ClinVar Miner

List of variants in gene BRCA1 reported by Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 3214
Download table as spreadsheet
HGVS dbSNP
NM_007294.3(BRCA1):c.*1113G>A rs111791349
NM_007294.3(BRCA1):c.*1287C>T rs12516
NM_007294.3(BRCA1):c.*1327G>A rs184237074
NM_007294.3(BRCA1):c.*1332G>A rs8176320
NM_007294.3(BRCA1):c.*1922T>C rs8176322
NM_007294.3(BRCA1):c.*1984C>G rs8176323
NM_007294.3(BRCA1):c.*228A>G rs56108540
NM_007294.3(BRCA1):c.*2602C>T rs116585239
NM_007294.3(BRCA1):c.*2670A>T rs11659028
NM_007294.3(BRCA1):c.*2810A>G rs7223952
NM_007294.3(BRCA1):c.*36C>G rs3092995
NM_007294.3(BRCA1):c.*3785T>A rs8071278
NM_007294.3(BRCA1):c.*4056C>A rs78612526
NM_007294.3(BRCA1):c.*421G>T rs8176318
NM_007294.3(BRCA1):c.*4271T>A rs13342026
NM_007294.3(BRCA1):c.*4549G>C rs138528005
NM_007294.3(BRCA1):c.*5513G>A rs112222971
NM_007294.3(BRCA1):c.*5678_*5679insAT rs35578914
NM_007294.3(BRCA1):c.*5860C>T rs150356989
NM_007294.3(BRCA1):c.*6207C>T rs78603756
NM_007294.3(BRCA1):c.*781C>T rs8176319
NM_007294.3(BRCA1):c.*873delA rs59541324
NM_007294.3(BRCA1):c.-19-115T>C rs3765640
NM_007294.3(BRCA1):c.-19-216A>G rs8176077
NM_007294.3(BRCA1):c.-19-361C>T rs141625477
NM_007294.3(BRCA1):c.-19-85_-19-81del rs56209245
NM_007294.3(BRCA1):c.1001C>T (p.Pro334Leu) rs41286290
NM_007294.3(BRCA1):c.1002del (p.Ser335fs) rs876658404
NM_007294.3(BRCA1):c.1008dupA (p.Glu337Argfs) rs67284603
NM_007294.3(BRCA1):c.1012A>T (p.Lys338Ter) rs397508826
NM_007294.3(BRCA1):c.1014A>G (p.Lys338=) rs876660793
NM_007294.3(BRCA1):c.1016_1017insC (p.Lys339fs) rs1555592653
NM_007294.3(BRCA1):c.1016del (p.Lys339fs) rs80357569
NM_007294.3(BRCA1):c.1016dup (p.Val340fs) rs80357569
NM_007294.3(BRCA1):c.1017G>A (p.Lys339=) rs863224416
NM_007294.3(BRCA1):c.1017_1018insA (p.Val340fs) rs886039921
NM_007294.3(BRCA1):c.1017_1018insC (p.Val340fs) rs886039921
NM_007294.3(BRCA1):c.1018_1019insA (p.Val340fs) rs1555592640
NM_007294.3(BRCA1):c.1018del (p.Lys339_Val340insTer) rs80357774
NM_007294.3(BRCA1):c.1018dup (p.Val340fs) rs80357774
NM_007294.3(BRCA1):c.101_105del (p.Pro34fs) rs886039920
NM_007294.3(BRCA1):c.101del (p.Pro34fs) rs80357750
NM_007294.3(BRCA1):c.102del (p.Val35fs) rs886039922
NM_007294.3(BRCA1):c.1039_1040del (p.Leu347fs) rs397508827
NM_007294.3(BRCA1):c.1039del (p.Leu347fs) rs749508254
NM_007294.3(BRCA1):c.1040_1041TG[2] (p.Cys348_Glu349delinsTer) rs1555592601
NM_007294.3(BRCA1):c.1040del (p.Leu347fs) rs397508828
NM_007294.3(BRCA1):c.1044T>A (p.Cys348Ter) rs886037985
NM_007294.3(BRCA1):c.1044_1045insTCAC (p.Glu349fs) rs886039923
NM_007294.3(BRCA1):c.1044_1047del (p.Leu347_Cys348insTer) rs886039924
NM_007294.3(BRCA1):c.1045G>T (p.Glu349Ter) rs80357338
NM_007294.3(BRCA1):c.1045_1046GA[2] (p.Arg350fs) rs886039925
NM_007294.3(BRCA1):c.1045_1046insTCAC (p.Glu349fs) rs1555592590
NM_007294.3(BRCA1):c.1054G>T (p.Glu352Ter) rs80357472
NM_007294.3(BRCA1):c.1054del (p.Glu352fs) rs886039926
NM_007294.3(BRCA1):c.1058G>A (p.Trp353Ter) rs80356908
NM_007294.3(BRCA1):c.1059G>A (p.Trp353Ter) rs80356935
NM_007294.3(BRCA1):c.1063A>T (p.Lys355Ter) rs397508829
NM_007294.3(BRCA1):c.1065G>A (p.Lys355=) rs41286292
NM_007294.3(BRCA1):c.1066C>T (p.Gln356Ter) rs80357215
NM_007294.3(BRCA1):c.1067A>G (p.Gln356Arg) rs1799950
NM_007294.3(BRCA1):c.1067del (p.Gln356fs) rs80357796
NM_007294.3(BRCA1):c.1068_1077del (p.Gln356fs) rs397508830
NM_007294.3(BRCA1):c.1071A>G (p.Lys357=) rs786202159
NM_007294.3(BRCA1):c.1072C>T (p.Leu358=) rs377310179
NM_007294.3(BRCA1):c.1072del (p.Leu358fs) rs80357836
NM_007294.3(BRCA1):c.1080C>A (p.Cys360Ter) rs886037986
NM_007294.3(BRCA1):c.1081_1082insA (p.Ser361fs) rs1555592544
NM_007294.3(BRCA1):c.1082C>G (p.Ser361Ter) rs397508833
NM_007294.3(BRCA1):c.1082_1092del (p.Cys360_Ser361insTer) rs80359880
NM_007294.3(BRCA1):c.1084_1085GA[1] (p.Asn363fs) rs80357897
NM_007294.3(BRCA1):c.1085dup (p.Asn363fs) rs1555592537
NM_007294.3(BRCA1):c.1086_1141del (p.Asn363fs) rs80359875
NM_007294.3(BRCA1):c.1088del (p.Asn363fs) rs80357954
NM_007294.3(BRCA1):c.1091del (p.Pro364fs) rs397508834
NM_007294.3(BRCA1):c.1093A>T (p.Arg365Ter) rs398122627
NM_007294.3(BRCA1):c.1098T>C (p.Asp366=) rs876658148
NM_007294.3(BRCA1):c.1099dup (p.Thr367fs) rs397508835
NM_007294.3(BRCA1):c.1100dup (p.Thr367_Glu368insTer) rs397508836
NM_007294.3(BRCA1):c.1101_1102insC (p.Glu368fs) rs80357665
NM_007294.3(BRCA1):c.1102G>T (p.Glu368Ter) rs80357139
NM_007294.3(BRCA1):c.1102_1103insC (p.Glu368fs) rs1555592500
NM_007294.3(BRCA1):c.1104del (p.Asp369fs) rs886039927
NM_007294.3(BRCA1):c.1105G>A (p.Asp369Asn) rs56056711
NM_007294.3(BRCA1):c.1105dup (p.Asp369fs) rs1555592498
NM_007294.3(BRCA1):c.1107_1108insCT (p.Val370fs) rs1555592487
NM_007294.3(BRCA1):c.110C>A (p.Thr37Lys) rs80356880
NM_007294.3(BRCA1):c.1110del (p.Pro371fs) rs1555592474
NM_007294.3(BRCA1):c.1112del (p.Pro371fs) rs397508837
NM_007294.3(BRCA1):c.1113T>C (p.Pro371=) rs876658619
NM_007294.3(BRCA1):c.1115G>A (p.Trp372Ter) rs397508838
NM_007294.3(BRCA1):c.1116G>A (p.Trp372Ter) rs80357468
NM_007294.3(BRCA1):c.1120_1121AC[1] (p.Leu375fs) rs397508839
NM_007294.3(BRCA1):c.1121_1123delinsT (p.Thr374fs) rs273897652
NM_007294.3(BRCA1):c.1121del (p.Thr374fs) rs80357612
NM_007294.3(BRCA1):c.1123C>T (p.Leu375=) rs1131692084
NM_007294.3(BRCA1):c.1123del (p.Thr374_Leu375insTer) rs886037987
NM_007294.3(BRCA1):c.1125_1132del (p.Asn376fs) rs886039928
NM_007294.3(BRCA1):c.1127del (p.Asn376fs) rs80357821
NM_007294.3(BRCA1):c.1129dup (p.Ser377fs) rs80357776
NM_007294.3(BRCA1):c.112_113del (p.Lys38fs) rs80357949
NM_007294.3(BRCA1):c.1132_1135del (p.Ser378fs) rs1135401841
NM_007294.3(BRCA1):c.1138C>T (p.Gln380Ter) rs397508840
NM_007294.3(BRCA1):c.1140del (p.Val382fs) rs886039929
NM_007294.3(BRCA1):c.1140dup (p.Lys381fs) rs876659327
NM_007294.3(BRCA1):c.1141A>T (p.Lys381Ter) rs80357385
NM_007294.3(BRCA1):c.1142_1143del (p.Lys381fs) rs879255313
NM_007294.3(BRCA1):c.1148_1149del (p.Asn383fs) rs431825384
NM_007294.3(BRCA1):c.1148del (p.Asn383fs) rs878854930
NM_007294.3(BRCA1):c.114G>A (p.Lys38=) rs1800062
NM_007294.3(BRCA1):c.1150G>T (p.Glu384Ter) rs878853288
NM_007294.3(BRCA1):c.1152dup (p.Trp385fs) rs397508841
NM_007294.3(BRCA1):c.1155G>A (p.Trp385Ter) rs876660558
NM_007294.3(BRCA1):c.1158_1159del (p.Ser387fs) rs397508842
NM_007294.3(BRCA1):c.1159dup (p.Ser387fs) rs397508842
NM_007294.3(BRCA1):c.115T>C (p.Cys39Arg) rs80357164
NM_007294.3(BRCA1):c.115_116TG[1] (p.Cys39_Asp40delinsTer) rs80357972
NM_007294.3(BRCA1):c.1165del (p.Ser389fs) rs80357985
NM_007294.3(BRCA1):c.1166del (p.Ser389fs) rs273897653
NM_007294.3(BRCA1):c.1171G>T (p.Glu391Ter) rs562553169
NM_007294.3(BRCA1):c.1173A>G (p.Glu391=) rs1131692097
NM_007294.3(BRCA1):c.1174del (p.Leu392fs) rs886039930
NM_007294.3(BRCA1):c.1175_1178del (p.Leu392fs) rs397508844
NM_007294.3(BRCA1):c.1175_1214del (p.Leu392fs) rs80359874
NM_007294.3(BRCA1):c.1175_1215del (p.Leu392fs) rs397507180
NM_007294.3(BRCA1):c.1175_1218del (p.Leu392fs) rs397507183
NM_007294.3(BRCA1):c.1177_1219del (p.Leu393fs) rs397507182
NM_007294.3(BRCA1):c.1179_1180insT (p.Gly394fs) rs886039931
NM_007294.3(BRCA1):c.1180_1181insT (p.Gly394fs) rs1555592299
NM_007294.3(BRCA1):c.1188del (p.Asp396fs) rs397508845
NM_007294.3(BRCA1):c.1190del (p.Asp397fs) rs748714307
NM_007294.3(BRCA1):c.1193C>A (p.Ser398Ter) rs80357068
NM_007294.3(BRCA1):c.1193C>G (p.Ser398Ter) rs80357068
NM_007294.3(BRCA1):c.1204G>T (p.Glu402Ter) rs273897655
NM_007294.3(BRCA1):c.1204del (p.Glu402fs) rs80357859
NM_007294.3(BRCA1):c.1205dup (p.Ser403fs) rs1555592219
NM_007294.3(BRCA1):c.1209T>C (p.Ser403=) rs369363742
NM_007294.3(BRCA1):c.1209_1210del (p.Glu404fs) rs886039932
NM_007294.3(BRCA1):c.1209dup (p.Glu404Ter) rs886039933
NM_007294.3(BRCA1):c.1210_1211insCT (p.Glu404fs) rs886039934
NM_007294.3(BRCA1):c.1211_1212insCT (p.Glu404fs) rs1555592174
NM_007294.3(BRCA1):c.1214C>A (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1214C>G (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1215A>G (p.Ser405=) rs786201517
NM_007294.3(BRCA1):c.1217del (p.Asn406fs) rs397508846
NM_007294.3(BRCA1):c.1218_1219insA (p.Ala407fs) rs1555592129
NM_007294.3(BRCA1):c.121del (p.His41fs) rs1555599226
NM_007294.3(BRCA1):c.1222A>T (p.Lys408Ter) rs80357253
NM_007294.3(BRCA1):c.1224del (p.Lys408_Val409insTer) rs879255320
NM_007294.3(BRCA1):c.1227A>G (p.Val409=) rs149349675
NM_007294.3(BRCA1):c.1227_1230dup (p.Asp411delinsSerTer) rs886039935
NM_007294.3(BRCA1):c.122A>G (p.His41Arg) rs80357276
NM_007294.3(BRCA1):c.122del (p.His41fs) rs397508847
NM_007294.3(BRCA1):c.1232_1233del (p.Asp411fs) rs397508848
NM_007294.3(BRCA1):c.1232_1235delinsCA (p.Asp411fs) rs876659253
NM_007294.3(BRCA1):c.1237T>C (p.Leu413=) rs574008372
NM_007294.3(BRCA1):c.123C>T (p.His41=) rs786202211
NM_007294.3(BRCA1):c.1240_1246del (p.Leu413_Asp414insTer) rs80357964
NM_007294.3(BRCA1):c.1240del (p.Asp414fs) rs786204260
NM_007294.3(BRCA1):c.1240dup (p.Asp414fs) rs786204260
NM_007294.3(BRCA1):c.1241dupA (p.Asp414Glufs) rs80357514
NM_007294.3(BRCA1):c.1242C>T (p.Asp414=) rs372400428
NM_007294.3(BRCA1):c.124del (p.Ile42fs) rs80357943
NM_007294.3(BRCA1):c.1251_1252delinsA (p.Asn417fs) rs886040899
NM_007294.3(BRCA1):c.1252G>T (p.Glu418Ter) rs80357083
NM_007294.3(BRCA1):c.1252del (p.Glu418fs) rs876660623
NM_007294.3(BRCA1):c.1252dup (p.Glu418fs) rs886039936
NM_007294.3(BRCA1):c.1253del (p.Glu418fs) rs886039937
NM_007294.3(BRCA1):c.1254G>A (p.Glu418=) rs786201948
NM_007294.3(BRCA1):c.1255del (p.Glu418_Val419insTer) rs80357535
NM_007294.3(BRCA1):c.1256dup (p.Asp420fs) rs786203103
NM_007294.3(BRCA1):c.1257A>T (p.Val419=) rs751690840
NM_007294.3(BRCA1):c.1257del (p.Asp420fs) rs886037988
NM_007294.3(BRCA1):c.1261G>T (p.Glu421Ter) rs80357046
NM_007294.3(BRCA1):c.1263_1264AT[3] (p.Ser423fs) rs397508850
NM_007294.3(BRCA1):c.1265dupA (p.Tyr422Terfs) rs80357809
NM_007294.3(BRCA1):c.1266T>G (p.Tyr422Ter) rs80357417
NM_007294.3(BRCA1):c.1273dup (p.Ser425fs) rs886039938
NM_007294.3(BRCA1):c.1275T>A (p.Ser425=) rs786201160
NM_007294.3(BRCA1):c.1276del (p.Ser426fs) rs80357766
NM_007294.3(BRCA1):c.1277C>A (p.Ser426Ter) rs886039939
NM_007294.3(BRCA1):c.1277C>G (p.Ser426Ter) rs886039939
NM_007294.3(BRCA1):c.1277del (p.Ser425_Ser426insTer) rs1064795775
NM_007294.3(BRCA1):c.1279G>T (p.Glu427Ter) rs397508851
NM_007294.3(BRCA1):c.1287del (p.Ile429fs) rs1060505045
NM_007294.3(BRCA1):c.1287dupA (p.Asp430Argfs) rs80357576
NM_007294.3(BRCA1):c.1288_1289insC (p.Asp430fs) rs1555591993
NM_007294.3(BRCA1):c.1288dup (p.Asp430fs) rs886039940
NM_007294.3(BRCA1):c.1292T>G (p.Leu431Ter) rs80357346
NM_007294.3(BRCA1):c.1292del (p.Leu431fs) rs80357528
NM_007294.3(BRCA1):c.1292dupT (p.Leu431Phefs) rs80357528
NM_007294.3(BRCA1):c.1293_1295delinsGA (p.Leu432fs) rs397508852
NM_007294.3(BRCA1):c.1294C>T (p.Leu432=) rs864622454
NM_007294.3(BRCA1):c.1297del (p.Ala433fs) rs80357794
NM_007294.3(BRCA1):c.1299dup (p.Ser434fs) rs886037786
NM_007294.3(BRCA1):c.1303_1309delinsAAAGT (p.Asp435fs) rs886039941
NM_007294.3(BRCA1):c.1308T>C (p.Pro436=) rs770279083
NM_007294.3(BRCA1):c.130T>A (p.Cys44Ser) rs80357327
NM_007294.3(BRCA1):c.130del (p.Cys44fs) rs80357951
NM_007294.3(BRCA1):c.130dup (p.Cys44fs) rs80357951
NM_007294.3(BRCA1):c.1310_1313del (p.His437fs) rs1555591959
NM_007294.3(BRCA1):c.1319T>G (p.Leu440Ter) rs273897656
NM_007294.3(BRCA1):c.1319del (p.Ala439_Leu440insTer) rs80357683
NM_007294.3(BRCA1):c.1319dup (p.Leu440fs) rs80357683
NM_007294.3(BRCA1):c.131G>A (p.Cys44Tyr) rs80357446
NM_007294.3(BRCA1):c.1321_1322AT[1] (p.Ile441fs) rs80357570
NM_007294.3(BRCA1):c.1323dup (p.Cys442fs) rs1555591939
NM_007294.3(BRCA1):c.1325_1326dup (p.Lys443fs) rs80357543
NM_007294.3(BRCA1):c.1326T>A (p.Cys442Ter) rs397508854
