefs) rs80357650
NM_007294.3(BRCA1):c.224_227delAAAG (p.Glu75Valfs) rs80357697
NM_007294.3(BRCA1):c.2253_2254delGT (p.Met751Ilefs) rs80357602
NM_007294.3(BRCA1):c.2255_2256dupTA (p.Ser753Terfs) rs80357557
NM_007294.3(BRCA1):c.2263G>T (p.Glu755Ter) rs41286296
NM_007294.3(BRCA1):c.2263delG (p.Glu755Lysfs) rs80357960
NM_007294.3(BRCA1):c.2269delG (p.Val757Phefs) rs80357583
NM_007294.3(BRCA1):c.2273dupT (p.Leu758Phefs) rs80357681
NM_007294.3(BRCA1):c.2275C>T (p.Gln759Ter) rs80356999
NM_007294.3(BRCA1):c.2283_2284delAA (p.Arg762Ilefs) rs80357657
NM_007294.3(BRCA1):c.2293G>T (p.Glu765Ter) rs80357449
NM_007294.3(BRCA1):c.2296_2297delAG (p.Ser766Terfs) rs80357780
NM_007294.3(BRCA1):c.2299delA (p.Ser767Alafs) rs80357786
NM_007294.3(BRCA1):c.2309C>A (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2309C>T (p.Ser770Leu) rs80357063
NM_007294.3(BRCA1):c.2314delG (p.Val772Tyrfs) rs80357957
NM_007294.3(BRCA1):c.2329delT (p.Tyr777Metfs) rs80357725
NM_007294.3(BRCA1):c.232delA (p.Arg78Aspfs) rs80357884
NM_007294.3(BRCA1):c.2331T>A (p.Tyr777Ter) rs80357444
NM_007294.3(BRCA1):c.2337_2338delTC (p.Gln780Glyfs) rs80357515
NM_007294.3(BRCA1):c.2338C>T (p.Gln780Ter) rs80356945
NM_007294.3(BRCA1):c.2351_2357delCGTTACT (p.Ser784Trpfs) rs80357820
NM_007294.3(BRCA1):c.2355dupA (p.Leu786Thrfs) rs80357990
NM_007294.3(BRCA1):c.2359dupG (p.Glu787Glyfs) rs80357739
NM_007294.3(BRCA1):c.2376delG (p.Lys793Argfs) rs80357913
NM_007294.3(BRCA1):c.2389G>T (p.Glu797Ter) rs62625306
NM_007294.3(BRCA1):c.2389_2390delGA (p.Glu797Thrfs) rs80357695
NM_007294.3(BRCA1):c.2390_2391delAA (p.Glu797Alafs) rs80357546
NM_007294.3(BRCA1):c.2393delC (p.Pro798Glnfs) rs80357850
NM_007294.3(BRCA1):c.2403T>A (p.Cys801Ter) rs80357381
NM_007294.3(BRCA1):c.2405_2406delTG (p.Val802Glufs) rs80357706
NM_007294.3(BRCA1):c.2406_2409delGAGT (p.Gln804Valfs) rs80357674
NM_007294.3(BRCA1):c.2410C>T (p.Gln804Ter) rs80356982
NM_007294.3(BRCA1):c.2411_2412delAG (p.Gln804Leufs) rs80357664
NM_007294.3(BRCA1):c.241C>T (p.Gln81Ter) rs80357350
NM_007294.3(BRCA1):c.2433delC (p.Lys812Argfs) rs80357524
NM_007294.3(BRCA1):c.2437G>T (p.Gly813Ter) rs80357186
NM_007294.3(BRCA1):c.2438dupG (p.Leu814Thrfs) rs80357503
NM_007294.3(BRCA1):c.2443delA (p.Ile815Phefs) rs80357598
NM_007294.3(BRCA1):c.2450delG (p.Gly817Valfs) rs80357679
NM_007294.3(BRCA1):c.2457delC (p.Asp821Ilefs) rs80357669
NM_007294.3(BRCA1):c.2468delG (p.Arg823Lysfs) rs80357799
NM_007294.3(BRCA1):c.2474dupA (p.Asp825Glufs) rs80357830
NM_007294.3(BRCA1):c.2475delC (p.Asp825Glufs) rs80357970
NM_007294.3(BRCA1):c.2476delA (p.Thr826Glnfs) rs80357631
NM_007294.3(BRCA1):c.2477_2478delCA (p.Thr826Argfs) rs80357800
NM_007294.3(BRCA1):c.2477delC (p.Thr826Lysfs) rs80357740
NM_007294.3(BRCA1):c.2487delT (p.Phe829Leufs) rs80357658
NM_007294.3(BRCA1):c.2488_2497dupAAGTATCCAT (p.Leu833Terfs) rs397508973
NM_007294.3(BRCA1):c.2504_2505ins17 (p.?)
NM_007294.3(BRCA1):c.2513delA (p.Asn838Thrfs) rs80357863
NM_007294.3(BRCA1):c.2515delC (p.His839Thrfs) rs80357607
NM_007294.3(BRCA1):c.2545G>T (p.Glu849Ter) rs80356951
NM_007294.3(BRCA1):c.2558dupA (p.Asp853Glufs) rs80357835
NM_007294.3(BRCA1):c.2560_2561dupGC (p.Gln855Leufs) rs80357968
NM_007294.3(BRCA1):c.2563C>T (p.Gln855Ter) rs80357131
NM_007294.3(BRCA1):c.2568T>G (p.Tyr856Ter) rs80356832
NM_007294.3(BRCA1):c.2586_2593delGGTTTCAA (p.Val863Alafs) rs80357675
NM_007294.3(BRCA1):c.2594delA (p.Lys865Serfs) rs80357756
NM_007294.3(BRCA1):c.2601_2604dupGTCA (p.Phe869Valfs) rs80357603
NM_007294.3(BRCA1):c.2603C>G (p.Ser868Ter) rs80356925
NM_007294.3(BRCA1):c.2611_2612delCC (p.Pro871Valfs) rs80357962
NM_007294.3(BRCA1):c.2612_2613insT (p.Phe872Valfs) rs80357948
NM_007294.3(BRCA1):c.2617dupT (p.Ser873Phefs) rs80357912
NM_007294.3(BRCA1):c.2646_2648delTGC (p.Cys882_Ser1217delinsTer) rs80357513
NM_007294.3(BRCA1):c.2658_2659insA (p.Ala887Serfs) rs80357541
NM_007294.3(BRCA1):c.2670delG (p.Ser891Profs) rs80357659
NM_007294.3(BRCA1):c.2675_2678delTAAA (p.Leu892Terfs) rs80357518
NM_007294.3(BRCA1):c.2679_2682delGAAA (p.Lys893Asnfs) rs80357596
NM_007294.3(BRCA1):c.2681_2682delAA (p.Lys894Thrfs) rs80357971
NM_007294.3(BRCA1):c.2685_2686delAA (p.Pro897Lysfs) rs80357636
NM_007294.3(BRCA1):c.2686delA (p.Ser896Valfs) rs80357636
NM_007294.3(BRCA1):c.2694dupA (p.Val899Serfs) rs80357549
NM_007294.3(BRCA1):c.269_281delTTTGTGCTTTTCA (p.Ile90Serfs) rs80359879
NM_007294.3(BRCA1):c.2702_2703delTT (p.Phe901Terfs) rs80357899
NM_007294.3(BRCA1):c.2706_2707dupAT (p.Cys903Tyrfs) rs80357717
NM_007294.3(BRCA1):c.2709delT (p.Cys903Trpfs) rs80357594
NM_007294.3(BRCA1):c.2710G>T (p.Glu904Ter) rs80357035
NM_007294.3(BRCA1):c.2719_2722delGAAG (p.Glu907Lysfs) rs80357731
NM_007294.3(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.3(BRCA1):c.2726_2730delATCAA (p.Asn909Argfs) rs80357712
NM_007294.3(BRCA1):c.2726delA (p.Asn909Ilefs) rs80357614
NM_007294.3(BRCA1):c.2726dupA (p.Asn909Lysfs) rs80357614
NM_007294.3(BRCA1):c.2727_2730delTCAA (p.Asn909Lysfs) rs80357605
NM_007294.3(BRCA1):c.2740G>T (p.Glu914Ter) rs80357419
NM_007294.3(BRCA1):c.2744_2745delCT (p.Ser915Terfs) rs80357540
NM_007294.3(BRCA1):c.2749dupA (p.Ile917Asnfs) rs80357942
NM_007294.3(BRCA1):c.2761C>T (p.Gln921Ter) rs80357377