NM_007294.3(BRCA1):c.1327A>T (p.Lys443Ter) rs398122630
NM_007294.3(BRCA1):c.1327_1345del (p.Lys443fs) rs886039942
NM_007294.3(BRCA1):c.1329A>G (p.Lys443=) rs771892131
NM_007294.3(BRCA1):c.1333G>T (p.Glu445Ter) rs80356915
NM_007294.3(BRCA1):c.1333del (p.Glu445fs) rs886039943
NM_007294.3(BRCA1):c.1335A>G (p.Glu445=) rs1131692094
NM_007294.3(BRCA1):c.1335_1336del (p.Arg446fs) rs80357978
NM_007294.3(BRCA1):c.1336del (p.Arg446fs) rs80357978
NM_007294.3(BRCA1):c.1336dup (p.Arg446fs) rs80357978
NM_007294.3(BRCA1):c.1339dup (p.Val447fs) rs397508855
NM_007294.3(BRCA1):c.133A>C (p.Lys45Gln) rs769650474
NM_007294.3(BRCA1):c.133_134delAA rs397508857
NM_007294.3(BRCA1):c.134+111C>T rs8176100
NM_007294.3(BRCA1):c.134+1335dup rs35851659
NM_007294.3(BRCA1):c.134+1391C>T rs79415432
NM_007294.3(BRCA1):c.134+1632C>A rs8176106
NM_007294.3(BRCA1):c.134+1651dup rs541592598
NM_007294.3(BRCA1):c.134+1704_134+1705insG rs113808892
NM_007294.3(BRCA1):c.134+1788C>T rs2671874
NM_007294.3(BRCA1):c.134+1936C>G rs8176108
NM_007294.3(BRCA1):c.134+1967T>C rs8176109
NM_007294.3(BRCA1):c.134+202A>T rs8176101
NM_007294.3(BRCA1):c.134+224del rs35149296
NM_007294.3(BRCA1):c.134+2359_134+2363del rs139811854
NM_007294.3(BRCA1):c.134+2570A>C rs138040784
NM_007294.3(BRCA1):c.134+2672A>G rs113210086
NM_007294.3(BRCA1):c.134+296C>T rs139405471
NM_007294.3(BRCA1):c.134+2983_134+2987del rs67177158
NM_007294.3(BRCA1):c.134+2990G>A rs375673256
NM_007294.3(BRCA1):c.134+2993T>A rs371133200
NM_007294.3(BRCA1):c.134+2994G>C rs377611452
NM_007294.3(BRCA1):c.134+2999del rs374842106
NM_007294.3(BRCA1):c.134+3001_134+3002del rs55820479
NM_007294.3(BRCA1):c.134+3004G>A rs55737636
NM_007294.3(BRCA1):c.134+3379T>C rs8176114
NM_007294.3(BRCA1):c.134+3404C>T rs187294938
NM_007294.3(BRCA1):c.134+3597C>T rs11657823
NM_007294.3(BRCA1):c.134+3898T>G rs8176116
NM_007294.3(BRCA1):c.134+4133C>T rs143757906
NM_007294.3(BRCA1):c.134+4177A>G rs8176117
NM_007294.3(BRCA1):c.134+4294A>T rs188719262
NM_007294.3(BRCA1):c.134+4313C>T rs8176118
NM_007294.3(BRCA1):c.134+563G>A rs8176102
NM_007294.3(BRCA1):c.134+693C>T rs8176103
NM_007294.3(BRCA1):c.134+746G>A rs8176104
NM_007294.3(BRCA1):c.1340_1341del (p.Val447fs) rs730881458
NM_007294.3(BRCA1):c.1340_1341insG (p.His448fs) rs80357597
NM_007294.3(BRCA1):c.1341_1342insG (p.His448fs) rs1555591909
NM_007294.3(BRCA1):c.1347del (p.Lys450fs) rs886039945
NM_007294.3(BRCA1):c.135-1006G>A rs8176124
NM_007294.3(BRCA1):c.135-1231G>A rs799914
NM_007294.3(BRCA1):c.135-1803dup rs34608699
NM_007294.3(BRCA1):c.135-2258T>C rs4792977
NM_007294.3(BRCA1):c.135-2435C>G rs142808159
NM_007294.3(BRCA1):c.135-2458G>A rs146059433
NM_007294.3(BRCA1):c.135-2524_135-2509dup rs146934045
NM_007294.3(BRCA1):c.135-2555C>G rs8176121
NM_007294.3(BRCA1):c.135-2683G>A rs8176120
NM_007294.3(BRCA1):c.135-3013T>A rs8065872
NM_007294.3(BRCA1):c.135-332C>T rs186268206
NM_007294.3(BRCA1):c.135-3390G>A rs187354131
NM_007294.3(BRCA1):c.135-3551G>A rs142024941
NM_007294.3(BRCA1):c.135-3552C>T rs8176119
NM_007294.3(BRCA1):c.135-3641C>T rs111572667
NM_007294.3(BRCA1):c.135-3759A>G rs113127132
NM_007294.3(BRCA1):c.135-3807T>C rs111615606
NM_007294.3(BRCA1):c.135-396A>G rs799913
NM_007294.3(BRCA1):c.135-3999C>T rs75129942
NM_007294.3(BRCA1):c.135-4161C>G rs73321427
NM_007294.3(BRCA1):c.135-4494T>C rs12936316
NM_007294.3(BRCA1):c.135-4533T>C rs147766773
NM_007294.3(BRCA1):c.135-499G>A rs8176126
NM_007294.3(BRCA1):c.135-563C>T rs575589035
NM_007294.3(BRCA1):c.135-766C>T rs12946839
NM_007294.3(BRCA1):c.135-925T>C rs148341992
NM_007294.3(BRCA1):c.1352C>A (p.Ser451Ter) rs80356891
NM_007294.3(BRCA1):c.1352C>G (p.Ser451Ter) rs80356891
NM_007294.3(BRCA1):c.1354del (p.Ser451_Val452insTer) rs886039946
NM_007294.3(BRCA1):c.1356_1357AG[2] (p.Glu453_Ser454insTer) rs80357969
NM_007294.3(BRCA1):c.1356del (p.Glu453fs) rs80357939
NM_007294.3(BRCA1):c.1361del (p.Ser454fs) rs398122632
NM_007294.3(BRCA1):c.1364_1365insGA (p.Asn455fs) rs1555591846
NM_007294.3(BRCA1):c.1371del (p.Asp458fs) rs397508861
NM_007294.3(BRCA1):c.1374C>T (p.Asp458=) rs397508862
NM_007294.3(BRCA1):c.1374del (p.Asp458fs) rs397508862
NM_007294.3(BRCA1):c.1375A>T (p.Lys459Ter) rs886039947
NM_007294.3(BRCA1):c.1377_1378del (p.Lys459fs) rs398122633
NM_007294.3(BRCA1):c.1378dup (p.Ile460fs) rs398122633
NM_007294.3(BRCA1):c.1379del (p.Ile460fs) rs886039949
NM_007294.3(BRCA1):c.1380del (p.Phe461fs) rs397508863
NM_007294.3(BRCA1):c.1380dupA (p.Ile460_Phe461delinsIleIleTrpfs) rs80357714
NM_007294.3(BRCA1):c.1383del (p.Phe461fs) rs80357879
NM_007294.3(BRCA1):c.1384_1393dup (p.Tyr465fs) rs397508864
NM_007294.3(BRCA1):c.1386G>A (p.Gly462=) rs876659749
NM_007294.3(BRCA1):c.1386del (p.Thr464fs) rs80357722
NM_007294.3(BRCA1):c.1386dup (p.Lys463fs) rs80357722
NM_007294.3(BRCA1):c.1387_1390delinsGAAAG (p.Lys463fs) rs80357770
NM_007294.3(BRCA1):c.1389_1390delinsG (p.Thr464fs) rs273897659
NM_007294.3(BRCA1):c.1390del (p.Thr464fs) rs80357770
NM_007294.3(BRCA1):c.1390dup (p.Thr464fs) rs80357770
NM_007294.3(BRCA1):c.1391_1392insG (p.Tyr465fs) rs1135401845
NM_007294.3(BRCA1):c.1392C>T (p.Thr464=) rs533802049
NM_007294.3(BRCA1):c.1392_1393insG (p.Tyr465fs) rs1555591814
NM_007294.3(BRCA1):c.1392del (p.Tyr465fs) rs80357592
NM_007294.3(BRCA1):c.1392dup (p.Tyr465fs) rs80357592
NM_007294.3(BRCA1):c.1395dup (p.Arg466fs) rs1555591796
NM_007294.3(BRCA1):c.1399A>T (p.Lys467Ter) rs80357279
NM_007294.3(BRCA1):c.139dup (p.Cys47fs) rs80357734
NM_007294.3(BRCA1):c.1401G>A (p.Lys467=) rs786201323
NM_007294.3(BRCA1):c.1403del (p.Lys468fs) rs397508870
NM_007294.3(BRCA1):c.1405del (p.Ala469fs) rs397508871
NM_007294.3(BRCA1):c.1407_1408del (p.Ser470fs) rs879255476
NM_007294.3(BRCA1):c.140_141insT (p.Met48fs) rs886039950
NM_007294.3(BRCA1):c.1412dup (p.Asn473fs) rs886039951
NM_007294.3(BRCA1):c.1416C>T (p.Pro472=) rs752808917
NM_007294.3(BRCA1):c.1418A>G (p.Asn473Ser) rs80357057
NM_007294.3(BRCA1):c.1419C>T (p.Asn473=) rs777228325
NM_007294.3(BRCA1):c.1419_1422del (p.Asn473fs) rs886039952
NM_007294.3(BRCA1):c.141C>A (p.Cys47Ter) rs398122635
NM_007294.3(BRCA1):c.141C>T (p.Cys47=) rs398122635
NM_007294.3(BRCA1):c.141_142insT (p.Met48fs) rs1555597309
NM_007294.3(BRCA1):c.1421T>G (p.Leu474Ter) rs80357490
NM_007294.3(BRCA1):c.1428_1437del (p.His476fs) rs886039953
NM_007294.3(BRCA1):c.1434_1435del (p.Glu479fs) rs1060505050
NM_007294.3(BRCA1):c.1434del (p.Glu479fs) rs431825386
NM_007294.3(BRCA1):c.1439dupA (p.Asn480Lysfs) rs80357505
NM_007294.3(BRCA1):c.143del (p.Met48fs) rs80357637
NM_007294.3(BRCA1):c.1440_1441insA (p.Leu481fs) rs80357778
NM_007294.3(BRCA1):c.1441_1442insA (p.Leu481fs) rs1555591749
NM_007294.3(BRCA1):c.1444_1447del (p.Leu481_Ile482insTer) rs80357801
NM_007294.3(BRCA1):c.1444del (p.Ile482fs) rs80357648
NM_007294.3(BRCA1):c.144del (p.Met48fs) rs80357682
NM_007294.3(BRCA1):c.1450G>T (p.Gly484Ter) rs80357304
NM_007294.3(BRCA1):c.1456T>C (p.Phe486Leu) rs55906931
NM_007294.3(BRCA1):c.1462dup (p.Thr488fs) rs80357599
NM_007294.3(BRCA1):c.1465G>T (p.Glu489Ter) rs80357167
NM_007294.3(BRCA1):c.1467G>A (p.Glu489=) rs794726997
NM_007294.3(BRCA1):c.1470A>G (p.Pro490=) rs775032066
NM_007294.3(BRCA1):c.1471C>T (p.Gln491Ter) rs62625303
NM_007294.3(BRCA1):c.1477del (p.Ile493fs) rs786203982
NM_007294.3(BRCA1):c.1480C>T (p.Gln494Ter) rs80357010
NM_007294.3(BRCA1):c.1483_1498del (p.Glu495fs) rs397508872
NM_007294.3(BRCA1):c.1486C>T (p.Arg496Cys) rs28897676
NM_007294.3(BRCA1):c.1487G>A (p.Arg496His) rs28897677
NM_007294.3(BRCA1):c.1488del (p.Leu498fs) rs587782251
NM_007294.3(BRCA1):c.1491C>G (p.Pro497=) rs786202374
NM_007294.3(BRCA1):c.1492del (p.Leu498fs) rs80357527
NM_007294.3(BRCA1):c.1497_1500AAAT[1] (p.Asn500_Lys501insTer) rs80357632
NM_007294.3(BRCA1):c.1497_1509del (p.Asn500fs) rs886039954
NM_007294.3(BRCA1):c.1499_1508dup (p.Arg504_Lys505insTer) rs397508873
NM_007294.3(BRCA1):c.1499del (p.Asn500fs) rs397508874
NM_007294.3(BRCA1):c.1504_1507del (p.Leu502fs) rs886039955
NM_007294.3(BRCA1):c.1504_1508del (p.Leu502fs) rs80357888
NM_007294.3(BRCA1):c.1505T>G (p.Leu502Ter) rs886039957
NM_007294.3(BRCA1):c.1505_1509del (p.Leu502fs) rs876659139
NM_007294.3(BRCA1):c.1505del (p.Lys501_Leu502insTer) rs886039956
NM_007294.3(BRCA1):c.1506A>G (p.Leu502=) rs786203671
NM_007294.3(BRCA1):c.1506_1510del (p.Leu502_Lys503insTer) rs397508876
NM_007294.3(BRCA1):c.1508del (p.Lys503fs) rs80357506
NM_007294.3(BRCA1):c.150del (p.Lys50fs) rs273897662
NM_007294.3(BRCA1):c.1510del (p.Arg504fs) rs80357908
NM_007294.3(BRCA1):c.1511G>A (p.Arg504His) rs56272539
NM_007294.3(BRCA1):c.1511dupG (p.Lys505Terfs) rs80357817
NM_007294.3(BRCA1):c.1512dup (p.Lys505Ter) rs398122636
NM_007294.3(BRCA1):c.1513A>T (p.Lys505Ter) rs397508877
NM_007294.3(BRCA1):c.1513_1514insT (p.Lys505fs) rs397508878
NM_007294.3(BRCA1):c.1514_1515insT (p.Lys505fs) rs1555591635
NM_007294.3(BRCA1):c.1517_1521del (p.Arg506fs) rs397508879
NM_007294.3(BRCA1):c.1518del (p.Arg507fs) rs80357947
NM_007294.3(BRCA1):c.1519A>T (p.Arg507Ter) rs397508880
NM_007294.3(BRCA1):c.1521_1531del (p.Thr509fs) rs1555591596
NM_007294.3(BRCA1):c.1523del (p.Pro508fs) rs80357782
NM_007294.3(BRCA1):c.1524T>C (p.Pro508=) rs200616937
NM_007294.3(BRCA1):c.1527A>G (p.Thr509=) rs1131692082
NM_007294.3(BRCA1):c.1529C>A (p.Ser510Ter) rs80357427
NM_007294.3(BRCA1):c.1529C>G (p.Ser510Ter) rs80357427
NM_007294.3(BRCA1):c.1530del (p.Gly511fs) rs80357735
NM_007294.3(BRCA1):c.153T>G (p.Leu51=) rs1131692081
NM_007294.3(BRCA1):c.1542_1550delinsCG (p.Glu515fs) rs876659591
NM_007294.3(BRCA1):c.1543G>T (p.Glu515Ter) rs886037990
NM_007294.3(BRCA1):c.1551del (p.Phe517fs) rs80357630
NM_007294.3(BRCA1):c.1556del (p.Lys519fs) rs80357662
NM_007294.3(BRCA1):c.1561_1562delinsTA (p.Ala521Ter) rs273897663
NM_007294.3(BRCA1):c.1561_1564delinsTAAA (p.Ala521_Asp522delinsTer) rs397508883
NM_007294.3(BRCA1):c.1563A>G (p.Ala521=) rs754970915
NM_007294.3(BRCA1):c.1566_1567insC (p.Ala524fs) rs1555591551
NM_007294.3(BRCA1):c.1569G>A (p.Leu523=) rs766934857
NM_007294.3(BRCA1):c.1570del (p.Ala524fs) rs397508886
NM_007294.3(BRCA1):c.1575del (p.Gln526fs) rs879255478
NM_007294.3(BRCA1):c.1575dup (p.Gln526fs) rs879255478
NM_007294.3(BRCA1):c.1576C>T (p.Gln526Ter) rs80356984
NM_007294.3(BRCA1):c.1578A>G (p.Gln526=) rs762642319
NM_007294.3(BRCA1):c.1579_1580del (p.Lys527fs) rs431825387
NM_007294.3(BRCA1):c.1583_1589del (p.Thr528fs) rs80357613
NM_007294.3(BRCA1):c.1595_1601del (p.Ile532fs) rs397508888
NM_007294.3(BRCA1):c.1600C>T (p.Gln534Ter) rs142074233
NM_007294.3(BRCA1):c.1600del (p.Gln534fs) rs869320776
NM_007294.3(BRCA1):c.1601_1602del (p.Gln534fs) rs878854933
NM_007294.3(BRCA1):c.1601dup (p.Thr536fs) rs397508889
NM_007294.3(BRCA1):c.1608_1611del (p.Asn537fs) rs80357698
NM_007294.3(BRCA1):c.160C>T (p.Gln54Ter) rs80356864
NM_007294.3(BRCA1):c.160del (p.Gln54fs) rs397508890
NM_007294.3(BRCA1):c.1612C>T (p.Gln538Ter) rs80356893
NM_007294.3(BRCA1):c.1612_1616del (p.Gln538fs) rs587776480
NM_007294.3(BRCA1):c.1616_1625del (p.Thr539fs) rs886039959
NM_007294.3(BRCA1):c.1617G>A (p.Thr539=) rs372002119
NM_007294.3(BRCA1):c.1618G>T (p.Glu540Ter) rs730881471
NM_007294.3(BRCA1):c.1618del (p.Glu540fs) rs1555591470
NM_007294.3(BRCA1):c.1621C>T (p.Gln541Ter) rs80356904
NM_007294.3(BRCA1):c.1622_1626del (p.Gln541fs) rs879255314
NM_007294.3(BRCA1):c.1623dup (p.Asn542fs) rs397508891
NM_007294.3(BRCA1):c.1628del (p.Gly543fs) rs398122640
NM_007294.3(BRCA1):c.1630C>T (p.Gln544Ter) rs80356952
NM_007294.3(BRCA1):c.1632A>G (p.Gln544=) rs876658401
NM_007294.3(BRCA1):c.1635G>A (p.Val545=) rs770842236
NM_007294.3(BRCA1):c.1636_1654del (p.Met546fs) rs80359881
NM_007294.3(BRCA1):c.1637_1685delinsGAAAG (p.Met546fs) rs483353085
NM_007294.3(BRCA1):c.1638_1646delinsA (p.Met546fs) rs1135401846
NM_007294.3(BRCA1):c.1640_1641AT[1] (p.Ile548fs) rs886039960
NM_007294.3(BRCA1):c.1648A>C (p.Asn550His) rs56012641
NM_007294.3(BRCA1):c.1649del (p.Asn550fs) rs80357619
NM_007294.3(BRCA1):c.1650T>C (p.Asn550=) rs777595821
NM_007294.3(BRCA1):c.1650dup (p.Ser551Ter) rs753524038
NM_007294.3(BRCA1):c.1651_1652insC (p.Ser551fs) rs886039961
NM_007294.3(BRCA1):c.1652_1653insC (p.Gly552fs) rs1555591420
NM_007294.3(BRCA1):c.165_166dup (p.Lys56fs) rs80357550
NM_007294.3(BRCA1):c.1660G>T (p.Glu554Ter) rs397508894
NM_007294.3(BRCA1):c.1669del (p.Thr557fs) rs886039962
NM_007294.3(BRCA1):c.1670_1673del (p.Thr557fs) rs1555591390
NM_007294.3(BRCA1):c.1673_1674del (p.Lys558fs) rs80357600
NM_007294.3(BRCA1):c.1674del (p.Gly559fs) rs80357600
NM_007294.3(BRCA1):c.1674dup (p.Gly559fs) rs80357600
NM_007294.3(BRCA1):c.1685_1686insGAAAG (p.Ile562fs) rs1555591372
NM_007294.3(BRCA1):c.1687C>T (p.Gln563Ter) rs80356898
NM_007294.3(BRCA1):c.1693G>T (p.Glu565Ter) rs886039963
NM_007294.3(BRCA1):c.1695dup (p.Lys566fs) rs273897664
NM_007294.3(BRCA1):c.1700del (p.Asn567fs) rs80357784
NM_007294.3(BRCA1):c.1700dup (p.Asn567fs) rs80357784
NM_007294.3(BRCA1):c.1704T>C (p.Pro568=) rs587780795
NM_007294.3(BRCA1):c.1704T>G (p.Pro568=) rs587780795
NM_007294.3(BRCA1):c.1707C>T (p.Asn569=) rs876659110
NM_007294.3(BRCA1):c.1710A>G (p.Pro570=) rs876659901
NM_007294.3(BRCA1):c.1713_1717del (p.Glu572fs) rs80357640
NM_007294.3(BRCA1):c.1714G>T (p.Glu572Ter) rs730881473
NM_007294.3(BRCA1):c.1716del (p.Glu572fs) rs397508900
NM_007294.3(BRCA1):c.1716dup (p.Ser573fs) rs397508900
NM_007294.3(BRCA1):c.171del (p.Pro58fs) rs80357660
NM_007294.3(BRCA1):c.171dup (p.Pro58fs) rs80357660
NM_007294.3(BRCA1):c.1722C>T (p.Leu574=) rs530914551
NM_007294.3(BRCA1):c.1723G>T (p.Glu575Ter) rs397508902
NM_007294.3(BRCA1):c.1723dup (p.Glu575fs) rs1555591335
NM_007294.3(BRCA1):c.1726_1727insG (p.Lys576fs) rs1555591326
NM_007294.3(BRCA1):c.1728A>G (p.Lys576=) rs786201232
NM_007294.3(BRCA1):c.1728dup (p.Glu577fs) rs397507192
NM_007294.3(BRCA1):c.1729G>T (p.Glu577Ter) rs397508903
NM_007294.3(BRCA1):c.1729_1730del (p.Glu577fs) rs80357834
NM_007294.3(BRCA1):c.1731A>G (p.Glu577=) rs28897678
NM_007294.3(BRCA1):c.1733_1734del (p.Ser578fs) rs886037991
NM_007294.3(BRCA1):c.1741A>T (p.Lys581Ter) rs397508905
NM_007294.3(BRCA1):c.1744del (p.Thr582fs) rs398122641
NM_007294.3(BRCA1):c.1746G>A (p.Thr582=) rs776115545
NM_007294.3(BRCA1):c.1747A>T (p.Lys583Ter) rs80356928
NM_007294.3(BRCA1):c.1749A>G (p.Lys583=) rs876659580
NM_007294.3(BRCA1):c.1749_1755del (p.Lys583fs) rs886039965
NM_007294.3(BRCA1):c.1757del (p.Pro586fs) rs80357723
NM_007294.3(BRCA1):c.1759_1762del (p.Ile587fs) rs879255479
NM_007294.3(BRCA1):c.1759del (p.Pro586_Ile587insTer) rs398122642
NM_007294.3(BRCA1):c.1761A>C (p.Ile587=) rs1057523389
NM_007294.3(BRCA1):c.1762dup (p.Ser588fs) rs886039966
NM_007294.3(BRCA1):c.1763_1764del (p.Ser588fs) rs879254237
NM_007294.3(BRCA1):c.1768_1770delinsC (p.Ser590fs) rs876659196
NM_007294.3(BRCA1):c.176C>A (p.Ser59Ter) rs199522616
NM_007294.3(BRCA1):c.176_177CA[1] (p.Gln60fs) rs397508907
NM_007294.3(BRCA1):c.1772del (p.Ile591fs) rs80357901
NM_007294.3(BRCA1):c.1776C>T (p.Ser592=) rs876658911
NM_007294.3(BRCA1):c.1779_1785del (p.Met594fs) rs886039967
NM_007294.3(BRCA1):c.1780del (p.Met594fs) rs1135401848
NM_007294.3(BRCA1):c.1788C>T (p.Leu596=) rs779253414
NM_007294.3(BRCA1):c.1789G>A (p.Glu597Lys) rs55650082
NM_007294.3(BRCA1):c.1789G>T (p.Glu597Ter) rs55650082
NM_007294.3(BRCA1):c.178C>T (p.Gln60Ter) rs80357471
NM_007294.3(BRCA1):c.1793T>A (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1793T>G (p.Leu598Ter) rs80357118
NM_007294.3(BRCA1):c.1794A>G (p.Leu598=) rs876659644
NM_007294.3(BRCA1):c.1795_1798del (p.Asn599fs) rs886039968
NM_007294.3(BRCA1):c.1797T>C (p.Asn599=) rs756211343
NM_007294.3(BRCA1):c.1799del (p.Ile600fs) rs878854934
NM_007294.3(BRCA1):c.179del (p.Gln60fs) rs80357591
NM_007294.3(BRCA1):c.179dup (p.Cys61fs) rs886039969
NM_007294.3(BRCA1):c.1803del (p.His601fs) rs886039970
NM_007294.3(BRCA1):c.1805del (p.Asn602fs) rs397508908
NM_007294.3(BRCA1):c.1808C>G (p.Ser603Ter) rs397508909
NM_007294.3(BRCA1):c.180_181GT[1] (p.Cys61fs) rs397508912
NM_007294.3(BRCA1):c.1812del (p.Ala605fs) rs80357927
NM_007294.3(BRCA1):c.1817del (p.Pro606fs) rs397508910
NM_007294.3(BRCA1):c.1819A>T (p.Lys607Ter) rs80357220
NM_007294.3(BRCA1):c.181T>G (p.Cys61Gly) rs28897672
NM_007294.3(BRCA1):c.1820_1823del (p.Lys607fs) rs397508911
NM_007294.3(BRCA1):c.1823_1826delAGAA (p.Lys608Ilefs) rs80357585
NM_007294.3(BRCA1):c.1823del (p.Lys608fs) rs397508911
NM_007294.3(BRCA1):c.1826del (p.Asn609fs) rs80357736
NM_007294.3(BRCA1):c.1827T>C (p.Asn609=) rs757657445
NM_007294.3(BRCA1):c.182_183insGCGC (p.Cys61fs) rs886039971
NM_007294.3(BRCA1):c.1830G>A (p.Arg610=) rs587780796
NM_007294.3(BRCA1):c.1831del (p.Arg610_Leu611insTer) rs397508913
NM_007294.3(BRCA1):c.1833G>A (p.Leu611=) rs786201548
NM_007294.3(BRCA1):c.1836dup (p.Arg613fs) rs876660523
NM_007294.3(BRCA1):c.1837del (p.Arg613fs) rs80357652
NM_007294.3(BRCA1):c.1839G>A (p.Arg613=) rs759157605
NM_007294.3(BRCA1):c.1839_1840del (p.Lys614fs) rs752474843
NM_007294.3(BRCA1):c.183_184insGCGC (p.Pro62fs) rs1555597239
NM_007294.3(BRCA1):c.1840A>T (p.Lys614Ter) rs80357282
NM_007294.3(BRCA1):c.1842G>A (p.Lys614=) rs760109939
NM_007294.3(BRCA1):c.1842_1843dup (p.Ser615fs) rs767595162
NM_007294.3(BRCA1):c.1844_1845insG (p.Ser616fs) rs886039973
NM_007294.3(BRCA1):c.1845_1846insG (p.Ser616fs) rs1555591112
NM_007294.3(BRCA1):c.1846dup (p.Ser616fs) rs397508914
NM_007294.3(BRCA1):c.1847del (p.Ser616fs) rs886039974
NM_007294.3(BRCA1):c.1854del (p.Arg618fs) rs397507193
NM_007294.3(BRCA1):c.1860del (p.His621fs) rs730881459
NM_007294.3(BRCA1):c.1863T>C (p.His621=) rs786201460
NM_007294.3(BRCA1):c.1865C>T (p.Ala622Val) rs56039126
NM_007294.3(BRCA1):c.1866G>A (p.Ala622=) rs1800064
NM_007294.3(BRCA1):c.1866G>T (p.Ala622=) rs1800064
NM_007294.3(BRCA1):c.1870G>T (p.Glu624Ter) rs80356950
NM_007294.3(BRCA1):c.1874_1877dupTAGT (p.Val627Serfs) rs80357516
NM_007294.3(BRCA1):c.1875A>G (p.Leu625=) rs786201429
NM_007294.3(BRCA1):c.1875del (p.Leu625_Val626insTer) rs398122646
NM_007294.3(BRCA1):c.1878_1879insTAGT (p.Val627Ter) rs886039975
NM_007294.3(BRCA1):c.187_188del (p.Leu63fs) rs1555597235
NM_007294.3(BRCA1):c.1880_1881insAGTT (p.Ser628fs) rs1555591019
NM_007294.3(BRCA1):c.1881C>T (p.Val627=) rs80356838
NM_007294.3(BRCA1):c.1881_1882insCC (p.Ser628fs) rs878853289
NM_007294.3(BRCA1):c.1881_1884del (p.Ser628fs) rs80357567
NM_007294.3(BRCA1):c.1882_1883insCC (p.Ser628fs) rs1555590997
NM_007294.3(BRCA1):c.1885A>T (p.Arg629Ter) rs1555590987
NM_007294.3(BRCA1):c.1885del (p.Arg629fs) rs886039976
NM_007294.3(BRCA1):c.1887_1900dup (p.Pro634delinsGlnIleTer) rs886039977
NM_007294.3(BRCA1):c.188T>A (p.Leu63Ter) rs80357086
NM_007294.3(BRCA1):c.1892dupT (p.Ser632Lysfs) rs80357932
NM_007294.3(BRCA1):c.1893A>C (p.Leu631=) rs80356834
NM_007294.3(BRCA1):c.1893A>G (p.Leu631=) rs80356834
NM_007294.3(BRCA1):c.1893_1894insT (p.Ser632Ter) rs80357768
NM_007294.3(BRCA1):c.1894_1895insT (p.Ser632fs) rs1555590964
NM_007294.3(BRCA1):c.1898del (p.Pro633fs) rs80357851
NM_007294.3(BRCA1):c.189dupA (p.Cys64Metfs) rs273897665
NM_007294.3(BRCA1):c.1905T>C (p.Asn635=) rs369373293
NM_007294.3(BRCA1):c.1905_1909del (p.Asn635_Cys636insTer) rs886039979
NM_007294.3(BRCA1):c.1906del (p.Cys636fs) rs397508916
NM_007294.3(BRCA1):c.1908_1911del (p.Cys636fs) rs886039980
NM_007294.3(BRCA1):c.190_191insAATGTAAGGATGATATAAA (p.Cys64Ter) rs1555597215
NM_007294.3(BRCA1):c.190_193del (p.Cys64fs) rs397508917
NM_007294.3(BRCA1):c.190_211del (p.Cys64fs) rs886039978
NM_007294.3(BRCA1):c.1911T>C (p.Thr637=) rs62625305
NM_007294.3(BRCA1):c.1912G>T (p.Glu638Ter) rs80357005
NM_007294.3(BRCA1):c.1912del (p.Glu638fs) rs80357933
NM_007294.3(BRCA1):c.1916T>A (p.Leu639Ter) rs80357267
NM_007294.3(BRCA1):c.1917G>A (p.Leu639=) rs786202103
NM_007294.3(BRCA1):c.1918C>T (p.Gln640Ter) rs886039981
NM_007294.3(BRCA1):c.1921del (p.Ile641fs) rs397507194
NM_007294.3(BRCA1):c.1921dup (p.Ile641fs) rs397507194
NM_007294.3(BRCA1):c.1923dup (p.Asp642Ter) rs878854935
NM_007294.3(BRCA1):c.1924G>C (p.Asp642His) rs80357344
NM_007294.3(BRCA1):c.1926T>C (p.Asp642=) rs786203720
NM_007294.3(BRCA1):c.192T>A (p.Cys64Ter) rs587781632
NM_007294.3(BRCA1):c.1930del (p.Cys644fs) rs886039982
NM_007294.3(BRCA1):c.1936del (p.Ser646fs) rs397508919
NM_007294.3(BRCA1):c.1938_1945del (p.Ser646fs) rs886039983
NM_007294.3(BRCA1):c.1938_1947del (p.Ser646fs) rs397508920
NM_007294.3(BRCA1):c.1942G>T (p.Glu648Ter) rs886039984
NM_007294.3(BRCA1):c.1944A>G (p.Glu648=) rs876660781
NM_007294.3(BRCA1):c.1945G>T (p.Glu649Ter) rs80356907
NM_007294.3(BRCA1):c.1947G>A (p.Glu649=) rs755706172
NM_007294.3(BRCA1):c.1949_1950del (p.Ile650fs) rs397508921
NM_007294.3(BRCA1):c.1949_1952del (p.Ile650fs) rs886039985
NM_007294.3(BRCA1):c.1949dup (p.Lys652fs) rs879255480
NM_007294.3(BRCA1):c.1950_1951insCA (p.Lys651fs) rs1555590811
NM_007294.3(BRCA1):c.1952del (p.Lys651fs) rs80357885
NM_007294.3(BRCA1):c.1952dupA (p.Lys652Glufs) rs80357885
NM_007294.3(BRCA1):c.1953_1956delGAAA (p.Lys653Serfs) rs80357526
NM_007294.3(BRCA1):c.1953del (p.Lys654fs) rs886039986
NM_007294.3(BRCA1):c.1953dupG (p.Lys652Glufs) rs80357753
NM_007294.3(BRCA1):c.1958_1961del (p.Lys653fs) rs80357522
NM_007294.3(BRCA1):c.1959A>G (p.Lys653=) rs767530204
NM_007294.3(BRCA1):c.195del (p.Asn66fs) rs80357869
NM_007294.3(BRCA1):c.1960A>T (p.Lys654Ter) rs80357355
NM_007294.3(BRCA1):c.1960_1961del (p.Lys654fs) rs80357522
NM_007294.3(BRCA1):c.1961_1962del (p.Lys654fs) rs886037993
NM_007294.3(BRCA1):c.1961del (p.Lys654fs) rs80357522
NM_007294.3(BRCA1):c.1961dupA (p.Lys654delinsLysValfs) rs80357522
NM_007294.3(BRCA1):c.1962_1968del (p.Lys654fs) rs1135401849
NM_007294.3(BRCA1):c.1963_1964insG (p.Tyr655Ter) rs1555590789
NM_007294.3(BRCA1):c.1963dup (p.Tyr655fs) rs397508924
NM_007294.3(BRCA1):c.1964_1965insG (p.Tyr655Ter) rs1555590775
NM_007294.3(BRCA1):c.1964del (p.Tyr655fs) rs786203594
NM_007294.3(BRCA1):c.1965C>A (p.Tyr655Ter) rs886039987
NM_007294.3(BRCA1):c.1968C>T (p.Asn656=) rs1131692075
NM_007294.3(BRCA1):c.1969C>T (p.Gln657Ter) rs397508926
NM_007294.3(BRCA1):c.1971A>G (p.Gln657=) rs28897679
NM_007294.3(BRCA1):c.1972del (p.Met658fs) rs397507195
NM_007294.3(BRCA1):c.1977_1978del (p.Val660fs) rs773413634
NM_007294.3(BRCA1):c.1978del (p.Val660fs) rs886039988
NM_007294.3(BRCA1):c.1983G>A (p.Arg661=) rs869320788
NM_007294.3(BRCA1):c.198T>C (p.Asn66=) rs878854936
NM_007294.3(BRCA1):c.1994del (p.Asn665fs) rs1555590714
NM_007294.3(BRCA1):c.1996del (p.Leu666fs) rs80357922
NM_007294.3(BRCA1):c.1998A>G (p.Leu666=) rs864622452
NM_007294.3(BRCA1):c.1999C>T (p.Gln667Ter) rs80356889
NM_007294.3(BRCA1):c.199G>T (p.Asp67Tyr) rs80357102
NM_007294.3(BRCA1):c.19_47del (p.Arg7fs) rs80359871
NM_007294.3(BRCA1):c.2001A>G (p.Gln667=) rs878854937
NM_007294.3(BRCA1):c.2001dup (p.Leu668fs) rs80357521
NM_007294.3(BRCA1):c.2002C>T (p.Leu668Phe) rs80357250
NM_007294.3(BRCA1):c.2012_2013dup (p.Lys672fs) rs397508928
NM_007294.3(BRCA1):c.2012dup (p.Gly671_Lys672insTer) rs886039989
NM_007294.3(BRCA1):c.2014A>T (p.Lys672Ter) rs397508929
NM_007294.3(BRCA1):c.2016A>G (p.Lys672=) rs776542749
NM_007294.3(BRCA1):c.2017G>T (p.Glu673Ter) rs80357391
NM_007294.3(BRCA1):c.2017del (p.Glu673fs) rs80357638
NM_007294.3(BRCA1):c.2019del (p.Glu673fs) rs80357626
NM_007294.3(BRCA1):c.201T>C (p.Asp67=) rs80357033
NM_007294.3(BRCA1):c.201_202TA[1] (p.Ile68fs) rs398122651
NM_007294.3(BRCA1):c.2021del (p.Pro674fs) rs397508930
NM_007294.3(BRCA1):c.2022T>G (p.Pro674=) rs771519405
NM_007294.3(BRCA1):c.2028_2029del (p.Gly677fs) rs397508931
NM_007294.3(BRCA1):c.202dup (p.Ile68fs) rs886039990