NM_007294.3(BRCA1):c.2762delA (p.Gln921Argfs) rs80357703
NM_007294.3(BRCA1):c.2764_2767delACAG (p.Thr922Leufs) rs80357822
NM_007294.3(BRCA1):c.2766delA (p.Val923Leufs) rs80357812
NM_007294.3(BRCA1):c.2767_2770delGTTA (p.Val923Ilefs) rs80357661
NM_007294.3(BRCA1):c.2796_2799delTGGT (p.Gly933Argfs) rs80357840
NM_007294.3(BRCA1):c.2799delT (p.Gln934Argfs) rs80357998
NM_007294.3(BRCA1):c.2800C>T (p.Gln934Ter) rs80357223
NM_007294.3(BRCA1):c.2805delA (p.Asp936Ilefs) rs397509012
NM_007294.3(BRCA1):c.2806_2809delGATA (p.Asp936Serfs) rs80357832
NM_007294.3(BRCA1):c.2812_2813delCCinsG (p.Pro938Glufs) rs273899689
NM_007294.3(BRCA1):c.2832T>A (p.Cys944Ter) rs80357458
NM_007294.3(BRCA1):c.2834_2836delGTAinsC (p.Ser945Thrfs) rs386134270
NM_007294.3(BRCA1):c.2835dupT (p.Ile946Tyrfs) rs80357519
NM_007294.3(BRCA1):c.2840_2841delAA (p.Lys947Argfs) rs80357984
NM_007294.3(BRCA1):c.2864C>A (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2866_2870delTCTCA (p.Ser956Valfs) rs80357819
NM_007294.3(BRCA1):c.2868delT (p.Gln957Serfs) rs80357929
NM_007294.3(BRCA1):c.2869C>T (p.Gln957Ter) rs80356973
NM_007294.3(BRCA1):c.2871_2872insA (p.Phe958Ilefs) rs80357693
NM_007294.3(BRCA1):c.2887delA (p.Thr963Leufs) rs80357559
NM_007294.3(BRCA1):c.2889_2890delTG (p.Gly964Thrfs) rs80357890
NM_007294.3(BRCA1):c.288_292delCACAGins7
NM_007294.3(BRCA1):c.290_291delCA (p.Thr97Argfs) rs80357738
NM_007294.3(BRCA1):c.2910delA (p.Lys970Asnfs) rs80357893
NM_007294.3(BRCA1):c.2915delG (p.Gly972Aspfs) rs80357573
NM_007294.3(BRCA1):c.2920_2921delTT (p.Leu974Thrfs) rs80357611
NM_007294.3(BRCA1):c.2921T>A (p.Leu974Ter) rs80356872
NM_007294.3(BRCA1):c.2923C>T (p.Gln975Ter) rs80357497
NM_007294.3(BRCA1):c.2934T>G (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934delT (p.Arg979Valfs) rs80357741
NM_007294.3(BRCA1):c.2940delA (p.Pro981Hisfs) rs80357876
NM_007294.3(BRCA1):c.2952delT (p.Ile986Serfs) rs80357627
NM_007294.3(BRCA1):c.2980delT (p.Cys994Valfs) rs80357502
NM_007294.3(BRCA1):c.2989_2990dupAA (p.Asn997Lysfs) rs80357829
NM_007294.3(BRCA1):c.2995_2996delCTinsTA (p.Leu999Ter) rs273899692
NM_007294.3(BRCA1):c.2999delA (p.Glu1000Glyfs) rs80357991
NM_007294.3(BRCA1):c.2T>C (p.Met1Thr) rs80357111
NM_007294.3(BRCA1):c.2T>G (p.Met1Arg) rs80357111
NM_007294.3(BRCA1):c.3005delA (p.Asn1002Thrfs) rs80357601
NM_007294.3(BRCA1):c.3008_3009delTT (p.Phe1003Terfs) rs80357617
NM_007294.3(BRCA1):c.301+2dupT rs273899694
NM_007294.3(BRCA1):c.3013delG (p.Glu1005Asnfs) rs80357937
NM_007294.3(BRCA1):c.3018_3021delTTCA (p.His1006Glnfs) rs80357749
NM_007294.3(BRCA1):c.302-1G>A rs80358116
NM_007294.3(BRCA1):c.302-1G>T rs80358116
NM_007294.3(BRCA1):c.302-2A>C rs80358011
NM_007294.3(BRCA1):c.302-2A>T rs80358011
NM_007294.3(BRCA1):c.302-2_302-1del rs483353093
NM_007294.3(BRCA1):c.302-2delA rs273899695
NM_007294.3(BRCA1):c.302-3C>G rs80358051
NM_007294.3(BRCA1):c.3020C>G (p.Ser1007Ter) rs80357168
NM_007294.3(BRCA1):c.3026C>A (p.Ser1009Ter) rs273899696
NM_007294.3(BRCA1):c.3029_3030delCT (p.Pro1010Argfs) rs80357510
NM_007294.3(BRCA1):c.303T>G (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.3044dupG (p.Asn1016Lysfs) rs80357746
NM_007294.3(BRCA1):c.3048_3052dupTGAGA (p.Asn1018Metfs) rs80357856
NM_007294.3(BRCA1):c.3049G>T (p.Glu1017Ter) rs80357004
NM_007294.3(BRCA1):c.3053_3054insTGAGA (p.Ile1019Glufs) rs80357547
NM_007294.3(BRCA1):c.3084_3094delTAATAACATTA (p.Asn1029Argfs) rs80357647
NM_007294.3(BRCA1):c.3087_3100dup (p.Asn1034Ilefs) rs80357967
NM_007294.3(BRCA1):c.3097G>T (p.Glu1033Ter) rs273899698
NM_007294.3(BRCA1):c.3107_3112delTTAAAG (p.Phe1036_Cys1372delinsTer) rs80357920
NM_007294.3(BRCA1):c.3108delT (p.Phe1036Leufs) rs80357841
NM_007294.3(BRCA1):c.3108dupT (p.Lys1037Terfs) rs80357841
NM_007294.3(BRCA1):c.3114_3117delAGCCinsGA (p.Ala1039Lysfs) rs273899700
NM_007294.3(BRCA1):c.3158_3159insG (p.Val1054Serfs) rs80357769
NM_007294.3(BRCA1):c.3178G>T (p.Glu1060Ter) rs80357424
NM_007294.3(BRCA1):c.317delA (p.Asn106Ilefs) rs80357950
NM_007294.3(BRCA1):c.3181delA (p.Ile1061Terfs) rs80357702
NM_007294.3(BRCA1):c.3188_3189delCCinsG (p.Ser1063Terfs) rs273899701
NM_007294.3(BRCA1):c.3193dupG (p.Asp1065Glyfs) rs80357511
NM_007294.3(BRCA1):c.3194_3195insG (p.Asp1065Glufs) rs80357883
NM_007294.3(BRCA1):c.321delT (p.Phe107Leufs) rs80357544
NM_007294.3(BRCA1):c.3226delA (p.Arg1076Glufs) rs273899703
NM_007294.3(BRCA1):c.3228_3229delAG (p.Gly1077Alafs) rs80357635
NM_007294.3(BRCA1):c.3239T>A (p.Leu1080Ter) rs80357145
NM_007294.3(BRCA1):c.3253dupA (p.Arg1085Lysfs) rs80357517
NM_007294.3(BRCA1):c.3254_3255dupGA (p.Leu1086Aspfs) rs80357624
NM_007294.3(BRCA1):c.3255dupA (p.Leu1086Ilefs) rs1555588090
NM_007294.3(BRCA1):c.3256_3257insGA (p.Leu1086Terfs) rs80357764
NM_007294.3(BRCA1):c.3257T>A (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3257T>G (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3257dupT (p.Leu1086Phefs) rs80357858
NM_007294.3(BRCA1):c.3268C>T (p.Gln1090Ter) rs80357402
NM_007294.3(BRCA1):c.3279delC (p.Tyr1094Ilefs) rs397509050
NM_007294.3(BRCA1):c.3286C>T (p.Gln1096Ter) rs80357485
NM_007294.3(BRCA1):c.3286delC (p.Gln1096Lysfs) rs80357533
NM_007294.3(BRCA1):c.3288_3289delAA (p.Leu1098Serfs) rs80357686
NM_007294.3(BRCA1):c.3288_3289ins46 (p.?)