NM_007294.3(BRCA1):c.2035A>T (p.Lys679Ter) rs80357082
NM_007294.3(BRCA1):c.2037G>A (p.Lys679=) rs572835027
NM_007294.3(BRCA1):c.2037delinsCC (p.Lys679fs) rs397508932
NM_007294.3(BRCA1):c.2038A>T (p.Lys680Ter) rs1135401850
NM_007294.3(BRCA1):c.2038_2039insCC (p.Lys680fs) rs80357940
NM_007294.3(BRCA1):c.2039_2040insCC (p.Lys680fs) rs1555590620
NM_007294.3(BRCA1):c.2043dup (p.Asn682Ter) rs863224510
NM_007294.3(BRCA1):c.2048del (p.Lys683fs) rs397508933
NM_007294.3(BRCA1):c.2049G>A (p.Lys683=) rs778215185
NM_007294.3(BRCA1):c.2056G>T (p.Glu686Ter) rs587782709
NM_007294.3(BRCA1):c.2059C>T (p.Gln687Ter) rs273898674
NM_007294.3(BRCA1):c.205dup (p.Thr69fs) rs273898673
NM_007294.3(BRCA1):c.2063_2066del (p.Thr688fs) rs397508935
NM_007294.3(BRCA1):c.2064A>G (p.Thr688=) rs1131692077
NM_007294.3(BRCA1):c.2066_2069del (p.Ser689fs) rs886037994
NM_007294.3(BRCA1):c.2068A>T (p.Lys690Ter) rs587781448
NM_007294.3(BRCA1):c.2071_2171del (p.Lys690_Arg691insTer) rs1555590294
NM_007294.3(BRCA1):c.2071del (p.Arg691fs) rs80357688
NM_007294.3(BRCA1):c.2074_2075del (p.Arg691_His692insTer) rs886037995
NM_007294.3(BRCA1):c.2074del (p.His692fs) rs80357554
NM_007294.3(BRCA1):c.2075_2076del (p.His692fs) rs397508936
NM_007294.3(BRCA1):c.2077G>A (p.Asp693Asn) rs4986850
NM_007294.3(BRCA1):c.2077_2078insTA (p.Asp693fs) rs80357595
NM_007294.3(BRCA1):c.2077delinsATA (p.Asp693fs) rs886039991
NM_007294.3(BRCA1):c.2078_2079insTA (p.Ser694fs) rs886039992
NM_007294.3(BRCA1):c.2079C>T (p.Asp693=) rs80356835
NM_007294.3(BRCA1):c.2079_2080del (p.Asp693fs) rs80357773
NM_007294.3(BRCA1):c.2079_2080insTA (p.Ser694Ter) rs1555590520
NM_007294.3(BRCA1):c.2080dup (p.Ser694fs) rs886039993
NM_007294.3(BRCA1):c.2082C>T (p.Ser694=) rs1799949
NM_007294.3(BRCA1):c.2086_2089del (p.Thr696fs) rs886039994
NM_007294.3(BRCA1):c.2086del (p.Thr696fs) rs397508937
NM_007294.3(BRCA1):c.2086dup (p.Thr696fs) rs886039995
NM_007294.3(BRCA1):c.2090del (p.Phe697fs) rs886039996
NM_007294.3(BRCA1):c.2090dup (p.Glu699fs) rs886039996
NM_007294.3(BRCA1):c.2094A>T (p.Pro698=) rs1131692098
NM_007294.3(BRCA1):c.2095G>T (p.Glu699Ter) rs876658306
NM_007294.3(BRCA1):c.2098_2099insA (p.Leu700fs) rs483353086
NM_007294.3(BRCA1):c.2099_2100insA (p.Lys701fs) rs1555590461
NM_007294.3(BRCA1):c.20dup (p.Val8fs) rs1555601027
NM_007294.3(BRCA1):c.2101A>T (p.Lys701Ter) rs876660282
NM_007294.3(BRCA1):c.2101_2102del (p.Lys701fs) rs431825389
NM_007294.3(BRCA1):c.2103G>A (p.Lys701=) rs273898677
NM_007294.3(BRCA1):c.2105T>G (p.Leu702Ter) rs80357298
NM_007294.3(BRCA1):c.2105del (p.Lys701_Leu702insTer) rs80357880
NM_007294.3(BRCA1):c.2105dup (p.Leu702fs) rs80357880
NM_007294.3(BRCA1):c.2109A>G (p.Thr703=) rs4986844
NM_007294.3(BRCA1):c.2110_2111del (p.Asn704fs) rs80357814
NM_007294.3(BRCA1):c.2112_2131dup (p.Lys711fs) rs886039998
NM_007294.3(BRCA1):c.2115A>T (p.Ala705=) rs1131692099
NM_007294.3(BRCA1):c.211del (p.Arg71fs) rs397508938
NM_007294.3(BRCA1):c.211dup (p.Arg71fs) rs397508938
NM_007294.3(BRCA1):c.212+23T>A rs8176128
NM_007294.3(BRCA1):c.212+325T>C rs55974475
NM_007294.3(BRCA1):c.212+3A>G rs80358083
NM_007294.3(BRCA1):c.212+430G>A rs8176130
NM_007294.3(BRCA1):c.212+657A>G rs8176132
NM_007294.3(BRCA1):c.2120del (p.Gly707fs) rs1555590441
NM_007294.3(BRCA1):c.2121T>G (p.Gly707=) rs786201649
NM_007294.3(BRCA1):c.2125_2126insA (p.Phe709fs) rs80357871
NM_007294.3(BRCA1):c.2125_2126insAGT (p.Phe709Ter) rs1555590428
NM_007294.3(BRCA1):c.2126_2127del (p.Phe709fs) rs397508939
NM_007294.3(BRCA1):c.2126_2127insA (p.Phe709fs) rs1135401851
NM_007294.3(BRCA1):c.2127_2128insGA (p.Thr710fs) rs886039999
NM_007294.3(BRCA1):c.2127del (p.Phe709fs) rs397508939
NM_007294.3(BRCA1):c.2128_2129insGA (p.Thr710fs) rs1555590415
NM_007294.3(BRCA1):c.2128dup (p.Thr710fs) rs1555590415
NM_007294.3(BRCA1):c.213-161A>G rs799912
NM_007294.3(BRCA1):c.213-266A>G rs8176134
NM_007294.3(BRCA1):c.213-485T>G rs8176133
NM_007294.3(BRCA1):c.2130T>G (p.Thr710=) rs273898678
NM_007294.3(BRCA1):c.2130delinsAA (p.Cys712fs) rs1060502332
NM_007294.3(BRCA1):c.2131_2132del (p.Lys711fs) rs398122653
NM_007294.3(BRCA1):c.2133_2134GT[1] (p.Cys712fs) rs886040001
NM_007294.3(BRCA1):c.2138C>A (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2138C>G (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2138_2139dup (p.Asn714fs) rs886040002
NM_007294.3(BRCA1):c.2139A>C (p.Ser713=) rs1131692089
NM_007294.3(BRCA1):c.2142_2144delinsAG (p.Asn714fs) rs886040003
NM_007294.3(BRCA1):c.2142del (p.Asn714fs) rs273898679
NM_007294.3(BRCA1):c.2145del (p.Ser716fs) rs886037996
NM_007294.3(BRCA1):c.2149G>T (p.Glu717Ter) rs886040004
NM_007294.3(BRCA1):c.2154T>G (p.Leu718=) rs779227326
NM_007294.3(BRCA1):c.2155A>T (p.Lys719Ter) rs80357147
NM_007294.3(BRCA1):c.2155_2168del (p.Lys719fs) rs397508941
NM_007294.3(BRCA1):c.2155_2221dup (p.Ser741Ter) rs1555590136
NM_007294.3(BRCA1):c.2157_2160del (p.Lys719fs) rs886040005
NM_007294.3(BRCA1):c.2157dup (p.Glu720fs) rs80357715
NM_007294.3(BRCA1):c.2158G>T (p.Glu720Ter) rs80356875
NM_007294.3(BRCA1):c.2161_2162insG (p.Phe721fs) rs886040006
NM_007294.3(BRCA1):c.2162_2163insG (p.Phe721fs) rs1555590332
NM_007294.3(BRCA1):c.2166del (p.Asn723fs) rs397508943
NM_007294.3(BRCA1):c.2167A>G (p.Asn723Asp) rs4986845
NM_007294.3(BRCA1):c.2174del (p.Ser725fs) rs397508944
NM_007294.3(BRCA1):c.2175C>T (p.Ser725=) rs273898680
NM_007294.3(BRCA1):c.2176_2177del (p.Leu726fs) rs397508945
NM_007294.3(BRCA1):c.2176del (p.Leu726fs) rs80357668
NM_007294.3(BRCA1):c.217C>T (p.Leu73=) rs786201203
NM_007294.3(BRCA1):c.2185G>T (p.Glu729Ter) rs876659852
NM_007294.3(BRCA1):c.2185_2189del (p.Glu729fs) rs886040007
NM_007294.3(BRCA1):c.2185del (p.Glu729fs) rs1064795840
NM_007294.3(BRCA1):c.2188G>T (p.Glu730Ter) rs80357058
NM_007294.3(BRCA1):c.2188_2195delinsAAAAAGG (p.Glu730fs) rs886040008
NM_007294.3(BRCA1):c.2188_2201del (p.Glu730fs) rs273898681
NM_007294.3(BRCA1):c.2188dup (p.Glu730fs) rs80357566
NM_007294.3(BRCA1):c.2192_2196del (p.Lys731fs) rs397508946
NM_007294.3(BRCA1):c.2193_2196del (p.Glu732fs) rs397508947
NM_007294.3(BRCA1):c.2193del (p.Glu732fs) rs886040009
NM_007294.3(BRCA1):c.2194G>T (p.Glu732Ter) rs80357426
NM_007294.3(BRCA1):c.2194delGinsAA (p.Glu732Lysfs) rs886040010
NM_007294.3(BRCA1):c.2195_2196delinsG (p.Glu732fs) rs397508948
NM_007294.3(BRCA1):c.2196del (p.Glu733fs) rs397508948
NM_007294.3(BRCA1):c.2197G>T (p.Glu733Ter) rs397508949
NM_007294.3(BRCA1):c.2197_2201del (p.Glu733fs) rs80357507
NM_007294.3(BRCA1):c.2198dup (p.Lys734fs) rs886040012
NM_007294.3(BRCA1):c.2199del (p.Lys734fs) rs80357944
NM_007294.3(BRCA1):c.219A>G (p.Leu73=) rs876659123
NM_007294.3(BRCA1):c.21C>T (p.Arg7=) rs149402012
NM_007294.3(BRCA1):c.2202del (p.Lys734fs) rs80357982
NM_007294.3(BRCA1):c.2202dup (p.Leu735fs) rs80357982
NM_007294.3(BRCA1):c.2203del (p.Lys734_Leu735insTer) rs80357936
NM_007294.3(BRCA1):c.2205del (p.Glu736fs) rs886040015
NM_007294.3(BRCA1):c.2206del (p.Glu736fs) rs80357860
NM_007294.3(BRCA1):c.2209del (p.Thr737fs) rs1060502333
NM_007294.3(BRCA1):c.220C>T (p.Gln74Ter) rs80357234
NM_007294.3(BRCA1):c.2210_2211del (p.Thr737fs) rs80357654
NM_007294.3(BRCA1):c.2210del (p.Thr737fs) rs80357793
NM_007294.3(BRCA1):c.2211_2212del (p.Thr737_Val738insTer) rs397508950
NM_007294.3(BRCA1):c.2211dup (p.Val738fs) rs886040016
NM_007294.3(BRCA1):c.2212_2215del (p.Val738fs) rs397508951
NM_007294.3(BRCA1):c.2213_2214dup (p.Lys739fs) rs80357574
NM_007294.3(BRCA1):c.2214_2218delinsAAA (p.Lys739fs) rs886040017
NM_007294.3(BRCA1):c.2214del (p.Val740fs) rs80357574
NM_007294.3(BRCA1):c.2214dup (p.Lys739Ter) rs80357574
NM_007294.3(BRCA1):c.2215A>T (p.Lys739Ter) rs56329598
NM_007294.3(BRCA1):c.2215_2216insCT (p.Lys739fs) rs80357930
NM_007294.3(BRCA1):c.2216_2217del (p.Lys739fs) rs80357802
NM_007294.3(BRCA1):c.2216_2217insCT (p.Lys739fs) rs1555590163
NM_007294.3(BRCA1):c.2217A>G (p.Lys739=) rs200521980
NM_007294.3(BRCA1):c.2217dup (p.Val740fs) rs80357802
NM_007294.3(BRCA1):c.2218del (p.Val740fs) rs886040018
NM_007294.3(BRCA1):c.2222_2223del (p.Val740_Ser741insTer) rs886040019
NM_007294.3(BRCA1):c.2223dup (p.Asn742Ter) rs886040020
NM_007294.3(BRCA1):c.2226_2227del (p.Asn742fs) rs878854938
NM_007294.3(BRCA1):c.222A>G (p.Gln74=) rs730881465
NM_007294.3(BRCA1):c.2232T>C (p.Ala744=) rs4986846
NM_007294.3(BRCA1):c.2232T>G (p.Ala744=) rs4986846
NM_007294.3(BRCA1):c.2236dupG (p.Asp746Glyfs) rs80357909
NM_007294.3(BRCA1):c.2241del (p.Asp749fs) rs80357650
NM_007294.3(BRCA1):c.2241dupC (p.Lys748Glnfs) rs80357650
NM_007294.3(BRCA1):c.2242_2251del (p.Lys748fs) rs886037997
NM_007294.3(BRCA1):c.2246_2280del (p.Asp749fs) rs886037998
NM_007294.3(BRCA1):c.2247_2248insGA (p.Leu750fs) rs1555590055
NM_007294.3(BRCA1):c.2248_2252del (p.Leu750fs) rs397508954
NM_007294.3(BRCA1):c.224_227del (p.Glu75fs) rs80357697
NM_007294.3(BRCA1):c.2253_2254del (p.Met751fs) rs80357602
NM_007294.3(BRCA1):c.2255T>A (p.Leu752Ter) rs1135401852
NM_007294.3(BRCA1):c.2255_2256dup (p.Ser753Ter) rs80357557
NM_007294.3(BRCA1):c.2257dup (p.Ser753fs) rs1555590033
NM_007294.3(BRCA1):c.2263G>T (p.Glu755Ter) rs41286296
NM_007294.3(BRCA1):c.2263del (p.Glu755fs) rs80357960
NM_007294.3(BRCA1):c.2269del (p.Val757fs) rs80357583
NM_007294.3(BRCA1):c.2273T>A (p.Leu758Ter) rs1060502334
NM_007294.3(BRCA1):c.2273del (p.Leu758fs) rs80357681
NM_007294.3(BRCA1):c.2273dup (p.Leu758fs) rs80357681
NM_007294.3(BRCA1):c.2274G>A (p.Leu758=) rs876660823
NM_007294.3(BRCA1):c.2275C>T (p.Gln759Ter) rs80356999
NM_007294.3(BRCA1):c.2283_2284del (p.Arg762fs) rs80357657
NM_007294.3(BRCA1):c.2289del (p.Ser763_Val764insTer) rs876658791
NM_007294.3(BRCA1):c.2292_2293AG[2] (p.Glu765_Ser766insTer) rs80357780
NM_007294.3(BRCA1):c.2292_2310dup (p.Leu771delinsArgGluTer) rs397508955
NM_007294.3(BRCA1):c.2293G>T (p.Glu765Ter) rs80357449
NM_007294.3(BRCA1):c.2295G>A (p.Glu765=) rs201875054
NM_007294.3(BRCA1):c.2298dup (p.Ser767Ter) rs786204264
NM_007294.3(BRCA1):c.2299del (p.Ser767fs) rs80357786
NM_007294.3(BRCA1):c.22_50del (p.Val8fs) rs886040013
NM_007294.3(BRCA1):c.2302del (p.Ser768fs) rs1555589953
NM_007294.3(BRCA1):c.2307_2313del (p.Ile769fs) rs886040022
NM_007294.3(BRCA1):c.2308del (p.Ser770fs) rs397508956
NM_007294.3(BRCA1):c.2309C>A (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2309C>G (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.230delinsGTCAACTTGTT (p.Thr77fs) rs397508957
NM_007294.3(BRCA1):c.2311T>C (p.Leu771=) rs16940
NM_007294.3(BRCA1):c.2311_2312insC (p.Leu771fs) rs886040023
NM_007294.3(BRCA1):c.2311_2317del (p.Pro773fs) rs1060502354
NM_007294.3(BRCA1):c.2312_2313insC (p.Leu771fs) rs1555589935
NM_007294.3(BRCA1):c.2314_2315del (p.Val772fs) rs886040024
NM_007294.3(BRCA1):c.2314del (p.Val772fs) rs80357957
NM_007294.3(BRCA1):c.2315T>C (p.Val772Ala) rs80357467
NM_007294.3(BRCA1):c.2316A>C (p.Val772=) rs876658590
NM_007294.3(BRCA1):c.231G>A (p.Thr77=) rs80356847
NM_007294.3(BRCA1):c.231G>C (p.Thr77=) rs80356847
NM_007294.3(BRCA1):c.231G>T (p.Thr77=) rs80356847
NM_007294.3(BRCA1):c.2322T>A (p.Gly774=) rs397508958
NM_007294.3(BRCA1):c.2322del (p.Thr775fs) rs886040025
NM_007294.3(BRCA1):c.2327dup (p.Asp776fs) rs1555589901
NM_007294.3(BRCA1):c.2329del (p.Tyr777fs) rs80357725
NM_007294.3(BRCA1):c.232del (p.Arg78fs) rs80357884
NM_007294.3(BRCA1):c.2331T>A (p.Tyr777Ter) rs80357444
NM_007294.3(BRCA1):c.2331T>G (p.Tyr777Ter) rs80357444
NM_007294.3(BRCA1):c.2331_2332dup (p.Gly778fs) rs431825390
NM_007294.3(BRCA1):c.2334C>T (p.Gly778=) rs777404687
NM_007294.3(BRCA1):c.2337_2338del (p.Gln780fs) rs80357515
NM_007294.3(BRCA1):c.2338C>T (p.Gln780Ter) rs80356945
NM_007294.3(BRCA1):c.2340_2343del (p.Glu781fs) rs886040026
NM_007294.3(BRCA1):c.2346dup (p.Ile783fs) rs886040027
NM_007294.3(BRCA1):c.2348_2349TC[1] (p.Ser784fs) rs397508960
NM_007294.3(BRCA1):c.2351_2357del (p.Ser784fs) rs80357820
NM_007294.3(BRCA1):c.2352G>A (p.Ser784=) rs372017932
NM_007294.3(BRCA1):c.2354T>A (p.Leu785Ter) rs397508961
NM_007294.3(BRCA1):c.2355dup (p.Leu786fs) rs80357990
NM_007294.3(BRCA1):c.2356del (p.Leu786fs) rs397508962
NM_007294.3(BRCA1):c.2357del (p.Leu786fs) rs397508963
NM_007294.3(BRCA1):c.2359del (p.Glu787fs) rs80357739
NM_007294.3(BRCA1):c.2359dupG (p.Glu787Glyfs) rs80357739
NM_007294.3(BRCA1):c.2361del (p.Val788fs) rs886040028
NM_007294.3(BRCA1):c.2362del (p.Val788fs) rs876659136
NM_007294.3(BRCA1):c.2368_2369del (p.Thr790fs) rs886040029
NM_007294.3(BRCA1):c.2376del (p.Lys793fs) rs80357913
NM_007294.3(BRCA1):c.2378dup (p.Ala794fs) rs864622536
NM_007294.3(BRCA1):c.237del (p.Phe79fs) rs886040030
NM_007294.3(BRCA1):c.2380dup (p.Ala794fs) rs886037999
NM_007294.3(BRCA1):c.2386_2387delinsT (p.Lys795_Thr796insTer) rs876660305
NM_007294.3(BRCA1):c.2386dup (p.Thr796fs) rs398122657
NM_007294.3(BRCA1):c.2387dup (p.Glu797fs) rs886040031
NM_007294.3(BRCA1):c.2389G>T (p.Glu797Ter) rs62625306
NM_007294.3(BRCA1):c.2389_2390del (p.Glu797fs) rs80357695
NM_007294.3(BRCA1):c.2389del (p.Glu797fs) rs397508965
NM_007294.3(BRCA1):c.2390_2391del (p.Glu797fs) rs80357546
NM_007294.3(BRCA1):c.2393del (p.Pro798fs) rs80357850
NM_007294.3(BRCA1):c.2394_2397AAAT[1] (p.Lys800fs) rs786202684
NM_007294.3(BRCA1):c.2396del (p.Asn799fs) rs886040033
NM_007294.3(BRCA1):c.2398_2411del (p.Lys800fs) rs886040034
NM_007294.3(BRCA1):c.239_241delinsTT (p.Ser80fs) rs886040032
NM_007294.3(BRCA1):c.2402del (p.Cys801fs) rs876659447
NM_007294.3(BRCA1):c.2403T>A (p.Cys801Ter) rs80357381
NM_007294.3(BRCA1):c.2406_2409del (p.Gln804fs) rs80357674
NM_007294.3(BRCA1):c.2407_2408del (p.Gln804fs) rs786202919
NM_007294.3(BRCA1):c.2409del (p.Gln804fs) rs770460699
NM_007294.3(BRCA1):c.2410C>T (p.Gln804Ter) rs80356982
NM_007294.3(BRCA1):c.2411_2412del (p.Gln804fs) rs80357664
NM_007294.3(BRCA1):c.2411del (p.Gln804fs) rs886040035
NM_007294.3(BRCA1):c.2412G>A (p.Gln804=) rs55746541
NM_007294.3(BRCA1):c.2412G>C (p.Gln804His) rs55746541
NM_007294.3(BRCA1):c.2418del (p.Ala807fs) rs879255281
NM_007294.3(BRCA1):c.2418dup (p.Ala807fs) rs886040036
NM_007294.3(BRCA1):c.241C>T (p.Gln81Ter) rs80357350
NM_007294.3(BRCA1):c.241_251del (p.Gln81fs) rs398122659
NM_007294.3(BRCA1):c.2421A>G (p.Ala807=) rs772960140
NM_007294.3(BRCA1):c.2424del (p.Phe808fs) rs397507200
NM_007294.3(BRCA1):c.2428A>T (p.Asn810Tyr) rs28897682
NM_007294.3(BRCA1):c.2429del (p.Asn810fs) rs397508967
NM_007294.3(BRCA1):c.2429dup (p.Asn810fs) rs397508967
NM_007294.3(BRCA1):c.2433del (p.Lys812fs) rs80357524
NM_007294.3(BRCA1):c.2433dup (p.Lys812fs) rs80357524
NM_007294.3(BRCA1):c.2434A>T (p.Lys812Ter) rs397508968
NM_007294.3(BRCA1):c.2437G>T (p.Gly813Ter) rs80357186
NM_007294.3(BRCA1):c.2438dup (p.Leu814fs) rs80357503
NM_007294.3(BRCA1):c.243A>G (p.Gln81=) rs863224418
NM_007294.3(BRCA1):c.243del (p.Gln81fs) rs273899684
NM_007294.3(BRCA1):c.2440C>T (p.Leu814=) rs786202054
NM_007294.3(BRCA1):c.2442_2443insT (p.Ile815fs) rs886040038
NM_007294.3(BRCA1):c.2443del (p.Ile815fs) rs80357598
NM_007294.3(BRCA1):c.2443dup (p.Ile815fs) rs80357598
NM_007294.3(BRCA1):c.2445_2448del (p.Ile815fs) rs886038000
NM_007294.3(BRCA1):c.2445dup (p.His816fs) rs1555589652
NM_007294.3(BRCA1):c.2450del (p.Gly817fs) rs80357679
NM_007294.3(BRCA1):c.2457del (p.Asp821fs) rs80357669
NM_007294.3(BRCA1):c.2458A>G (p.Lys820Glu) rs56082113
NM_007294.3(BRCA1):c.2467del (p.Arg823fs) rs1064795446
NM_007294.3(BRCA1):c.2468del (p.Arg823fs) rs80357799
NM_007294.3(BRCA1):c.246del (p.Val83fs) rs886040039
NM_007294.3(BRCA1):c.2472T>C (p.Asn824=) rs786201415
NM_007294.3(BRCA1):c.2473del (p.Asp825fs) rs886040040
NM_007294.3(BRCA1):c.2474dup (p.Asp825fs) rs80357830
NM_007294.3(BRCA1):c.2475_2476CA[1] (p.Thr826fs) rs80357800
NM_007294.3(BRCA1):c.2475del (p.Asp825fs) rs80357970
NM_007294.3(BRCA1):c.2476del (p.Thr826fs) rs80357631
NM_007294.3(BRCA1):c.2477C>A (p.Thr826Lys) rs28897683
NM_007294.3(BRCA1):c.2477_2492delinsTG (p.Thr826fs) rs886040041
NM_007294.3(BRCA1):c.2477del (p.Thr826fs) rs80357740
NM_007294.3(BRCA1):c.2481del (p.Gly828fs) rs886040042
NM_007294.3(BRCA1):c.2486_2487del (p.Gly828_Phe829insTer) rs80357658
NM_007294.3(BRCA1):c.2487_2488insCCCCT (p.Lys830fs) rs397508972
NM_007294.3(BRCA1):c.2487del (p.Phe829fs) rs80357658
NM_007294.3(BRCA1):c.2487dup (p.Lys830Ter) rs80357658
NM_007294.3(BRCA1):c.2488_2489insCCCCT (p.Lys830fs) rs1555589565
NM_007294.3(BRCA1):c.2488_2497dup (p.Leu833Ter) rs397508973
NM_007294.3(BRCA1):c.2488_2504dup (p.His835fs) rs483353078
NM_007294.3(BRCA1):c.2489_2490insAAGTATCCAT (p.Tyr831fs) rs1555589559
NM_007294.3(BRCA1):c.2489_2492del (p.Lys830fs) rs886040043
NM_007294.3(BRCA1):c.2490_2497dup (p.Leu833fs) rs1555589539
NM_007294.3(BRCA1):c.2493_2494insGT (p.Pro832fs) rs1555589547
NM_007294.3(BRCA1):c.2496A>T (p.Pro832=) rs767666029
NM_007294.3(BRCA1):c.249T>C (p.Val83=) rs780485347
NM_007294.3(BRCA1):c.2501del (p.Gly834fs) rs886040044
NM_007294.3(BRCA1):c.2506del (p.Glu836fs) rs587780798
NM_007294.3(BRCA1):c.2507_2508del (p.Glu836fs) rs273899686
NM_007294.3(BRCA1):c.250G>T (p.Glu84Ter) rs398122661
NM_007294.3(BRCA1):c.2513del (p.Asn838fs) rs80357863
NM_007294.3(BRCA1):c.2515_2516CA[1] (p.His839fs) rs397508974
NM_007294.3(BRCA1):c.2515del (p.His839fs) rs80357607
NM_007294.3(BRCA1):c.2518del (p.Ser840fs) rs397508975
NM_007294.3(BRCA1):c.2521C>T (p.Arg841Trp) rs1800709
NM_007294.3(BRCA1):c.2523G>A (p.Arg841=) rs773013395
NM_007294.3(BRCA1):c.2523G>C (p.Arg841=) rs773013395
NM_007294.3(BRCA1):c.2524G>T (p.Glu842Ter) rs876658552
NM_007294.3(BRCA1):c.2524dup (p.Glu842fs) rs886040045
NM_007294.3(BRCA1):c.2525A>G (p.Glu842Gly) rs28897684
NM_007294.3(BRCA1):c.2527del (p.Thr843fs) rs1085308034
NM_007294.3(BRCA1):c.2529_2530del (p.Ser844fs) rs886040046
NM_007294.3(BRCA1):c.2532_2536del (p.Ser844fs) rs886040047
NM_007294.3(BRCA1):c.2535A>C (p.Ile845=) rs876660248
NM_007294.3(BRCA1):c.2536G>T (p.Glu846Ter) rs786203523
NM_007294.3(BRCA1):c.2538_2540delinsG (p.Met847fs) rs886040048
NM_007294.3(BRCA1):c.2542_2545del (p.Glu848fs) rs886040049
NM_007294.3(BRCA1):c.2545G>T (p.Glu849Ter) rs80356951
NM_007294.3(BRCA1):c.2548del (p.Ser850fs) rs1555589434
NM_007294.3(BRCA1):c.2551G>T (p.Glu851Ter) rs398122662
NM_007294.3(BRCA1):c.2551del (p.Glu851fs) rs397508977
NM_007294.3(BRCA1):c.2552_2553del (p.Glu851fs) rs886040050
NM_007294.3(BRCA1):c.2552_2553dup (p.Leu852fs) rs886040051
NM_007294.3(BRCA1):c.2556del (p.Asp853fs) rs397508978
NM_007294.3(BRCA1):c.2556dup (p.Asp853Ter) rs397508978
NM_007294.3(BRCA1):c.2557_2558insTTCACTTTTC (p.Asp853fs) rs1555589410
NM_007294.3(BRCA1):c.2558dupA (p.Asp853Glufs) rs80357835
NM_007294.3(BRCA1):c.255G>A (p.Glu85=) rs756499058
NM_007294.3(BRCA1):c.2560_2561dup (p.Gln855fs) rs80357968
NM_007294.3(BRCA1):c.2561_2565del (p.Ala854fs) rs397508981
NM_007294.3(BRCA1):c.2562_2563insGC (p.Gln855fs) rs878853290
NM_007294.3(BRCA1):c.2563C>T (p.Gln855Ter) rs80357131
NM_007294.3(BRCA1):c.2563_2564insGC (p.Gln855fs) rs1555589397
NM_007294.3(BRCA1):c.2566T>C (p.Tyr856His) rs80356892
NM_007294.3(BRCA1):c.2566_2567insTGATT (p.Tyr856fs) rs1555589385
NM_007294.3(BRCA1):c.2568T>C (p.Tyr856=) rs80356832
NM_007294.3(BRCA1):c.2568T>G (p.Tyr856Ter) rs80356832
NM_007294.3(BRCA1):c.2569T>C (p.Leu857=) rs779895958
NM_007294.3(BRCA1):c.2570T>A (p.Leu857Ter) rs886037787
NM_007294.3(BRCA1):c.2572C>T (p.Gln858Ter) rs397508983
NM_007294.3(BRCA1):c.2576del (p.Asn859fs) rs1555589351
NM_007294.3(BRCA1):c.2577_2578insTT (p.Thr860fs) rs886040052
NM_007294.3(BRCA1):c.2578_2579insTT (p.Thr860fs) rs1555589340
NM_007294.3(BRCA1):c.2580A>G (p.Thr860=) rs556684572
NM_007294.3(BRCA1):c.2584A>G (p.Lys862Glu) rs80356927
NM_007294.3(BRCA1):c.2586_2593del (p.Val863fs) rs80357675
NM_007294.3(BRCA1):c.2587del (p.Val863fs) rs886040053
NM_007294.3(BRCA1):c.258A>G (p.Leu86=) rs777491912
NM_007294.3(BRCA1):c.258A>T (p.Leu86=) rs777491912
NM_007294.3(BRCA1):c.2591C>G (p.Ser864Ter) rs80357003
NM_007294.3(BRCA1):c.2593A>T (p.Lys865Ter) rs587782628
NM_007294.3(BRCA1):c.2594del (p.Lys865fs) rs80357756
NM_007294.3(BRCA1):c.2596C>T (p.Arg866Cys) rs41286300
NM_007294.3(BRCA1):c.2599C>T (p.Gln867Ter) rs886038001
NM_007294.3(BRCA1):c.2601G>A (p.Gln867=) rs876659166
NM_007294.3(BRCA1):c.2601_2604dup (p.Phe869fs) rs80357603
NM_007294.3(BRCA1):c.2603C>A (p.Ser868Ter) rs80356925
NM_007294.3(BRCA1):c.2603C>G (p.Ser868Ter) rs80356925
NM_007294.3(BRCA1):c.2604A>C (p.Ser868=) rs864622491
NM_007294.3(BRCA1):c.260T>A (p.Leu87Ter) rs886040054
NM_007294.3(BRCA1):c.2611_2612del (p.Pro871fs) rs80357962
NM_007294.3(BRCA1):c.2612C>T (p.Pro871Leu) rs799917
NM_007294.3(BRCA1):c.2612_2613insT (p.Phe872fs) rs80357948
NM_007294.3(BRCA1):c.2612delinsTT (p.Pro871fs) rs397508986
NM_007294.3(BRCA1):c.2612dup (p.Phe872fs) rs1555589289
NM_007294.3(BRCA1):c.2613G>A (p.Pro871=) rs587782608
NM_007294.3(BRCA1):c.2617del (p.Ser873fs) rs80357912
NM_007294.3(BRCA1):c.2617dupT (p.Ser873Phefs) rs80357912
NM_007294.3(BRCA1):c.261G>A (p.Leu87=) rs757971617
NM_007294.3(BRCA1):c.2621del (p.Asn874fs) rs587781423
NM_007294.3(BRCA1):c.2625A>G (p.Pro875=) rs754222140
NM_007294.3(BRCA1):c.2625A>T (p.Pro875=) rs754222140
NM_007294.3(BRCA1):c.2630del (p.Asn877fs) rs886038002
NM_007294.3(BRCA1):c.2634A>G (p.Ala878=) rs730881451
NM_007294.3(BRCA1):c.2635G>T (p.Glu879Ter) rs80357251
NM_007294.3(BRCA1):c.2637del (p.Glu880fs) rs886040056
NM_007294.3(BRCA1):c.2641G>T (p.Glu881Ter) rs397508988
NM_007294.3(BRCA1):c.2643del (p.Glu881fs) rs397508989
NM_007294.3(BRCA1):c.2646_2648del (p.Cys882_Ala883delinsTer) rs80357513
NM_007294.3(BRCA1):c.2647_2648insGGCA (p.Ala883fs) rs1555589236
NM_007294.3(BRCA1):c.2648_2649insGGCA (p.Thr884fs) rs886040057
NM_007294.3(BRCA1):c.2649_2650del (p.Thr884fs) rs886040058
NM_007294.3(BRCA1):c.2649_2650insGGCA (p.Thr884fs) rs886038003
NM_007294.3(BRCA1):c.2650_2651insGGCA (p.Thr884fs) rs1555589228
NM_007294.3(BRCA1):c.2652dup (p.Phe885fs) rs886040059
NM_007294.3(BRCA1):c.2654del (p.Phe885fs) rs398122663
NM_007294.3(BRCA1):c.2654dup (p.Ser886fs) rs398122663
NM_007294.3(BRCA1):c.2655_2656CT[1] (p.Ser886fs) rs397508990
NM_007294.3(BRCA1):c.2658_2659insA (p.Ala887fs) rs80357541
NM_007294.3(BRCA1):c.2659_2660insA (p.Ala887fs) rs397508991
NM_007294.3(BRCA1):c.2659dup (p.Ala887fs) rs1555589203
NM_007294.3(BRCA1):c.2660_2661insA (p.His888fs) rs1555589195
NM_007294.3(BRCA1):c.2665dup (p.Ser889fs) rs397508992
NM_007294.3(BRCA1):c.2666dup (p.Gly890fs) rs876660425
NM_007294.3(BRCA1):c.2669G>T (p.Gly890Val) rs80356874
NM_007294.3(BRCA1):c.2670G>T (p.Gly890=) rs786201677
NM_007294.3(BRCA1):c.2670del (p.Ser891fs) rs80357659
NM_007294.3(BRCA1):c.2671del (p.Ser891fs) rs397508993
NM_007294.3(BRCA1):c.2674T>C (p.Leu892=) rs137998759
NM_007294.3(BRCA1):c.2675T>G (p.Leu892Ter) rs397508994
NM_007294.3(BRCA1):c.2675_2678del (p.Ser891_Leu892insTer) rs80357518
NM_007294.3(BRCA1):c.2677A>T (p.Lys893Ter) rs80357170
NM_007294.3(BRCA1):c.2678dup (p.Lys894fs) rs886040060
NM_007294.3(BRCA1):c.2679G>A (p.Lys893=) rs587781771
NM_007294.3(BRCA1):c.2679_2680del (p.Lys894fs) rs397508995
NM_007294.3(BRCA1):c.2679_2682del (p.Lys893fs) rs80357596
NM_007294.3(BRCA1):c.2680A>T (p.Lys894Ter) rs876659457
NM_007294.3(BRCA1):c.2681_2682del (p.Lys894fs) rs80357971
NM_007294.3(BRCA1):c.2682A>G (p.Lys894=) rs1131692093
NM_007294.3(BRCA1):c.2682del (p.Lys894fs) rs80357971
NM_007294.3(BRCA1):c.2683C>T (p.Gln895Ter) rs397508997
NM_007294.3(BRCA1):c.2683_2686del (p.Gln895fs) rs397508998
NM_007294.3(BRCA1):c.2683_2693del (p.Gln895fs) rs886040061
NM_007294.3(BRCA1):c.2685_2686del (p.Pro897fs) rs80357636
NM_007294.3(BRCA1):c.2686del (p.Ser896fs) rs80357636