NM_007294.3(BRCA1):c.3292_3293delCT (p.Leu1098Serfs) rs80357992
NM_007294.3(BRCA1):c.3296delC (p.Pro1099Leufs) rs80357815
NM_007294.3(BRCA1):c.329_330delAG (p.Lys110Argfs) rs80357754
NM_007294.3(BRCA1):c.329dupA (p.Glu111Glyfs) rs80357604
NM_007294.3(BRCA1):c.32_33insC (p.Gln12Thrfs) rs80357811
NM_007294.3(BRCA1):c.3309T>A (p.Cys1103Ter) rs80357317
NM_007294.3(BRCA1):c.3319G>T (p.Glu1107Ter) rs80357106
NM_007294.3(BRCA1):c.3323_3326delTAAA (p.Ile1108Lysfs) rs80357763
NM_007294.3(BRCA1):c.3325_3329delAAAAA (p.Lys1109Alafs) rs80357575
NM_007294.3(BRCA1):c.3326_3329delAAAA (p.Lys1109Serfs) rs80357575
NM_007294.3(BRCA1):c.3329_3330delAG (p.Lys1110Thrfs) rs80357525
NM_007294.3(BRCA1):c.3329dupA (p.Gln1111Alafs) rs80357575
NM_007294.3(BRCA1):c.3330_3331insA (p.Gln1111Thrfs) rs80357996
NM_007294.3(BRCA1):c.3331C>T (p.Gln1111Ter) rs80357089
NM_007294.3(BRCA1):c.3331_3334delCAAG (p.Gln1111Asnfs) rs80357701
NM_007294.3(BRCA1):c.3333delA (p.Glu1112Asnfs) rs80357966
NM_007294.3(BRCA1):c.3339T>G (p.Tyr1113Ter) rs80357421
NM_007294.3(BRCA1):c.3340G>T (p.Glu1114Ter) rs80357278
NM_007294.3(BRCA1):c.3343delG (p.Glu1115Lysfs) rs273899705
NM_007294.3(BRCA1):c.3351dupT (p.Gln1118Serfs) rs80357785
NM_007294.3(BRCA1):c.3357delT (p.Val1120Leufs) rs80357827
NM_007294.3(BRCA1):c.3358_3359delGT (p.Val1120Terfs) rs80357945
NM_007294.3(BRCA1):c.3359_3360delTT (p.Val1120Glufs) rs80357843
NM_007294.3(BRCA1):c.3362delA (p.Asn1121Ilefs) rs80357865
NM_007294.3(BRCA1):c.3365_3366delCA (p.Thr1122Argfs) rs80357892
NM_007294.3(BRCA1):c.3375_3376delTC (p.Pro1126Ilefs) rs80357828
NM_007294.3(BRCA1):c.3389C>G (p.Ser1130Ter) rs80357405
NM_007294.3(BRCA1):c.3390delA (p.Asp1131Ilefs) rs80357900
NM_007294.3(BRCA1):c.3397_3398delTT (p.Leu1133Argfs) rs80357577
NM_007294.3(BRCA1):c.3398T>A (p.Leu1133Ter) rs80356971
NM_007294.3(BRCA1):c.3400G>T (p.Glu1134Ter) rs80357018
NM_007294.3(BRCA1):c.3403C>T (p.Gln1135Ter) rs80357136
NM_007294.3(BRCA1):c.3417delT (p.Ser1139Argfs) rs273899706
NM_007294.3(BRCA1):c.342_343delTC (p.Pro115Terfs) rs80357881
NM_007294.3(BRCA1):c.3430C>T (p.Gln1144Ter) rs80357369
NM_007294.3(BRCA1):c.3442delG (p.Glu1148Argfs) rs80357808
NM_007294.3(BRCA1):c.3462dupA (p.Asp1155Argfs) rs80357857
NM_007294.3(BRCA1):c.3477_3479delAAAinsC (p.Lys1160Glyfs) rs273899707
NM_007294.3(BRCA1):c.3477_3480delAAAG (p.Ile1159Metfs) rs80357781
NM_007294.3(BRCA1):c.3481_3491delGAAGATACTAG (p.Glu1161Phefs) rs80357877
NM_007294.3(BRCA1):c.3485delA (p.Asp1162Valfs) rs80357509
NM_007294.3(BRCA1):c.34C>T (p.Gln12Ter) rs80357134
NM_007294.3(BRCA1):c.3516_3517ins100 (p.?)