NM_007294.3(BRCA1):c.2686dup (p.Ser896fs) rs80357636
NM_007294.3(BRCA1):c.2687_2693del (p.Ser896fs) rs886040062
NM_007294.3(BRCA1):c.2688_2689insA (p.Pro897fs) rs1555589140
NM_007294.3(BRCA1):c.2689_2690insAC (p.Pro897fs) rs1555589138
NM_007294.3(BRCA1):c.2690_2691dup (p.Lys898fs) rs1555589128
NM_007294.3(BRCA1):c.2693_2694dup (p.Val899fs) rs80357549
NM_007294.3(BRCA1):c.2694del (p.Val899fs) rs80357549
NM_007294.3(BRCA1):c.2694dup (p.Val899fs) rs80357549
NM_007294.3(BRCA1):c.269_281del (p.Ile90fs) rs80359879
NM_007294.3(BRCA1):c.2702_2703del (p.Thr900_Phe901insTer) rs80357899
NM_007294.3(BRCA1):c.2704del (p.Glu902fs) rs886040064
NM_007294.3(BRCA1):c.2706A>G (p.Glu902=) rs398122665
NM_007294.3(BRCA1):c.2706_2707dup (p.Cys903fs) rs80357717
NM_007294.3(BRCA1):c.2707_2708TG[1] (p.Cys903_Glu904delinsTer) rs886040065
NM_007294.3(BRCA1):c.2707del (p.Cys903fs) rs1064794864
NM_007294.3(BRCA1):c.2709del (p.Cys903fs) rs80357594
NM_007294.3(BRCA1):c.2710G>T (p.Glu904Ter) rs80357035
NM_007294.3(BRCA1):c.2710del (p.Glu904fs) rs886040066
NM_007294.3(BRCA1):c.2713C>T (p.Gln905Ter) rs397509002
NM_007294.3(BRCA1):c.2717del (p.Lys906fs) rs876659072
NM_007294.3(BRCA1):c.2719G>T (p.Glu907Ter) rs876658593
NM_007294.3(BRCA1):c.2719_2722del (p.Glu907fs) rs80357731
NM_007294.3(BRCA1):c.2719del (p.Glu907fs) rs879255481
NM_007294.3(BRCA1):c.271_272TG[1] (p.Ala92fs) rs587776485
NM_007294.3(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.3(BRCA1):c.2726_2730del (p.Asn909fs) rs80357712
NM_007294.3(BRCA1):c.2726del (p.Asn909fs) rs80357614
NM_007294.3(BRCA1):c.2726dupA (p.Asn909Lysfs) rs80357614
NM_007294.3(BRCA1):c.2727_2730del (p.Asn909fs) rs80357605
NM_007294.3(BRCA1):c.2728C>T (p.Gln910Ter) rs397509004
NM_007294.3(BRCA1):c.2728del (p.Gln910fs) rs397509005
NM_007294.3(BRCA1):c.2733A>G (p.Gly911=) rs1800740
NM_007294.3(BRCA1):c.2739T>C (p.Asn913=) rs273899688
NM_007294.3(BRCA1):c.2740G>T (p.Glu914Ter) rs80357419
NM_007294.3(BRCA1):c.2744_2745del (p.Glu914_Ser915insTer) rs80357540
NM_007294.3(BRCA1):c.2745T>G (p.Ser915=) rs876658748
NM_007294.3(BRCA1):c.2745dup (p.Asn916Ter) rs397509008
NM_007294.3(BRCA1):c.2748del (p.Asn916fs) rs398122667
NM_007294.3(BRCA1):c.2749dupA (p.Ile917Asnfs) rs80357942
NM_007294.3(BRCA1):c.2750del (p.Ile917fs) rs886040067
NM_007294.3(BRCA1):c.2751del (p.Lys918fs) rs886040068
NM_007294.3(BRCA1):c.2753_2755delinsCA (p.Lys918fs) rs886040069
NM_007294.3(BRCA1):c.2755_2756insGGGTG (p.Pro919fs) rs1555589008
NM_007294.3(BRCA1):c.2757T>C (p.Pro919=) rs755516286
NM_007294.3(BRCA1):c.2760_2763ACAG[1] (p.Thr922fs) rs80357822
NM_007294.3(BRCA1):c.2760del (p.Gln921fs) rs1064795769
NM_007294.3(BRCA1):c.2761C>T (p.Gln921Ter) rs80357377
NM_007294.3(BRCA1):c.2762del (p.Gln921fs) rs80357703
NM_007294.3(BRCA1):c.2766del (p.Val923fs) rs80357812
NM_007294.3(BRCA1):c.2767_2770del (p.Val923fs) rs80357661
NM_007294.3(BRCA1):c.2773A>C (p.Ile925Leu) rs4986847
NM_007294.3(BRCA1):c.2774del (p.Ile925fs) rs398122669
NM_007294.3(BRCA1):c.2775C>T (p.Ile925=) rs786201104
NM_007294.3(BRCA1):c.2776_2777del (p.Thr926fs) rs886040070
NM_007294.3(BRCA1):c.2776_2777insTA (p.Thr926fs) rs886040071
NM_007294.3(BRCA1):c.2778_2779insAT (p.Ala927fs) rs886040072
NM_007294.3(BRCA1):c.2778dup (p.Ala927fs) rs886040072
NM_007294.3(BRCA1):c.2783del (p.Gly928fs) rs1064795600
NM_007294.3(BRCA1):c.2787_2788insTTATCACTGCAGGCTTT (p.Pro930fs) rs886040073
NM_007294.3(BRCA1):c.2788_2789insTTATCACTGCAGGCTTT (p.Pro930fs) rs1555588952
NM_007294.3(BRCA1):c.2790T>C (p.Pro930=) rs876659151
NM_007294.3(BRCA1):c.2792_2795TGGT[1] (p.Gly933fs) rs80357840
NM_007294.3(BRCA1):c.2793G>A (p.Val931=) rs876660555
NM_007294.3(BRCA1):c.2796del (p.Gly933fs) rs1555588942
NM_007294.3(BRCA1):c.2798_2799del (p.Gly933fs) rs397509011
NM_007294.3(BRCA1):c.2799del (p.Gln934fs) rs80357998
NM_007294.3(BRCA1):c.2800C>T (p.Gln934Ter) rs80357223
NM_007294.3(BRCA1):c.2805del (p.Asp936fs) rs397509012
NM_007294.3(BRCA1):c.2805dup (p.Asp936fs) rs397509012
NM_007294.3(BRCA1):c.2806_2807del (p.Lys935_Asp936insTer) rs886038004
NM_007294.3(BRCA1):c.2806_2809del (p.Asp936fs) rs80357832
NM_007294.3(BRCA1):c.2808_2811del (p.Lys937fs) rs397509013
NM_007294.3(BRCA1):c.2809A>T (p.Lys937Ter) rs1555588915
NM_007294.3(BRCA1):c.280C>T (p.Gln94Ter) rs886037972
NM_007294.3(BRCA1):c.2811G>A (p.Lys937=) rs876659271
NM_007294.3(BRCA1):c.2812_2813del (p.Pro938fs) rs730882056
NM_007294.3(BRCA1):c.2812_2813delinsG (p.Pro938fs) rs273899689
NM_007294.3(BRCA1):c.2814A>G (p.Pro938=) rs80356851
NM_007294.3(BRCA1):c.2814del (p.Val939fs) rs886040074
NM_007294.3(BRCA1):c.2823del (p.Asn941fs) rs886040075
NM_007294.3(BRCA1):c.2829A>G (p.Lys943=) rs1131692088
NM_007294.3(BRCA1):c.2830del (p.Cys944fs) rs397509014
NM_007294.3(BRCA1):c.2832T>A (p.Cys944Ter) rs80357458
NM_007294.3(BRCA1):c.2834_2835del (p.Ser945fs) rs397509015
NM_007294.3(BRCA1):c.2834_2836delinsC (p.Ser945fs) rs386134270
NM_007294.3(BRCA1):c.2835dupT (p.Ile946Tyrfs) rs80357519
NM_007294.3(BRCA1):c.2836_2837del (p.Ile946fs) rs397509016
NM_007294.3(BRCA1):c.2840_2841del (p.Lys947fs) rs80357984
NM_007294.3(BRCA1):c.2843del (p.Gly948fs) rs886040076
NM_007294.3(BRCA1):c.2844_2853del (p.Gly949fs) rs397509017
NM_007294.3(BRCA1):c.2848dup (p.Ser950fs) rs397509018
NM_007294.3(BRCA1):c.2850_2851insC (p.Arg951fs) rs886040077
NM_007294.3(BRCA1):c.2850dup (p.Arg951Ter) rs1555588846
NM_007294.3(BRCA1):c.2851_2852insC (p.Arg951fs) rs1555588844
NM_007294.3(BRCA1):c.2856_2857del (p.Phe952fs) rs397509019
NM_007294.3(BRCA1):c.2860C>T (p.Leu954=) rs730881452
NM_007294.3(BRCA1):c.2861_2864del (p.Leu954fs) rs886040078
NM_007294.3(BRCA1):c.2861dup (p.Ser955fs) rs886040079
NM_007294.3(BRCA1):c.2862A>C (p.Leu954=) rs559190752
NM_007294.3(BRCA1):c.2862A>G (p.Leu954=) rs559190752
NM_007294.3(BRCA1):c.2864C>A (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2864C>G (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2865A>G (p.Ser955=) rs748285767
NM_007294.3(BRCA1):c.2865A>T (p.Ser955=) rs748285767
NM_007294.3(BRCA1):c.2866_2870del (p.Ser956fs) rs80357819
NM_007294.3(BRCA1):c.2866dup (p.Ser956fs) rs1555588822
NM_007294.3(BRCA1):c.2868del (p.Gln957fs) rs80357929
NM_007294.3(BRCA1):c.2869C>T (p.Gln957Ter) rs80356973
NM_007294.3(BRCA1):c.2870dup (p.Phe958fs) rs397509020
NM_007294.3(BRCA1):c.2871_2872insA (p.Phe958fs) rs80357693
NM_007294.3(BRCA1):c.2872_2873insA (p.Phe958fs) rs1555588803
NM_007294.3(BRCA1):c.2872_2876del (p.Phe958fs) rs397509021
NM_007294.3(BRCA1):c.2875del (p.Arg959fs) rs886040080
NM_007294.3(BRCA1):c.2878_2879del (p.Gly960fs) rs886040081
NM_007294.3(BRCA1):c.2882del (p.Asn961fs) rs886040082
NM_007294.3(BRCA1):c.2883C>T (p.Asn961=) rs201190540
NM_007294.3(BRCA1):c.2887del (p.Thr963fs) rs80357559
NM_007294.3(BRCA1):c.2889T>C (p.Thr963=) rs876659125
NM_007294.3(BRCA1):c.2889_2890del (p.Gly964fs) rs80357890
NM_007294.3(BRCA1):c.288C>T (p.Asp96=) rs146085503
NM_007294.3(BRCA1):c.288_289CA[1] (p.Thr97fs) rs80357738
NM_007294.3(BRCA1):c.2890G>T (p.Gly964Ter) rs879254027
NM_007294.3(BRCA1):c.2898T>C (p.Ile966=) rs786202249
NM_007294.3(BRCA1):c.2898del (p.Thr967fs) rs886038005
NM_007294.3(BRCA1):c.2901_2902dup (p.Pro968fs) rs398122670
NM_007294.3(BRCA1):c.2903_2904insTC (p.Asn969fs) rs886040083
NM_007294.3(BRCA1):c.2903dup (p.Asn969fs) rs1555588756
NM_007294.3(BRCA1):c.2904_2905insTC (p.Asn969fs) rs1555588752
NM_007294.3(BRCA1):c.2906_2908delinsCT (p.Asn969fs) rs886040084
NM_007294.3(BRCA1):c.2906del (p.Asn969fs) rs886040085
NM_007294.3(BRCA1):c.2910del (p.Lys970fs) rs80357893
NM_007294.3(BRCA1):c.2912_2913del (p.His971fs) rs878854940
NM_007294.3(BRCA1):c.2913T>C (p.His971=) rs786203804
NM_007294.3(BRCA1):c.2914G>T (p.Gly972Ter) rs397509023
NM_007294.3(BRCA1):c.2915del (p.Gly972fs) rs80357573
NM_007294.3(BRCA1):c.2917_2920del (p.Leu973fs) rs886040086
NM_007294.3(BRCA1):c.291A>G (p.Thr97=) rs1131692085
NM_007294.3(BRCA1):c.2920T>C (p.Leu974=) rs763845063
NM_007294.3(BRCA1):c.2920_2921del (p.Leu974fs) rs80357611
NM_007294.3(BRCA1):c.2921T>A (p.Leu974Ter) rs80356872
NM_007294.3(BRCA1):c.2921dup (p.Leu974fs) rs80357611
NM_007294.3(BRCA1):c.2923C>T (p.Gln975Ter) rs80357497
NM_007294.3(BRCA1):c.2927del (p.Asn976fs) rs886038006
NM_007294.3(BRCA1):c.2929_2930dup (p.Tyr978fs) rs397509025
NM_007294.3(BRCA1):c.2931A>G (p.Pro977=) rs273899691
NM_007294.3(BRCA1):c.2933dup (p.Tyr978Ter) rs878853292
NM_007294.3(BRCA1):c.2934T>A (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934T>G (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2934del (p.Arg979fs) rs80357741
NM_007294.3(BRCA1):c.2938del (p.Ile980fs) rs730881439
NM_007294.3(BRCA1):c.2940del (p.Pro981fs) rs80357876
NM_007294.3(BRCA1):c.2943A>T (p.Pro981=) rs587780799
NM_007294.3(BRCA1):c.2945del (p.Pro982fs) rs730881461
NM_007294.3(BRCA1):c.2947del (p.Leu983fs) rs876659108
NM_007294.3(BRCA1):c.2951_2952del (p.Phe984fs) rs80357627
NM_007294.3(BRCA1):c.2952del (p.Ile986fs) rs80357627
NM_007294.3(BRCA1):c.2952dup (p.Pro985fs) rs80357627
NM_007294.3(BRCA1):c.2955del (p.Ile986fs) rs397509027
NM_007294.3(BRCA1):c.2959A>T (p.Lys987Ter) rs878854941
NM_007294.3(BRCA1):c.2960_2964del (p.Lys987fs) rs1555588625
NM_007294.3(BRCA1):c.2960dup (p.Ser988fs) rs886040088
NM_007294.3(BRCA1):c.2963C>A (p.Ser988Ter) rs397507206
NM_007294.3(BRCA1):c.2967del (p.Phe989fs) rs397509028
NM_007294.3(BRCA1):c.2970del (p.Thr992fs) rs886040089
NM_007294.3(BRCA1):c.2971A>T (p.Lys991Ter) rs886040090
NM_007294.3(BRCA1):c.2973_2979del (p.Lys991fs) rs397509030
NM_007294.3(BRCA1):c.2974_2990del (p.Thr992fs) rs397509031
NM_007294.3(BRCA1):c.2979A>G (p.Lys993=) rs772854836
NM_007294.3(BRCA1):c.2980del (p.Cys994fs) rs80357502
NM_007294.3(BRCA1):c.2981_2982del (p.Lys993_Cys994insTer) rs397507207
NM_007294.3(BRCA1):c.2981del (p.Cys994fs) rs886040091
NM_007294.3(BRCA1):c.2983A>T (p.Lys995Ter) rs879255315
NM_007294.3(BRCA1):c.2989_2990dup (p.Asn997fs) rs80357829
NM_007294.3(BRCA1):c.2990del (p.Asn997fs) rs80357829
NM_007294.3(BRCA1):c.2995C>T (p.Leu999=) rs80356848
NM_007294.3(BRCA1):c.2995_2996delinsTA (p.Leu999Ter) rs273899692
NM_007294.3(BRCA1):c.2999del (p.Glu1000fs) rs80357991
NM_007294.3(BRCA1):c.3001G>T (p.Glu1001Ter) rs886038007
NM_007294.3(BRCA1):c.3005delA (p.Asn1002Thrfs) rs80357601
NM_007294.3(BRCA1):c.3006_3009del (p.Asn1002fs) rs886040092
NM_007294.3(BRCA1):c.3008_3009del (p.Asn1002_Phe1003insTer) rs80357617
NM_007294.3(BRCA1):c.3009T>C (p.Phe1003=) rs786201587
NM_007294.3(BRCA1):c.3010G>T (p.Glu1004Ter) rs786202534
NM_007294.3(BRCA1):c.3012G>A (p.Glu1004=) rs786201784
NM_007294.3(BRCA1):c.3013del (p.Glu1005fs) rs80357937
NM_007294.3(BRCA1):c.3015del (p.Glu1005fs) rs886038008
NM_007294.3(BRCA1):c.3016_3020del (p.His1006fs) rs1135401855
NM_007294.3(BRCA1):c.3018_3021del (p.His1006fs) rs80357749
NM_007294.3(BRCA1):c.302-1G>C rs80358116
NM_007294.3(BRCA1):c.302-41T>C rs8176135
NM_007294.3(BRCA1):c.302-70G>A rs147809611
NM_007294.3(BRCA1):c.3020C>G (p.Ser1007Ter) rs80357168
NM_007294.3(BRCA1):c.3020_3023del (p.Ser1007fs) rs886040093
NM_007294.3(BRCA1):c.3022A>G (p.Met1008Val) rs56321129
NM_007294.3(BRCA1):c.3024G>A (p.Met1008Ile) rs1800704
NM_007294.3(BRCA1):c.3024dup (p.Ser1009fs) rs886040094
NM_007294.3(BRCA1):c.3026C>A (p.Ser1009Ter) rs273899696
NM_007294.3(BRCA1):c.3029_3030del (p.Pro1010fs) rs80357510
NM_007294.3(BRCA1):c.3030T>G (p.Pro1010=) rs876660048
NM_007294.3(BRCA1):c.3035_3036GA[1] (p.Glu1013fs) rs397507208
NM_007294.3(BRCA1):c.303T>A (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.303T>C (p.Tyr101=) rs80356936
NM_007294.3(BRCA1):c.303T>G (p.Tyr101Ter) rs80356936
NM_007294.3(BRCA1):c.3044dup (p.Asn1016fs) rs80357746
NM_007294.3(BRCA1):c.3045A>C (p.Gly1015=) rs1131692079
NM_007294.3(BRCA1):c.3048_3052dupTGAGA (p.Asn1018Metfs) rs80357856
NM_007294.3(BRCA1):c.3049G>T (p.Glu1017Ter) rs80357004
NM_007294.3(BRCA1):c.3053_3054insTGAGA (p.Ile1019fs) rs80357547
NM_007294.3(BRCA1):c.3054_3055insTGAGA (p.Ile1019Ter) rs1555588469
NM_007294.3(BRCA1):c.3056_3059del (p.Ile1019fs) rs1135401856
NM_007294.3(BRCA1):c.3060A>G (p.Pro1020=) rs781435355
NM_007294.3(BRCA1):c.3062del (p.Ser1021fs) rs1135401857
NM_007294.3(BRCA1):c.3069G>A (p.Val1023=) rs1131692091
NM_007294.3(BRCA1):c.3075A>C (p.Thr1025=) rs786201258
NM_007294.3(BRCA1):c.3075_3076insGGAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGATCATTCCAAGTACAGTGAGCACA (p.Ile1026delinsGlyLysLeuTer) rs886040095
NM_007294.3(BRCA1):c.3076_3077insGGAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGATCATTCCAAGTACAGTGAGCACA (p.Ile1026delinsArgLysThrLeuArgAsnIleGlnCysHisLeuLysGluLysTrpGluMetArgSerPheGlnValGlnTer) rs1555588427
NM_007294.3(BRCA1):c.3083G>A (p.Arg1028His) rs80357459
NM_007294.3(BRCA1):c.3084_3094del (p.Asn1029fs) rs80357647
NM_007294.3(BRCA1):c.3087_3100dup (p.Asn1034fs) rs80357967
NM_007294.3(BRCA1):c.3091dup (p.Ile1031fs) rs1555588399
NM_007294.3(BRCA1):c.3093T>A (p.Ile1031=) rs786204265
NM_007294.3(BRCA1):c.3097G>T (p.Glu1033Ter) rs273899698
NM_007294.3(BRCA1):c.309C>T (p.Asn103=) rs876659814
NM_007294.3(BRCA1):c.3107_3112del (p.Phe1036_Glu1038delinsTer) rs80357920
NM_007294.3(BRCA1):c.3108del (p.Phe1036fs) rs80357841
NM_007294.3(BRCA1):c.3108dup (p.Lys1037Ter) rs80357841
NM_007294.3(BRCA1):c.3109_3110insT (p.Lys1037fs) rs886040096
NM_007294.3(BRCA1):c.310del (p.Ser104fs) rs886040097
NM_007294.3(BRCA1):c.310dup (p.Ser104fs) rs1555596484
NM_007294.3(BRCA1):c.3110_3111insT (p.Lys1037fs) rs1555588381
NM_007294.3(BRCA1):c.3112G>T (p.Glu1038Ter) rs80357161
NM_007294.3(BRCA1):c.3113A>G (p.Glu1038Gly) rs16941
NM_007294.3(BRCA1):c.3114_3117delinsGA (p.Ala1039fs) rs273899700
NM_007294.3(BRCA1):c.3115del (p.Ala1039fs) rs886040098
NM_007294.3(BRCA1):c.3117_3120del (p.Ser1040fs) rs886040099
NM_007294.3(BRCA1):c.3119G>A (p.Ser1040Asn) rs4986852
NM_007294.3(BRCA1):c.3122C>G (p.Ser1041Ter) rs397509035
NM_007294.3(BRCA1):c.3125_3134del (p.Ser1042fs) rs397509036
NM_007294.3(BRCA1):c.3129_3138del (p.Asn1043fs) rs730881462
NM_007294.3(BRCA1):c.3130A>G (p.Ile1044Val) rs80357271
NM_007294.3(BRCA1):c.3132del (p.Asn1045fs) rs879255316
NM_007294.3(BRCA1):c.3138_3141del (p.Gly1048fs) rs1064794177
NM_007294.3(BRCA1):c.3143del (p.Gly1048fs) rs886040100
NM_007294.3(BRCA1):c.3144T>C (p.Gly1048=) rs80356837
NM_007294.3(BRCA1):c.3145del (p.Ser1049fs) rs397509038
NM_007294.3(BRCA1):c.314A>G (p.Tyr105Cys) rs28897673
NM_007294.3(BRCA1):c.3150_3208dup (p.Ala1070delinsValLeuMetLysTrpAlaProValLeuMetLysTer) rs1555588199
NM_007294.3(BRCA1):c.3153T>C (p.Thr1051=) rs1057521053
NM_007294.3(BRCA1):c.3155del (p.Asn1052fs) rs397509040
NM_007294.3(BRCA1):c.3157G>T (p.Glu1053Ter) rs786203587
NM_007294.3(BRCA1):c.3157del (p.Glu1053fs) rs397509041
NM_007294.3(BRCA1):c.3157dup (p.Glu1053fs) rs397509042
NM_007294.3(BRCA1):c.3158_3159insG (p.Val1054fs) rs80357769
NM_007294.3(BRCA1):c.3164del (p.Gly1055fs) rs397509043
NM_007294.3(BRCA1):c.3168del (p.Ser1057fs) rs397509044
NM_007294.3(BRCA1):c.3169_3172del (p.Ser1057fs) rs397509045
NM_007294.3(BRCA1):c.3171T>C (p.Ser1057=) rs746394738
NM_007294.3(BRCA1):c.3174del (p.Asn1059fs) rs397507210
NM_007294.3(BRCA1):c.3178G>T (p.Glu1060Ter) rs80357424
NM_007294.3(BRCA1):c.317del (p.Asn106fs) rs80357950
NM_007294.3(BRCA1):c.3181del (p.Glu1060_Ile1061insTer) rs80357702
NM_007294.3(BRCA1):c.3182del (p.Ile1061fs) rs886040101
NM_007294.3(BRCA1):c.3183del (p.Ile1061fs) rs397509046
NM_007294.3(BRCA1):c.3188_3189delinsG (p.Gly1062_Ser1063insTer) rs273899701
NM_007294.3(BRCA1):c.3193dup (p.Asp1065fs) rs80357511
NM_007294.3(BRCA1):c.3196G>T (p.Glu1066Ter) rs1555588220
NM_007294.3(BRCA1):c.3196dup (p.Glu1066fs) rs1555588222
NM_007294.3(BRCA1):c.3203_3206del (p.Ile1068fs) rs886040102
NM_007294.3(BRCA1):c.3204del (p.Gln1069fs) rs398122673
NM_007294.3(BRCA1):c.3205del (p.Gln1069fs) rs886040103
NM_007294.3(BRCA1):c.3210A>T (p.Ala1070=) rs1131692068
NM_007294.3(BRCA1):c.3210dup (p.Glu1071fs) rs886040104
NM_007294.3(BRCA1):c.3211_3212dup (p.Leu1072fs) rs886040105
NM_007294.3(BRCA1):c.3211dup (p.Glu1071fs) rs397509047
NM_007294.3(BRCA1):c.3213A>G (p.Glu1071=) rs528254652
NM_007294.3(BRCA1):c.3214del (p.Glu1071_Leu1072insTer) rs80357923
NM_007294.3(BRCA1):c.3217_3218del (p.Leu1072_Gly1073insTer) rs886040106
NM_007294.3(BRCA1):c.321del (p.Phe107fs) rs80357544
NM_007294.3(BRCA1):c.3226A>T (p.Arg1076Ter) rs886038009
NM_007294.3(BRCA1):c.3226_3227AG[1] (p.Gly1077fs) rs80357635
NM_007294.3(BRCA1):c.3226del (p.Arg1076fs) rs273899703
NM_007294.3(BRCA1):c.3234A>G (p.Pro1078=) rs876660522
NM_007294.3(BRCA1):c.3238T>C (p.Leu1080=) rs754597283
NM_007294.3(BRCA1):c.3239T>A (p.Leu1080Ter) rs80357145
NM_007294.3(BRCA1):c.3242_3246ATGCT[1] (p.Ala1082_Met1083insTer) rs1135401859
NM_007294.3(BRCA1):c.3243T>C (p.Asn1081=) rs876659805
NM_007294.3(BRCA1):c.3243_3288dup (p.Ser1097delinsCysTyrAlaTer) rs1555588016
NM_007294.3(BRCA1):c.3253dupA (p.Arg1085Lysfs) rs80357517
NM_007294.3(BRCA1):c.3254_3255dup (p.Leu1086fs) rs80357624
NM_007294.3(BRCA1):c.3255dupA (p.Leu1086Ilefs) rs1555588090
NM_007294.3(BRCA1):c.3256_3257insGA (p.Leu1086Ter) rs80357764
NM_007294.3(BRCA1):c.3257T>A (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3257T>G (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3257_3258insGA (p.Gly1087fs) rs1555588074
NM_007294.3(BRCA1):c.3257del (p.Arg1085_Leu1086insTer) rs80357858
NM_007294.3(BRCA1):c.3257dupT (p.Leu1086Phefs) rs80357858
NM_007294.3(BRCA1):c.3258del (p.Val1088fs) rs886040107
NM_007294.3(BRCA1):c.3262_3277del (p.Val1088fs) rs886040108
NM_007294.3(BRCA1):c.3262del (p.Val1088fs) rs397509049
NM_007294.3(BRCA1):c.3266T>A (p.Leu1089Ter) rs886040110
NM_007294.3(BRCA1):c.3266del (p.Leu1089fs) rs886040109
NM_007294.3(BRCA1):c.3268C>T (p.Gln1090Ter) rs80357402
NM_007294.3(BRCA1):c.3270A>G (p.Gln1090=) rs369925993
NM_007294.3(BRCA1):c.3279_3280del (p.Val1093_Tyr1094insTer) rs886038010
NM_007294.3(BRCA1):c.3279del (p.Tyr1094fs) rs397509050
NM_007294.3(BRCA1):c.3282T>G (p.Tyr1094Ter) rs886040111
NM_007294.3(BRCA1):c.3285del (p.Lys1095fs) rs397509051
NM_007294.3(BRCA1):c.3286C>T (p.Gln1096Ter) rs80357485
NM_007294.3(BRCA1):c.3286del (p.Gln1096fs) rs80357533
NM_007294.3(BRCA1):c.3288_3289del (p.Leu1098fs) rs80357686
NM_007294.3(BRCA1):c.3289del (p.Ser1097fs) rs80357686
NM_007294.3(BRCA1):c.3289dup (p.Ser1097fs) rs80357686
NM_007294.3(BRCA1):c.3292_3293del (p.Leu1098fs) rs80357992
NM_007294.3(BRCA1):c.3294del (p.Pro1099fs) rs876658626
NM_007294.3(BRCA1):c.3296C>T (p.Pro1099Leu) rs80357201
NM_007294.3(BRCA1):c.3296del (p.Pro1099fs) rs80357815
NM_007294.3(BRCA1):c.329_330del (p.Lys110fs) rs80357754
NM_007294.3(BRCA1):c.329del (p.Lys110fs) rs80357604
NM_007294.3(BRCA1):c.329dup (p.Glu111fs) rs80357604
NM_007294.3(BRCA1):c.32_33insC (p.Gln12fs) rs80357811
NM_007294.3(BRCA1):c.3302G>A (p.Ser1101Asn) rs41293447
NM_007294.3(BRCA1):c.3306T>C (p.Asn1102=) rs876658664
NM_007294.3(BRCA1):c.3308_3309insC (p.Cys1103_Lys1104insTer) rs886040113
NM_007294.3(BRCA1):c.3309T>A (p.Cys1103Ter) rs80357317
NM_007294.3(BRCA1):c.3309_3310insC (p.Lys1104fs) rs1555587980
NM_007294.3(BRCA1):c.330G>A (p.Lys110=) rs878854947
NM_007294.3(BRCA1):c.330_331insA (p.Glu111fs) rs886040112
NM_007294.3(BRCA1):c.3312G>A (p.Lys1104=) rs876659024
NM_007294.3(BRCA1):c.3314del (p.His1105fs) rs397509054
NM_007294.3(BRCA1):c.3317del (p.Pro1106fs) rs1555587972
NM_007294.3(BRCA1):c.3319G>T (p.Glu1107Ter) rs80357106
NM_007294.3(BRCA1):c.331del (p.Glu111fs) rs886040114
NM_007294.3(BRCA1):c.3323_3324del (p.Ile1108fs) rs786202791
NM_007294.3(BRCA1):c.3323_3326del (p.Ile1108fs) rs80357763
NM_007294.3(BRCA1):c.3325_3329del (p.Lys1109fs) rs80357575
NM_007294.3(BRCA1):c.3326_3329del (p.Lys1109fs) rs80357575
NM_007294.3(BRCA1):c.3327A>C (p.Lys1109Asn) rs41293449
NM_007294.3(BRCA1):c.3327A>G (p.Lys1109=) rs41293449
NM_007294.3(BRCA1):c.3329_3330del (p.Lys1110fs) rs80357525
NM_007294.3(BRCA1):c.3329del (p.Lys1110fs) rs80357575
NM_007294.3(BRCA1):c.3329dupA (p.Gln1111Alafs) rs80357575
NM_007294.3(BRCA1):c.3330_3331insA (p.Gln1111fs) rs80357996
NM_007294.3(BRCA1):c.3330del (p.Lys1110fs) rs886038011
NM_007294.3(BRCA1):c.3331C>T (p.Gln1111Ter) rs80357089
NM_007294.3(BRCA1):c.3331_3334del (p.Gln1111fs) rs80357701
NM_007294.3(BRCA1):c.3331_3335del (p.Gln1111fs) rs886040115
NM_007294.3(BRCA1):c.3331del (p.Gln1111fs) rs886040116
NM_007294.3(BRCA1):c.3333_3336del (p.Gln1111fs) rs397509057
NM_007294.3(BRCA1):c.3333del (p.Glu1112fs) rs80357966
NM_007294.3(BRCA1):c.3333dup (p.Glu1112fs) rs80357966
NM_007294.3(BRCA1):c.3334del (p.Glu1112fs) rs1555587944
NM_007294.3(BRCA1):c.3339T>G (p.Tyr1113Ter) rs80357421
NM_007294.3(BRCA1):c.3339_3341del (p.Tyr1113_Glu1114delinsTer) rs886040117
NM_007294.3(BRCA1):c.3340G>T (p.Glu1114Ter) rs80357278
NM_007294.3(BRCA1):c.3342_3345del (p.Glu1114_Glu1115insTer) rs397509058
NM_007294.3(BRCA1):c.3343del (p.Glu1115fs) rs273899705
NM_007294.3(BRCA1):c.3348A>G (p.Val1116=) rs1131692073
NM_007294.3(BRCA1):c.3351dup (p.Gln1118fs) rs80357785
NM_007294.3(BRCA1):c.3352C>T (p.Gln1118Ter) rs397507215
NM_007294.3(BRCA1):c.3354_3355del (p.Gln1118fs) rs397509059
NM_007294.3(BRCA1):c.3357del (p.Val1120fs) rs80357827
NM_007294.3(BRCA1):c.3358_3359del (p.Thr1119_Val1120insTer) rs80357945
NM_007294.3(BRCA1):c.3358_3368del (p.Val1120fs) rs886040118
NM_007294.3(BRCA1):c.3359_3360del (p.Val1120fs) rs80357843
NM_007294.3(BRCA1):c.3359_3363del (p.Val1120fs) rs397509060
NM_007294.3(BRCA1):c.335_338del (p.Asn112fs) rs587782666
NM_007294.3(BRCA1):c.335del (p.Asn112fs) rs886040119
NM_007294.3(BRCA1):c.335dup (p.Asn112fs) rs886040119
NM_007294.3(BRCA1):c.3360dup (p.Asn1121Ter) rs886040120
NM_007294.3(BRCA1):c.3362del (p.Asn1121fs) rs80357865
NM_007294.3(BRCA1):c.3365_3366del (p.Thr1122fs) rs80357892
NM_007294.3(BRCA1):c.3371_3372TC[2] (p.Pro1126fs) rs80357828
NM_007294.3(BRCA1):c.3372C>T (p.Phe1124=) rs786203431
NM_007294.3(BRCA1):c.3373dup (p.Ser1125fs) rs886040121
NM_007294.3(BRCA1):c.3377del (p.Pro1126fs) rs397509061
NM_007294.3(BRCA1):c.3381T>C (p.Tyr1127=) rs781319410
NM_007294.3(BRCA1):c.3381T>G (p.Tyr1127Ter) rs781319410
NM_007294.3(BRCA1):c.3384_3391del (p.Leu1128_Ile1129insTer) rs886040122
NM_007294.3(BRCA1):c.3388del (p.Ser1130fs) rs886040123
NM_007294.3(BRCA1):c.3389C>G (p.Ser1130Ter) rs80357405
NM_007294.3(BRCA1):c.3390del (p.Asp1131fs) rs80357900
NM_007294.3(BRCA1):c.3395del (p.Asn1132fs) rs886040124
NM_007294.3(BRCA1):c.3396C>T (p.Asn1132=) rs764013144
NM_007294.3(BRCA1):c.3396del (p.Asn1132_Leu1133insTer) rs886040125
NM_007294.3(BRCA1):c.3397_3398del (p.Leu1133fs) rs80357577
NM_007294.3(BRCA1):c.3398T>A (p.Leu1133Ter) rs80356971
NM_007294.3(BRCA1):c.3398T>G (p.Leu1133Ter) rs80356971
NM_007294.3(BRCA1):c.339C>T (p.Asn113=) rs587779367
NM_007294.3(BRCA1):c.3400G>T (p.Glu1134Ter) rs80357018
NM_007294.3(BRCA1):c.3402A>G (p.Glu1134=) rs752875919
NM_007294.3(BRCA1):c.3403C>T (p.Gln1135Ter) rs80357136
NM_007294.3(BRCA1):c.340_341TC[1] (p.Ser114_Pro115insTer) rs80357881
NM_007294.3(BRCA1):c.3412G>T (p.Gly1138Ter) rs886040126
NM_007294.3(BRCA1):c.3413del (p.Gly1138fs) rs397509063
NM_007294.3(BRCA1):c.3413dup (p.Ser1139fs) rs397509063
NM_007294.3(BRCA1):c.3416_3427delinsC (p.Ser1139fs) rs886040128
NM_007294.3(BRCA1):c.3416del (p.Ser1139fs) rs397509064
NM_007294.3(BRCA1):c.3416dup (p.Ser1139fs) rs1555587739
NM_007294.3(BRCA1):c.3417del (p.Ser1139fs) rs273899706
NM_007294.3(BRCA1):c.3418A>G (p.Ser1140Gly) rs2227945
NM_007294.3(BRCA1):c.3420dup (p.His1141fs) rs397509065
NM_007294.3(BRCA1):c.3423T>C (p.His1141=) rs863224419