NM_007294.3(BRCA1):c.3531delT (p.Phe1177Leufs) rs80357621
NM_007294.3(BRCA1):c.3544C>T (p.Gln1182Ter) rs80357296
NM_007294.3(BRCA1):c.3548_3549delAA (p.Lys1183Argfs) rs80357956
NM_007294.3(BRCA1):c.3549_3550delAGinsT (p.Lys1183Asnfs) rs273899709
NM_007294.3(BRCA1):c.3569_3570delCT (p.Pro1190Glnfs) rs80357845
NM_007294.3(BRCA1):c.3571_3572ins4
NM_007294.3(BRCA1):c.3580delA (p.Thr1194Profs) rs80357663
NM_007294.3(BRCA1):c.3583delC (p.His1195Ilefs) rs273900710
NM_007294.3(BRCA1):c.3586dupA (p.Thr1196Asnfs) rs80357531
NM_007294.3(BRCA1):c.3592_3593dupTT (p.Leu1198Phefs) rs80357562
NM_007294.3(BRCA1):c.3598C>T (p.Gln1200Ter) rs62625307
NM_007294.3(BRCA1):c.3612delA (p.Ala1206Profs) rs80357980
NM_007294.3(BRCA1):c.3619A>T (p.Lys1207Ter) rs80357455
NM_007294.3(BRCA1):c.3620dupA (p.Lys1208Glufs) rs80357926
NM_007294.3(BRCA1):c.3624dupA (p.Leu1209Ilefs) rs80357512
NM_007294.3(BRCA1):c.3626delT (p.Leu1209Terfs) rs80357571
NM_007294.3(BRCA1):c.3627dupA (p.Glu1210Argfs) rs80357729
NM_007294.3(BRCA1):c.3629_3630delAG (p.Glu1210Valfs) rs80357589
NM_007294.3(BRCA1):c.3640G>T (p.Glu1214Ter) rs80356923
NM_007294.3(BRCA1):c.3642_3643delGA (p.Asn1215Leufs) rs80357805
NM_007294.3(BRCA1):c.3648dupA (p.Ser1217Ilefs) rs80357902
NM_007294.3(BRCA1):c.3649_3650insA (p.Ser1217Tyrfs) rs80357831
NM_007294.3(BRCA1):c.3661G>T (p.Glu1221Ter) rs80357310
NM_007294.3(BRCA1):c.3664G>T (p.Glu1222Ter) rs80357356
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.3671_3672ins4
NM_007294.3(BRCA1):c.3676_3679delTTCC (p.Phe1226Asnfs) rs80357671
NM_007294.3(BRCA1):c.3689T>G (p.Leu1230Ter) rs80357162
NM_007294.3(BRCA1):c.3699delA (p.Val1234Terfs) rs80357873
NM_007294.3(BRCA1):c.3700_3704delGTAAA (p.Val1234Glnfs) rs80357609
NM_007294.3(BRCA1):c.3706_3707delAA (p.Asn1236Tyrfs) rs80357666
NM_007294.3(BRCA1):c.3706_3713delAATATACC (p.Asn1236Phefs) rs80357552
NM_007294.3(BRCA1):c.3710delT (p.Ile1237Asnfs) rs80357564
NM_007294.3(BRCA1):c.3715_3717delTCTinsC (p.Ser1239Profs) rs273900714
NM_007294.3(BRCA1):c.3718C>T (p.Gln1240Ter) rs80356903
NM_007294.3(BRCA1):c.3722_3740del19 (p.Ser1241Leufs) rs80359882
NM_007294.3(BRCA1):c.3736delA (p.Thr1246Profs) rs80357578
NM_007294.3(BRCA1):c.3748G>T (p.Glu1250Ter) rs28897686
NM_007294.3(BRCA1):c.3756_3759delGTCT (p.Ser1253Argfs) rs80357868
NM_007294.3(BRCA1):c.3759_3760delTA (p.Lys1254Glufs) rs80357520
NM_007294.3(BRCA1):c.3759dupT (p.Lys1254Terfs) rs80357687
NM_007294.3(BRCA1):c.3760_3761insT (p.Lys1254Ilefs) rs80357986
NM_007294.3(BRCA1):c.3761_3762insTT (p.Lys1254Asnfs) rs80357928
NM_007294.3(BRCA1):c.3762_3763delGA (p.Asn1255Hisfs) rs80357645
NM_007294.3(BRCA1):c.3764dupA (p.Asn1255Lysfs) rs80357848
NM_007294.3(BRCA1):c.3766dupA (p.Thr1256Asnfs) rs80357704
NM_007294.3(BRCA1):c.3770_3771delAG (p.Glu1257Glyfs) rs80357579
NM_007294.3(BRCA1):c.3771_3772delGG (p.Asn1259Phefs) rs80357810
NM_007294.3(BRCA1):c.3778_3779insA (p.Leu1260Tyrfs) rs80357849
NM_007294.3(BRCA1):c.3779delT (p.Leu1260Tyrfs) rs80357798
NM_007294.3(BRCA1):c.3782delT (p.Leu1261Tyrfs) rs80357545
NM_007294.3(BRCA1):c.3785C>A (p.Ser1262Ter) rs80357269
NM_007294.3(BRCA1):c.3794delA (p.Asn1265Ilefs) rs80357767
NM_007294.3(BRCA1):c.37_40delAATG (p.Asn13Serfs) rs80357530
NM_007294.3(BRCA1):c.3817C>T (p.Gln1273Ter) rs80357208
NM_007294.3(BRCA1):c.3820dupG (p.Val1274Glyfs) rs80357616
NM_007294.3(BRCA1):c.3830dupC (p.Ala1279Glyfs) rs80357878
NM_007294.3(BRCA1):c.3839_3843delCTCAGinsAGGC (p.Ser1280Terfs) rs273900717
NM_007294.3(BRCA1):c.3841C>T (p.Gln1281Ter) rs80356866
NM_007294.3(BRCA1):c.3841_3842delCA (p.Gln1281Glyfs) rs80357584
NM_007294.3(BRCA1):c.3856delA (p.Ser1286Valfs) rs80357855
NM_007294.3(BRCA1):c.3858_3861delTGAG (p.Ser1286Argfs) rs80357842
NM_007294.3(BRCA1):c.3862delG (p.Glu1288Lysfs) rs273900718
NM_007294.3(BRCA1):c.3867_3871delAAAAT (p.Lys1290Phefs) rs80357560
NM_007294.3(BRCA1):c.3868A>T (p.Lys1290Ter) rs80357254
NM_007294.3(BRCA1):c.3869_3870delAA (p.Lys1290Metfs) rs80357918
NM_007294.3(BRCA1):c.3893C>A (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3895C>T (p.Gln1299Ter) rs80357038
NM_007294.3(BRCA1):c.3901_3902delAG (p.Ser1301Terfs) rs80357646
NM_007294.3(BRCA1):c.3904G>T (p.Glu1302Ter) rs80357461
NM_007294.3(BRCA1):c.3908dupT (p.Leu1303Phefs) rs80357634
NM_007294.3(BRCA1):c.390C>A (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.3916_3917delTT (p.Leu1306Aspfs) rs80357678
NM_007294.3(BRCA1):c.391A>T (p.Arg131Ter) rs80357207
NM_007294.3(BRCA1):c.3931_3934delAACA (p.Asn1311Profs) rs80357864
NM_007294.3(BRCA1):c.3932delA (p.Asn1311Thrfs) rs80357504
NM_007294.3(BRCA1):c.3937C>T (p.Gln1313Ter) rs80357318
NM_007294.3(BRCA1):c.3964A>T (p.Lys1322Ter) rs80357343
NM_007294.3(BRCA1):c.3966delA (p.Lys1322Asnfs) rs80357979
NM_007294.3(BRCA1):c.3967C>T (p.Gln1323Ter) rs80357262
NM_007294.3(BRCA1):c.3972delG (p.Met1324Ilefs) rs80357987
NM_007294.3(BRCA1):c.3973delA (p.Arg1325Glyfs) rs80357904
NM_007294.3(BRCA1):c.399_400delTG (p.Ala134Glnfs) rs80357568
NM_007294.3(BRCA1):c.3G>T (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.4015G>T (p.Glu1339Ter) rs80357021
NM_007294.3(BRCA1):c.4035delA (p.Glu1346Lysfs) rs80357711
NM_007294.3(BRCA1):c.4038_4039delAA (p.Gly1348Asnfs) rs273900721
NM_007294.3(BRCA1):c.4041_4042delAG (p.Gly1348Asnfs) rs80357727
NM_007294.3(BRCA1):c.4052dupT (p.Leu1351Phefs) rs80357779
NM_007294.3(BRCA1):c.4057G>T (p.Glu1353Ter) rs80357178
NM_007294.3(BRCA1):c.4065_4068delTCAA (p.Asn1355Lysfs) rs80357508
NM_007294.3(BRCA1):c.406dupA (p.Arg136Lysfs) rs80357709
NM_007294.3(BRCA1):c.4075C>T (p.Gln1359Ter) rs80357456
NM_007294.3(BRCA1):c.4085delA (p.Asp1362Valfs) rs80357737
NM_007294.3(BRCA1):c.4096+1G>A rs80358178
NM_007294.3(BRCA1):c.4097-1G>A rs80358070
NM_007294.3(BRCA1):c.4097-2A>G rs80358019
NM_007294.3(BRCA1):c.4110_4111delTG (p.Gly1371Valfs) rs80357529
NM_007294.3(BRCA1):c.4111_4112insATCT (p.Gly1371Aspfs) rs80357935
NM_007294.3(BRCA1):c.4113delG (p.Cys1372Valfs) rs80357861
NM_007294.3(BRCA1):c.4116_4117delTG (p.Cys1372Terfs) rs80357804
NM_007294.3(BRCA1):c.4117G>T (p.Glu1373Ter) rs80357259
NM_007294.3(BRCA1):c.4120_4121delAG (p.Ser1374Terfs) rs80357787
NM_007294.3(BRCA1):c.4122_4123delTG (p.Ser1374Argfs) rs80357691
NM_007294.3(BRCA1):c.4123G>T (p.Glu1375Ter) rs80357397
NM_007294.3(BRCA1):c.4128_4129delAA (p.Ser1377Argfs) rs80357921
NM_007294.3(BRCA1):c.412_418delCTACAGA (p.Leu138Valfs) rs80357816
NM_007294.3(BRCA1):c.4148C>G (p.Ser1383Ter) rs80357071
NM_007294.3(BRCA1):c.4155_4156ins10 (p.?)
NM_007294.3(BRCA1):c.415C>T (p.Gln139Ter) rs80357372
NM_007294.3(BRCA1):c.4161_4162delTC (p.Gln1388Glufs) rs80357565
NM_007294.3(BRCA1):c.4163_4166delAGAG (p.Gln1388Leufs) rs80357532
NM_007294.3(BRCA1):c.4163dupA (p.Ser1389Glufs) rs80357788
NM_007294.3(BRCA1):c.4165_4166delAG (p.Ser1389Terfs) rs80357572
NM_007294.3(BRCA1):c.4167_4168insAG (p.Asp1390Argfs) rs80357847
NM_007294.3(BRCA1):c.4167_4170delTGAC (p.Ser1389Argfs) rs80357538
NM_007294.3(BRCA1):c.4182_4183dupTC (p.Gln1395Leufs) rs80357742
NM_007294.3(BRCA1):c.4183C>T (p.Gln1395Ter) rs80357260
NM_007294.3(BRCA1):c.4185+1G>T rs80358076
NM_007294.3(BRCA1):c.4185+2_4185+22del21insA rs273900724
NM_007294.3(BRCA1):c.4185G>A (p.Gln1395=) rs80356857
NM_007294.3(BRCA1):c.4186-1643_4357+2020del
NM_007294.3(BRCA1):c.4186C>T (p.Gln1396Ter) rs80357011
NM_007294.3(BRCA1):c.4195_4196delAC (p.Thr1399Hisfs) rs80357649
NM_007294.3(BRCA1):c.4210delC (p.Leu1404Terfs) rs80357765
NM_007294.3(BRCA1):c.4214delT (p.Ile1405Lysfs) rs273900728
NM_007294.3(BRCA1):c.4222C>T (p.Gln1408Ter) rs80356989
NM_007294.3(BRCA1):c.4243delG (p.Glu1415Lysfs) rs80357981
NM_007294.3(BRCA1):c.4251_4252delGT (p.Leu1418Argfs) rs80357977
NM_007294.3(BRCA1):c.4258C>T (p.Gln1420Ter) rs80357305
NM_007294.3(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.3(BRCA1):c.4285_4286insG (p.Tyr1429Terfs) rs80357716
NM_007294.3(BRCA1):c.4289dupC (p.Ser1431Phefs) rs80357556
NM_007294.3(BRCA1):c.4300dupA (p.Ser1434Lysfs) rs80357790
NM_007294.3(BRCA1):c.4321dupG (p.Asp1441Glyfs) rs80357748
NM_007294.3(BRCA1):c.4327C>T (p.Arg1443Ter) rs41293455
NM_007294.3(BRCA1):c.4331_4338delATCCAGAA (p.Asn1444Thrfs) rs80357825
NM_007294.3(BRCA1):c.4338_4339ins4
NM_007294.3(BRCA1):c.4339C>T (p.Gln1447Ter) rs80357067
NM_007294.3(BRCA1):c.4348dupT (p.Ser1450Phefs) rs80357548
NM_007294.3(BRCA1):c.4357+1G>A rs80358027
NM_007294.3(BRCA1):c.4357+1G>C rs80358027
NM_007294.3(BRCA1):c.4357+1G>T rs80358027
NM_007294.3(BRCA1):c.4357+2T>G rs80358152
NM_007294.3(BRCA1):c.4370C>G (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4373_4389del17 (p.Gln1458Profs) rs80359885
NM_007294.3(BRCA1):c.4388_4389ins7
NM_007294.3(BRCA1):c.4389C>A (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4391_4393delCTAinsTT (p.Pro1464Leufs) rs273900730
NM_007294.3(BRCA1):c.4391_4403delCTATAAGCCAGAAinsTT (p.Pro1464Leufs) rs273900731
NM_007294.3(BRCA1):c.4391delC (p.Pro1464Leufs) rs80357916
NM_007294.3(BRCA1):c.442-2A>C rs80358155
NM_007294.3(BRCA1):c.4463dupA (p.Asn1488Lysfs) rs80357620
NM_007294.3(BRCA1):c.4480G>T (p.Glu1494Ter) rs80357148
NM_007294.3(BRCA1):c.4482_4483delAA (p.Arg1495Valfs) rs80357854
NM_007294.3(BRCA1):c.4484+1G>A rs80358063
NM_007294.3(BRCA1):c.4484G>A (p.Arg1495Lys) rs80357389
NM_007294.3(BRCA1):c.4484G>T (p.Arg1495Met) rs80357389
NM_007294.3(BRCA1):c.4485-1G>A rs80358189
NM_007294.3(BRCA1):c.4485-2A>G rs80358054
NM_007294.3(BRCA1):c.4487C>A (p.Ser1496Ter) rs80356953
NM_007294.3(BRCA1):c.4487C>G (p.Ser1496Ter) rs80356953
NM_007294.3(BRCA1):c.4508C>A (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4516delG (p.Asp1506Ilefs) rs273900736
NM_007294.3(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.3(BRCA1):c.4533_4534delCA (p.His1511Glnfs) rs80357534
NM_007294.3(BRCA1):c.4552C>T (p.Gln1518Ter) rs80356881
NM_007294.3(BRCA1):c.456_457delCA (p.Ser153Cysfs) rs80357882
NM_007294.3(BRCA1):c.4574_4575delAA (p.Gln1525Argfs) rs80357813
NM_007294.3(BRCA1):c.4595_4596insCT (p.Asp1533Leufs) rs80357699
NM_007294.3(BRCA1):c.4603G>T (p.Glu1535Ter) rs80357366
NM_007294.3(BRCA1):c.4609C>T (p.Gln1537Ter) rs80357229
NM_007294.3(BRCA1):c.4611_4612insG (p.Gln1538Alafs) rs80357915
NM_007294.3(BRCA1):c.4612C>T (p.Gln1538Ter) rs80356992
NM_007294.3(BRCA1):c.4618G>T (p.Glu1540Ter) rs80357277
NM_007294.3(BRCA1):c.4621G>T (p.Glu1541Ter) rs80357248
NM_007294.3(BRCA1):c.4625_4626delCT (p.Ser1542Trpfs) rs80357542
NM_007294.3(BRCA1):c.4644_4645ins8
NM_007294.3(BRCA1):c.4655_4658delACTT (p.Tyr1552Cysfs) rs80357561
NM_007294.3(BRCA1):c.465delA (p.Gln155Hisfs) rs1555594954
NM_007294.3(BRCA1):c.4675+1G>A rs80358044
NM_007294.3(BRCA1):c.4675+3A>T rs80358082
NM_007294.3(BRCA1):c.4675G>A (p.Glu1559Lys) rs80356988
NM_007294.3(BRCA1):c.4675G>C (p.Glu1559Gln) rs80356988
NM_007294.3(BRCA1):c.4676-1G>A rs80358008
NM_007294.3(BRCA1):c.4676-2A>G rs80358096
NM_007294.3(BRCA1):c.4678G>T (p.Gly1560Ter) rs80357349
NM_007294.3(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.3(BRCA1):c.4696_4697insA (p.Ser1566Tyrfs) rs483353095
NM_007294.3(BRCA1):c.4712_4716delTCTCT (p.Phe1571Terfs) rs80357718
NM_007294.3(BRCA1):c.4745delA (p.Asp1582Alafs) rs80357907
NM_007294.3(BRCA1):c.4749_4750delAG (p.Arg1583Serfs) rs80357641
NM_007294.3(BRCA1):c.4754_4755delCA (p.Pro1585Argfs) rs80357837
NM_007294.3(BRCA1):c.4764_4765delTC (p.Arg1589Cysfs) rs80357795
NM_007294.3(BRCA1):c.4801A>T (p.Lys1601Ter) rs80357303
NM_007294.3(BRCA1):c.4810C>T (p.Gln1604Ter) rs80357352
NM_007294.3(BRCA1):c.4843dupG (p.Ala1615Glyfs) rs80357615
NM_007294.3(BRCA1):c.485_486delTG (p.Val162Glufs) rs80357708
NM_007294.3(BRCA1):c.4891dupA (p.Ser1631Lysfs) rs80357656
NM_007294.3(BRCA1):c.4932_4933dupAA (p.Arg1645Lysfs) rs80357833
NM_007294.3(BRCA1):c.4936delG (p.Val1646Serfs) rs80357653
NM_007294.3(BRCA1):c.493delC (p.Leu165Terfs) rs80357551
NM_007294.3(BRCA1):c.4941delC (p.Asn1647Lysfs) rs80357905
NM_007294.3(BRCA1):c.4944_4945delAA (p.Arg1649Asnfs) rs80357655
NM_007294.3(BRCA1):c.4945delA (p.Arg1649Glufs) rs80357655
NM_007294.3(BRCA1):c.494dupT (p.Arg166Glufs) rs80357762
NM_007294.3(BRCA1):c.4964_4982del19 (p.Ser1655Tyrfs) rs80359876
NM_007294.3(BRCA1):c.4966_4984del19 (p.Gly1656Leufs) rs80359884
NM_007294.3(BRCA1):c.4981G>T (p.Glu1661Ter) rs80357401
NM_007294.3(BRCA1):c.4986+1G>A rs80358162
NM_007294.3(BRCA1):c.4986+3G>C rs80358023
NM_007294.3(BRCA1):c.4986+4A>C rs80358087
NM_007294.3(BRCA1):c.4986+4A>T rs80358087
NM_007294.3(BRCA1):c.4987-1G=
NM_007294.3(BRCA1):c.4999A>T (p.Lys1667Ter) rs80357204
NM_007294.3(BRCA1):c.5005delG (p.Ala1669Profs) rs80357938
NM_007294.3(BRCA1):c.5007_5008ins13 (p.?)
NM_007294.3(BRCA1):c.5026_5036delTTAACTAATCT (p.Leu1676Asnfs) rs80357894
NM_007294.3(BRCA1):c.5030_5033delCTAA (p.Thr1677Ilefs) rs80357580
NM_007294.3(BRCA1):c.5033_5034ins4
NM_007294.3(BRCA1):c.5035_5039delCTAAT (p.Leu1679Tyrfs) rs80357623
NM_007294.3(BRCA1):c.5035delC (p.Leu1679Terfs) rs80357896
NM_007294.3(BRCA1):c.5040delT (p.Thr1681Leufs) rs80357673
NM_007294.3(BRCA1):c.5047G>T (p.Glu1683Ter) rs80356879
NM_007294.3(BRCA1):c.5056dupC (p.His1686Profs) rs80357974
NM_007294.3(BRCA1):c.505C>T (p.Gln169Ter) rs80357133
NM_007294.3(BRCA1):c.5071dupA (p.Thr1691Asnfs) rs80357672
NM_007294.3(BRCA1):c.5074+1G>A rs80358053
NM_007294.3(BRCA1):c.5074+1G>T rs80358053
NM_007294.3(BRCA1):c.5074+2T>C rs80358089
NM_007294.3(BRCA1):c.5074G>A (p.Asp1692Asn) rs80187739
NM_007294.3(BRCA1):c.5074G>C (p.Asp1692His) rs80187739
NM_007294.3(BRCA1):c.5074G>T (p.Asp1692Tyr) rs80187739
NM_007294.3(BRCA1):c.5075-1G>A rs1800747
NM_007294.3(BRCA1):c.5075-1G>C rs1800747
NM_007294.3(BRCA1):c.5075-2A>C rs80358066
NM_007294.3(BRCA1):c.5075-2A>T rs80358066
NM_007294.3(BRCA1):c.5080G>T (p.Glu1694Ter) rs80356896
NM_007294.3(BRCA1):c.5084_5085delTT (p.Phe1695Cysfs) rs80357760
NM_007294.3(BRCA1):c.5091_5092delTG (p.Cys1697Terfs) rs80357710
NM_007294.3(BRCA1):c.5095C>T (p.Arg1699Trp) rs55770810
NM_007294.3(BRCA1):c.5098delA (p.Thr1700Hisfs) rs483353099
NM_007294.3(BRCA1):c.5102_5103delTG (p.Leu1701Glnfs) rs80357608
NM_007294.3(BRCA1):c.5106delA (p.Lys1702Asnfs) rs80357553
NM_007294.3(BRCA1):c.5109T>G (p.Tyr1703Ter) rs80356974
NM_007294.3(BRCA1):c.5123C>A (p.Ala1708Glu) rs28897696
NM_007294.3(BRCA1):c.5126delG (p.Gly1709Glufs) rs80357874
NM_007294.3(BRCA1):c.5136G>A (p.Trp1712Ter) rs80357418
NM_007294.3(BRCA1):c.5137delG (p.Val1713Terfs) rs80357997
NM_007294.3(BRCA1):c.5145delC (p.Tyr1716Ilefs) rs80357870
NM_007294.3(BRCA1):c.514C>T (p.Gln172Ter) rs80356947
NM_007294.3(BRCA1):c.514delC (p.Gln172Asnfs) rs80357872
NM_007294.3(BRCA1):c.5150delT (p.Phe1717Serfs) rs80357720
NM_007294.3(BRCA1):c.5152+1G>A rs80358094
NM_007294.3(BRCA1):c.5152+1G>C rs80358094
NM_007294.3(BRCA1):c.5152+1G>T rs80358094
NM_007294.3(BRCA1):c.5152+3A>C rs80358124
NM_007294.3(BRCA1):c.5152+3_5152+4insT rs273901744
NM_007294.3(BRCA1):c.5153-1G>A rs80358137
NM_007294.3(BRCA1):c.5153-1G>C rs80358137
NM_007294.3(BRCA1):c.5153-2delA rs273901746
NM_007294.3(BRCA1):c.5153G>A (p.Trp1718Ter) rs41293461
NM_007294.3(BRCA1):c.5154G>A (p.Trp1718Ter) rs80357239
NM_007294.3(BRCA1):c.5155delG (p.Val1719Terfs) rs80357743
NM_007294.3(BRCA1):c.5156_5157delTG (p.Val1719Aspfs) rs80357895
NM_007294.3(BRCA1):c.5173G>T (p.Glu1725Ter) rs80357291
NM_007294.3(BRCA1):c.5177_5178delGA (p.Arg1726Lysfs) rs80357730
NM_007294.3(BRCA1):c.5179A>T (p.Lys1727Ter) rs80357347
NM_007294.3(BRCA1):c.5193+1G>A rs80358004
NM_007294.3(BRCA1):c.5193+1G>C rs80358004
NM_007294.3(BRCA1):c.5193+2delT rs273901751
NM_007294.3(BRCA1):c.5193+3_5193+15del rs273901752
NM_007294.3(BRCA1):c.5194-1G>A rs80358173
NM_007294.3(BRCA1):c.5194-2A>G rs80358069
NM_007294.3(BRCA1):c.5209A>T (p.Arg1737Ter) rs80357496
NM_007294.3(BRCA1):c.5209_5248del40insTC (p.Arg1737Serfs) rs273901753
NM_007294.3(BRCA1):c.520delC (p.Gln174Lysfs) rs80357639
NM_007294.3(BRCA1):c.5229_5230delAA (p.Arg1744Lysfs) rs80357852
NM_007294.3(BRCA1):c.5232_5238delAAACCACins12 (p.?)
NM_007294.3(BRCA1):c.5239C>T (p.Gln1747Ter) rs80357367
NM_007294.3(BRCA1):c.5241delA (p.Gly1748Valfs) rs80357791
NM_007294.3(BRCA1):c.5243delG (p.Gly1748Valfs) rs80357676
NM_007294.3(BRCA1):c.5259delA (p.Glu1754Asnfs) rs80357925
NM_007294.3(BRCA1):c.5260G>T (p.Glu1754Ter) rs80357432
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs397507247
NM_007294.3(BRCA1):c.5271_5277del (p.Asp1757Glufs)
NM_007294.3(BRCA1):c.5276delA (p.Lys1759Argfs) rs80357732
NM_007294.3(BRCA1):c.5277+1G>A rs80358150
NM_007294.3(BRCA1):c.5277+1_5277+6del
NM_007294.3(BRCA1):c.5277+1delG rs273901754
NM_007294.3(BRCA1):c.5277G>A (p.Lys1759=) rs80356854
NM_007294.3(BRCA1):c.5278-1G>A rs80358099
NM_007294.3(BRCA1):c.5278-1G>T rs80358099
NM_007294.3(BRCA1):c.5284delA (p.Arg1762Glyfs) rs80357684
NM_007294.3(BRCA1):c.5289dupG (p.Leu1764Alafs) rs80357886
NM_007294.3(BRCA1):c.529delT (p.Ser177Leufs) rs80357758
NM_007294.3(BRCA1):c.5304delC (p.Tyr1769Metfs) rs80357959
NM_007294.3(BRCA1):c.5310delG (p.Phe1772Serfs) rs80357581
NM_007294.3(BRCA1):c.5311_5332+1del
NM_007294.3(BRCA1):c.5319dupC (p.Asn1774Glnfs) rs80357823
NM_007294.3(BRCA1):c.5320_5321delAA (p.Asn1774Hisfs) rs80357818
NM_007294.3(BRCA1):c.5328dupC (p.Thr1777Hisfs) rs80357751
NM_007294.3(BRCA1):c.5332+1G>A rs80358041
NM_007294.3(BRCA1):c.5332+2T>A rs80358182
NM_007294.3(BRCA1):c.5333-1G>C rs80358126
NM_007294.3(BRCA1):c.5333-36_5406+400del rs1555574977
NM_007294.3(BRCA1):c.5335delC (p.Gln1779Asnfs) rs80357590
NM_007294.3(BRCA1):c.5341delG (p.Glu1781Asnfs) rs80357694
NM_007294.3(BRCA1):c.5345G>A (p.Trp1782Ter) rs80357219
NM_007294.3(BRCA1):c.5346G>A (p.Trp1782Ter) rs80357284
NM_007294.3(BRCA1):c.5352dupA (p.Gln1785Thrfs) rs80357744
NM_007294.3(BRCA1):c.5353C>T (p.Gln1785Ter) rs80356969
NM_007294.3(BRCA1):c.5363G>T (p.Gly1788Val) rs80357069
NM_007294.3(BRCA1):c.5370_5397delTGTGGTGAAGGAGCTTTCATCATTCACC (p.Val1791Leufs) rs80359878
NM_007294.3(BRCA1):c.5386dupT (p.Ser1796Phefs) rs80357838
NM_007294.3(BRCA1):c.5387C>A (p.Ser1796Ter) rs80357055
NM_007294.3(BRCA1):c.5406+1G>A rs80358028
NM_007294.3(BRCA1):c.5406+2del rs273901765
NM_007294.3(BRCA1):c.5407-1G>A rs80358029
NM_007294.3(BRCA1):c.5407-1G>C rs80358029
NM_007294.3(BRCA1):c.5407-2A>G rs80358002
NM_007294.3(BRCA1):c.5407-2A>T rs80358002
NM_007294.3(BRCA1):c.5417delC (p.Pro1806Glnfs) rs80357558
NM_007294.3(BRCA1):c.5419delA (p.Ile1807Leufs) rs80357934
NM_007294.3(BRCA1):c.5440delG (p.Ala1814Profs) rs80357946
NM_007294.3(BRCA1):c.5444G>A (p.Trp1815Ter) rs80356962
NM_007294.3(BRCA1):c.5449G>T (p.Glu1817Ter) rs80356868
NM_007294.3(BRCA1):c.5467+1G>A rs80358145
NM_007294.3(BRCA1):c.5467+2T>C rs80358009
NM_007294.3(BRCA1):c.5467+2T>G rs80358009
NM_007294.3(BRCA1):c.5468-1G>A rs80358048
NM_007294.3(BRCA1):c.5468-40T>A rs80358151
NM_007294.3(BRCA1):c.547+1G>A rs80358030
NM_007294.3(BRCA1):c.547+1G>T rs80358030
NM_007294.3(BRCA1):c.547+2T>A rs80358047
NM_007294.3(BRCA1):c.5470_5477delATTGGGCA (p.Ile1824Aspfs) rs80357973
NM_007294.3(BRCA1):c.5479_5480insGA (p.Met1827Argfs) rs80357757
NM_007294.3(BRCA1):c.5490delA (p.Pro1831Leufs) rs80357976
NM_007294.3(BRCA1):c.5492delC (p.Pro1831Leufs) rs80357582
NM_007294.3(BRCA1):c.5496_5506delGGTGACCCGAGinsA (p.Val1833Serfs) rs273902775
NM_007294.3(BRCA1):c.5498_5511delTGACCCGAGAGTGG (p.Val1833Glyfs) rs80359873
NM_007294.3(BRCA1):c.5503C>T (p.Arg1835Ter) rs41293465
NM_007294.3(BRCA1):c.5503_5564del62 (p.Arg1835Thrfs) rs80359883
NM_007294.3(BRCA1):c.5506G>T (p.Glu1836Ter) rs80356942
NM_007294.3(BRCA1):c.5510G>A (p.Trp1837Ter) rs80357307
NM_007294.3(BRCA1):c.5511G>A (p.Trp1837Ter) rs80356914
NM_007294.3(BRCA1):c.5512delG (p.Val1838Cysfs) rs80357839
NM_007294.3(BRCA1):c.5521delA (p.Ser1841Valfs) rs80357721
NM_007294.3(BRCA1):c.5534_5539delACCAGTins20 (p.?)
NM_007294.3(BRCA1):c.5535C>A (p.Tyr1845Ter) rs80356977
NM_007294.3(BRCA1):c.5536C>T (p.Gln1846Ter) rs80356873
NM_007294.3(BRCA1):c.5558dupA (p.Tyr1853Terfs) rs80357629
NM_007294.3(BRCA1):c.5559C>A (p.Tyr1853Ter) rs80357336
NM_007294.3(BRCA1):c.5563delAins6
NM_007294.3(BRCA1):c.594-2A>C rs80358033
NM_007294.3(BRCA1):c.625_626ins20 (p.?)
NM_007294.3(BRCA1):c.64_65dupTT (p.Leu22Phefs) rs80357642
NM_007294.3(BRCA1):c.65delT (p.Leu22Terfs) rs80357642
NM_007294.3(BRCA1):c.668delA (p.Lys223Argfs) rs80357537
NM_007294.3(BRCA1):c.668dupA (p.Ala224Glyfs) rs80357537
NM_007294.3(BRCA1):c.66dupA (p.Glu23Argfs) rs80357783
NM_007294.3(BRCA1):c.671-1G>T rs80358020
NM_007294.3(BRCA1):c.671-2A>C rs80358108
NM_007294.3(BRCA1):c.676delT (p.Cys226Valfs) rs80357941
NM_007294.3(BRCA1):c.685delT (p.Ser229Leufs) rs80357824
NM_007294.3(BRCA1):c.68_69delAG (p.Glu23Valfs) rs386833395
NM_007294.3(BRCA1):c.68_69dupAG (p.Cys24Serfs) rs80357914
NM_007294.3(BRCA1):c.697_698delGT (p.Val233Asnfs) rs80357747
NM_007294.3(BRCA1):c.70_71insA (p.Cys24Terfs) rs80357536
NM_007294.3(BRCA1):c.70_71insTGTC (p.Cys24Leufs) rs80357536
NM_007294.3(BRCA1):c.70_80delTGTCCCATCTG (p.Cys24Serfs) rs80357696
NM_007294.3(BRCA1):c.731delA (p.Asn244Metfs) rs80357700
NM_007294.3(BRCA1):c.74_75delCC (p.Pro25Hisfs) rs80357633
NM_007294.3(BRCA1):c.763G>T (p.Glu255Ter) rs80357009
NM_007294.3(BRCA1):c.775delG (p.Glu259Lysfs) rs80357628
NM_007294.3(BRCA1):c.783T>G (p.Tyr261Ter) rs80357321
NM_007294.3(BRCA1):c.791_794delGTTC (p.Ser264Metfs) rs80357707
NM_007294.3(BRCA1):c.794_795delCT (p.Ser265Cysfs) rs80357955
NM_007294.3(BRCA1):c.80+1G>A rs80358010
NM_007294.3(BRCA1):c.80+1G>C rs80358010
NM_007294.3(BRCA1):c.80+1G>T rs80358010
NM_007294.3(BRCA1):c.80+2T>G rs80358128
NM_007294.3(BRCA1):c.800C>G (p.Ser267Ter) rs80357392
NM_007294.3(BRCA1):c.807_808ins11 (p.?)
NM_007294.3(BRCA1):c.809delA (p.His270Leufs) rs80357965
NM_007294.3(BRCA1):c.81-1G>A rs80358018
NM_007294.3(BRCA1):c.81-2delA rs273902791
NM_007294.3(BRCA1):c.822T>A (p.Cys274Ter) rs80357331
NM_007294.3(BRCA1):c.824_825ins10 (p.?)
NM_007294.3(BRCA1):c.833_834insA (p.His279Serfs) rs483353108
NM_007294.3(BRCA1):c.835delC (p.His279Metfs) rs80357523
NM_007294.3(BRCA1):c.83_84delTG (p.Leu28Argfs) rs80357728
NM_007294.3(BRCA1):c.841_842dupAG (p.Ser281Argfs) rs80357792
NM_007294.3(BRCA1):c.843_846delCTCA (p.Ser282Tyrfs) rs80357919
NM_007294.3(BRCA1):c.844_850dupTCATTAC (p.Gln284Leufs) rs80357989
NM_007294.3(BRCA1):c.848T>A (p.Leu283Ter) rs273902792
NM_007294.3(BRCA1):c.851_852delAG (p.Gln284Profs) rs80357719
NM_007294.3(BRCA1):c.851_852ins7
NM_007294.3(BRCA1):c.85G>T (p.Glu29Ter) rs80357443
NM_007294.3(BRCA1):c.882delA (p.Asp295Thrfs) rs80357587
NM_007294.3(BRCA1):c.892_895dupAATG (p.Val299Glufs) rs80357806
NM_007294.3(BRCA1):c.895_896delGT (p.Val299Argfs) rs80357670
NM_007294.3(BRCA1):c.902_903insT (p.Lys301Asnfs) rs80357726
NM_007294.3(BRCA1):c.904delG (p.Ala302Leufs) rs273903793
NM_007294.3(BRCA1):c.911delT (p.Phe304Serfs) rs80357622
NM_007294.3(BRCA1):c.922_923delAG (p.Ser308Glnfs) rs80357644
NM_007294.3(BRCA1):c.923delG (p.Ser308Thrfs) rs80357953
NM_007294.3(BRCA1):c.929delA (p.Gln310Argfs) rs80357844
NM_007294.3(BRCA1):c.930delG (p.Gln310Hisfs) rs80357689
NM_007294.3(BRCA1):c.949C>T (p.Gln317Ter) rs80357211
NM_007294.3(BRCA1):c.949_953delCAACA (p.Gln317Terfs) rs80357555
NM_007294.3(BRCA1):c.952_1015del64 (p.His318Argfs) rs80359872
NM_007294.3(BRCA1):c.954_955insGT (p.Asn319Valfs) rs80357690
NM_007294.3(BRCA1):c.959_960delGA (p.Arg320Metfs) rs397509339
NM_007294.3(BRCA1):c.964delG (p.Ala322Leufs) rs273903794
NM_007294.3(BRCA1):c.980_981delCA (p.Thr327Metfs) rs80357610
NM_007294.3(BRCA1):c.984_985insC (p.Asn329Glnfs) rs80357775
NM_007294.3:c.133_137delinsT
NM_007299.3(BRCA1):c.1865_1868delGAAA rs80357867
NM_007299.3(BRCA1):c.787+11_787+12delTT rs80357724
Single allele
U14680.1:n.2294delG
U14680.1:n.2494delC
U14680.1:n.3235_3238delCAGC
U14680.1:n.3702delA

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.