NM_007294.3(BRCA1):c.3424del (p.Ala1142fs) rs1555587718
NM_007294.3(BRCA1):c.3426A>G (p.Ala1142=) rs80356843
NM_007294.3(BRCA1):c.3428delinsTA (p.Ser1143fs) rs397509066
NM_007294.3(BRCA1):c.342del (p.Pro115fs) rs886040129
NM_007294.3(BRCA1):c.3430C>T (p.Gln1144Ter) rs80357369
NM_007294.3(BRCA1):c.3432G>A (p.Gln1144=) rs80356922
NM_007294.3(BRCA1):c.3436_3439del (p.Cys1146fs) rs397509067
NM_007294.3(BRCA1):c.3442G>T (p.Glu1148Ter) rs886038012
NM_007294.3(BRCA1):c.3442del (p.Glu1148fs) rs80357808
NM_007294.3(BRCA1):c.3450del (p.Asp1151fs) rs397509068
NM_007294.3(BRCA1):c.3450dup (p.Asp1151Ter) rs397509069
NM_007294.3(BRCA1):c.3458_3462del (p.Leu1153fs) rs886038014
NM_007294.3(BRCA1):c.3459_3460del (p.Leu1154fs) rs886038013
NM_007294.3(BRCA1):c.3461T>G (p.Leu1154Ter) rs886040130
NM_007294.3(BRCA1):c.3462A>G (p.Leu1154=) rs876659048
NM_007294.3(BRCA1):c.3462dup (p.Asp1155fs) rs80357857
NM_007294.3(BRCA1):c.3463G>C (p.Asp1155His) rs80357484
NM_007294.3(BRCA1):c.3468T>C (p.Asp1156=) rs864622146
NM_007294.3(BRCA1):c.3468del (p.Asp1156fs) rs397509070
NM_007294.3(BRCA1):c.346del (p.Glu116fs) rs762635795
NM_007294.3(BRCA1):c.3472G>T (p.Glu1158Ter) rs397509072
NM_007294.3(BRCA1):c.3477_3479delinsC (p.Lys1160fs) rs273899707
NM_007294.3(BRCA1):c.3477_3480del (p.Ile1159fs) rs80357781
NM_007294.3(BRCA1):c.3478_3479del (p.Lys1160fs) rs273899707
NM_007294.3(BRCA1):c.3478_3487del (p.Lys1160fs) rs786203694
NM_007294.3(BRCA1):c.3479_3483del (p.Lys1160fs) rs886040132
NM_007294.3(BRCA1):c.3479_3488del (p.Lys1160fs) rs397509073
NM_007294.3(BRCA1):c.3479del (p.Lys1160fs) rs273899707
NM_007294.3(BRCA1):c.3481G>T (p.Glu1161Ter) rs786203438
NM_007294.3(BRCA1):c.3481_3491del (p.Glu1161fs) rs80357877
NM_007294.3(BRCA1):c.3481_3493del (p.Glu1161fs) rs1555587588
NM_007294.3(BRCA1):c.3481del (p.Glu1161fs) rs397509074
NM_007294.3(BRCA1):c.3482_3492del (p.Glu1161fs) rs886040133
NM_007294.3(BRCA1):c.3485_3488del (p.Asp1162fs) rs886040134
NM_007294.3(BRCA1):c.3485_3491del (p.Asp1162fs) rs886040135
NM_007294.3(BRCA1):c.3485del (p.Asp1162fs) rs80357509
NM_007294.3(BRCA1):c.3489_3499del (p.Ser1164fs) rs886040136
NM_007294.3(BRCA1):c.3494_3495del (p.Phe1165fs) rs397509076
NM_007294.3(BRCA1):c.3496del (p.Ala1166fs) rs886038015
NM_007294.3(BRCA1):c.3498del (p.Glu1167fs) rs886040137
NM_007294.3(BRCA1):c.34C>T (p.Gln12Ter) rs80357134
NM_007294.3(BRCA1):c.34dup (p.Gln12fs) rs1555601009
NM_007294.3(BRCA1):c.3503del (p.Asn1168fs) rs397507216
NM_007294.3(BRCA1):c.3503dup (p.Asn1168fs) rs397507216
NM_007294.3(BRCA1):c.3504_3505insA (p.Asp1169fs) rs886040138
NM_007294.3(BRCA1):c.3505_3509del (p.Asn1168_Asp1169insTer) rs397509078
NM_007294.3(BRCA1):c.3506dup (p.Asp1169fs) rs1555587573
NM_007294.3(BRCA1):c.3511A>T (p.Lys1171Ter) rs730882164
NM_007294.3(BRCA1):c.3512del (p.Lys1171fs) rs886040139
NM_007294.3(BRCA1):c.3513G>A (p.Lys1171=) rs786202844
NM_007294.3(BRCA1):c.3514G>T (p.Glu1172Ter) rs397509079
NM_007294.3(BRCA1):c.3525T>G (p.Ala1175=) rs1131692086
NM_007294.3(BRCA1):c.3526del (p.Val1176fs) rs1064794016
NM_007294.3(BRCA1):c.3531del (p.Phe1177fs) rs80357621
NM_007294.3(BRCA1):c.3531dup (p.Ser1178Ter) rs80357621
NM_007294.3(BRCA1):c.3534del (p.Ser1178fs) rs886040140
NM_007294.3(BRCA1):c.3537A>G (p.Lys1179=) rs1131692090
NM_007294.3(BRCA1):c.3540C>T (p.Ser1180=) rs928545955
NM_007294.3(BRCA1):c.3540_3541del (p.Val1181fs) rs397509080
NM_007294.3(BRCA1):c.3541_3542del (p.Val1181fs) rs886040141
NM_007294.3(BRCA1):c.3541del (p.Val1181fs) rs886038016
NM_007294.3(BRCA1):c.3544C>T (p.Gln1182Ter) rs80357296
NM_007294.3(BRCA1):c.3547_3550delinsGAT (p.Lys1183fs) rs886038017
NM_007294.3(BRCA1):c.3548A>G (p.Lys1183Arg) rs16942
NM_007294.3(BRCA1):c.3548_3549del (p.Lys1183fs) rs80357956
NM_007294.3(BRCA1):c.3549_3550del (p.Gly1184fs) rs730882057
NM_007294.3(BRCA1):c.3549_3550delinsT (p.Lys1183fs) rs273899709
NM_007294.3(BRCA1):c.3553G>T (p.Glu1185Ter) rs397509081
NM_007294.3(BRCA1):c.355A>T (p.Lys119Ter) rs886040142
NM_007294.3(BRCA1):c.3564dup (p.Ser1189fs) rs886040143
NM_007294.3(BRCA1):c.3569_3570del (p.Pro1190fs) rs80357845
NM_007294.3(BRCA1):c.3570del (p.Ser1191fs) rs886038018
NM_007294.3(BRCA1):c.3571del (p.Ser1191fs) rs886040145
NM_007294.3(BRCA1):c.3573C>T (p.Ser1191=) rs864622080
NM_007294.3(BRCA1):c.3576_3577insAA (p.Phe1193fs) rs1555587476
NM_007294.3(BRCA1):c.3578dup (p.Thr1194fs) rs397509083
NM_007294.3(BRCA1):c.357_358delinsT (p.Lys119fs) rs886040144
NM_007294.3(BRCA1):c.3580_3581insT (p.Thr1194fs) rs1555587464
NM_007294.3(BRCA1):c.3580del (p.Thr1194fs) rs80357663
NM_007294.3(BRCA1):c.3582C>T (p.Thr1194=) rs786202722
NM_007294.3(BRCA1):c.3582_3589del (p.His1195fs) rs886040146
NM_007294.3(BRCA1):c.3583_3590del (p.His1195fs) rs886040147
NM_007294.3(BRCA1):c.3583del (p.His1195fs) rs273900710
NM_007294.3(BRCA1):c.3586dupA (p.Thr1196Asnfs) rs80357531
NM_007294.3(BRCA1):c.3587dup (p.His1197fs) rs886040148
NM_007294.3(BRCA1):c.3588A>G (p.Thr1196=) rs876658595
NM_007294.3(BRCA1):c.3592_3593dup (p.Leu1198fs) rs80357562
NM_007294.3(BRCA1):c.3593T>A (p.Leu1198Ter) rs397509085
NM_007294.3(BRCA1):c.3596_3602del (p.Ala1199fs) rs397509086
NM_007294.3(BRCA1):c.3598C>T (p.Gln1200Ter) rs62625307
NM_007294.3(BRCA1):c.3599_3600del (p.Gln1200fs) rs398122674
NM_007294.3(BRCA1):c.3603T>G (p.Gly1201=) rs80356830
NM_007294.3(BRCA1):c.3604del (p.Tyr1202fs) rs886040150
NM_007294.3(BRCA1):c.3605dup (p.Tyr1202Ter) rs886040151
NM_007294.3(BRCA1):c.3607C>T (p.Arg1203Ter) rs62625308
NM_007294.3(BRCA1):c.3608G>A (p.Arg1203Gln) rs55930959
NM_007294.3(BRCA1):c.3612A>G (p.Arg1204=) rs537737635
NM_007294.3(BRCA1):c.3612del (p.Ala1206fs) rs80357980
NM_007294.3(BRCA1):c.3615G>A (p.Gly1205=) rs750113197
NM_007294.3(BRCA1):c.3616del (p.Ala1206fs) rs886038019
NM_007294.3(BRCA1):c.3619A>T (p.Lys1207Ter) rs80357455
NM_007294.3(BRCA1):c.361dup (p.Glu121fs) rs886040152
NM_007294.3(BRCA1):c.3620dup (p.Lys1208fs) rs80357926
NM_007294.3(BRCA1):c.3621_3626delinsAA (p.Leu1209fs) rs397509087
NM_007294.3(BRCA1):c.3624del (p.Lys1208fs) rs80357512
NM_007294.3(BRCA1):c.3624dup (p.Leu1209fs) rs80357512
NM_007294.3(BRCA1):c.3625_3626insA (p.Leu1209fs) rs886040153
NM_007294.3(BRCA1):c.3626T>G (p.Leu1209Ter) rs786203884
NM_007294.3(BRCA1):c.3626del (p.Lys1208_Leu1209insTer) rs80357571
NM_007294.3(BRCA1):c.3626dup (p.Leu1209fs) rs80357571
NM_007294.3(BRCA1):c.3627A>G (p.Leu1209=) rs770579978
NM_007294.3(BRCA1):c.3627_3628AG[1] (p.Glu1210fs) rs80357589
NM_007294.3(BRCA1):c.3627dupA (p.Glu1210Argfs) rs80357729
NM_007294.3(BRCA1):c.3628del (p.Glu1210fs) rs397509090
NM_007294.3(BRCA1):c.3629dup (p.Ser1211fs) rs886040154
NM_007294.3(BRCA1):c.3631_3634del (p.Ser1211fs) rs886040156
NM_007294.3(BRCA1):c.3635C>G (p.Ser1212Ter) rs886038021
NM_007294.3(BRCA1):c.3636A>G (p.Ser1212=) rs148038877
NM_007294.3(BRCA1):c.3636A>T (p.Ser1212=) rs148038877
NM_007294.3(BRCA1):c.3637G>T (p.Glu1213Ter) rs1135401864
NM_007294.3(BRCA1):c.3637del (p.Glu1213fs) rs1555587365
NM_007294.3(BRCA1):c.363_364del (p.Glu121fs) rs886040155
NM_007294.3(BRCA1):c.3640G>A (p.Glu1214Lys) rs80356923
NM_007294.3(BRCA1):c.3640G>T (p.Glu1214Ter) rs80356923
NM_007294.3(BRCA1):c.3640_3641GA[1] (p.Asn1215fs) rs80357805
NM_007294.3(BRCA1):c.3642G>A (p.Glu1214=) rs398122675
NM_007294.3(BRCA1):c.3644_3648del (p.Asn1215fs) rs1060505051
NM_007294.3(BRCA1):c.3645C>T (p.Asn1215=) rs758329415
NM_007294.3(BRCA1):c.3647T>A (p.Leu1216Ter) rs397509091
NM_007294.3(BRCA1):c.3647T>G (p.Leu1216Ter) rs397509091
NM_007294.3(BRCA1):c.3648_3652del (p.Leu1216_Ser1217insTer) rs1555587333
NM_007294.3(BRCA1):c.3648dupA (p.Ser1217Ilefs) rs80357902
NM_007294.3(BRCA1):c.3649_3650insA (p.Ser1217fs) rs80357831
NM_007294.3(BRCA1):c.3649dup (p.Ser1217fs) rs1555587345
NM_007294.3(BRCA1):c.3650_3651insA (p.Ser1217_Ser1218insTer) rs1555587337
NM_007294.3(BRCA1):c.3651dup (p.Ser1218Ter) rs886040157
NM_007294.3(BRCA1):c.3658del (p.Asp1220fs) rs786202963
NM_007294.3(BRCA1):c.3661G>T (p.Glu1221Ter) rs80357310
NM_007294.3(BRCA1):c.3663_3664AG[1] (p.Glu1222fs) rs1555587316
NM_007294.3(BRCA1):c.3664G>T (p.Glu1222Ter) rs80357356
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.3669del (p.Cys1225fs) rs886040158
NM_007294.3(BRCA1):c.366T>G (p.Val122=) rs190900046
NM_007294.3(BRCA1):c.3672del (p.Cys1225fs) rs398122677
NM_007294.3(BRCA1):c.3675C>A (p.Cys1225Ter) rs879254023
NM_007294.3(BRCA1):c.3676_3679del (p.Phe1226fs) rs80357671
NM_007294.3(BRCA1):c.3679C>T (p.Gln1227Ter) rs886040159
NM_007294.3(BRCA1):c.3683del (p.His1228fs) rs397507217
NM_007294.3(BRCA1):c.3684C>T (p.His1228=) rs786201623
NM_007294.3(BRCA1):c.3685T>C (p.Leu1229=) rs767958299
NM_007294.3(BRCA1):c.3688T>C (p.Leu1230=) rs786201581
NM_007294.3(BRCA1):c.3689T>G (p.Leu1230Ter) rs80357162
NM_007294.3(BRCA1):c.368del (p.Ser123fs) rs431825397
NM_007294.3(BRCA1):c.3693dup (p.Gly1232fs) rs397509092
NM_007294.3(BRCA1):c.3695_3698del (p.Gly1232fs) rs397509093
NM_007294.3(BRCA1):c.3695_3699GTAAA[1] (p.Val1234fs) rs80357609
NM_007294.3(BRCA1):c.3695del (p.Gly1232fs) rs886038022
NM_007294.3(BRCA1):c.3697A>T (p.Lys1233Ter) rs774679104
NM_007294.3(BRCA1):c.3699A>G (p.Lys1233=) rs368690455
NM_007294.3(BRCA1):c.369T>A (p.Ser123=) rs774583925
NM_007294.3(BRCA1):c.36A>G (p.Gln12=) rs763230080
NM_007294.3(BRCA1):c.36_39del (p.Asn13fs) rs886040149
NM_007294.3(BRCA1):c.3702A>G (p.Val1234=) rs587780862
NM_007294.3(BRCA1):c.3704_3707del (p.Asn1235fs) rs397509094
NM_007294.3(BRCA1):c.3704del (p.Asn1235fs) rs397509095
NM_007294.3(BRCA1):c.3705_3747dup (p.Glu1250delinsGlnTyrThrPheSerValTyrTer) rs797044631
NM_007294.3(BRCA1):c.3706_3707del (p.Asn1236fs) rs80357666
NM_007294.3(BRCA1):c.3706_3713del (p.Asn1236fs) rs80357552
NM_007294.3(BRCA1):c.3708_3709TA[3] (p.Pro1238fs) rs777371832
NM_007294.3(BRCA1):c.370A>G (p.Ile124Val) rs80357448
NM_007294.3(BRCA1):c.3710del (p.Ile1237fs) rs80357564
NM_007294.3(BRCA1):c.3711_3715del (p.Pro1238fs) rs1135401865
NM_007294.3(BRCA1):c.3713C>T (p.Pro1238Leu) rs28897688
NM_007294.3(BRCA1):c.3714T>C (p.Pro1238=) rs140777892
NM_007294.3(BRCA1):c.3714_3747delTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC rs886038023
NM_007294.3(BRCA1):c.3715_3717delinsC (p.Ser1239fs) rs273900714
NM_007294.3(BRCA1):c.3715del (p.Ser1239fs) rs397509096
NM_007294.3(BRCA1):c.3716dup (p.Gln1240fs) rs397509097
NM_007294.3(BRCA1):c.3717T>A (p.Ser1239=) rs730881453
NM_007294.3(BRCA1):c.3718C>T (p.Gln1240Ter) rs80356903
NM_007294.3(BRCA1):c.3720G>A (p.Gln1240=) rs876658341
NM_007294.3(BRCA1):c.3722_3740del (p.Ser1241fs) rs80359882
NM_007294.3(BRCA1):c.3723T>C (p.Ser1241=) rs772759939
NM_007294.3(BRCA1):c.372C>A (p.Ile124=) rs273900715
NM_007294.3(BRCA1):c.372del (p.Ile125fs) rs886040160
NM_007294.3(BRCA1):c.3730_3731insGACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGG (p.His1244fs) rs1555587210
NM_007294.3(BRCA1):c.3731_3738del (p.His1244fs) rs886040161
NM_007294.3(BRCA1):c.3731_3743del (p.His1244fs) rs886040162
NM_007294.3(BRCA1):c.3736del (p.Thr1246fs) rs80357578
NM_007294.3(BRCA1):c.3738C>T (p.Thr1246=) rs778655093
NM_007294.3(BRCA1):c.3739G>A (p.Val1247Ile) rs80357191
NM_007294.3(BRCA1):c.3747C>T (p.Thr1249=) rs587780801
NM_007294.3(BRCA1):c.3748G>A (p.Glu1250Lys) rs28897686
NM_007294.3(BRCA1):c.3748G>T (p.Glu1250Ter) rs28897686
NM_007294.3(BRCA1):c.3748_3749insC (p.Glu1250fs) rs1555587165
NM_007294.3(BRCA1):c.3750G>A (p.Glu1250=) rs145903082
NM_007294.3(BRCA1):c.3750del (p.Glu1250fs) rs886040163
NM_007294.3(BRCA1):c.3752_3755GTCT[1] (p.Ser1253fs) rs80357868
NM_007294.3(BRCA1):c.3753T>A (p.Cys1251Ter) rs397509098
NM_007294.3(BRCA1):c.3754_3755del (p.Leu1252fs) rs1135401866
NM_007294.3(BRCA1):c.3756G>C (p.Leu1252=) rs752122039
NM_007294.3(BRCA1):c.3756_3757del (p.Leu1252_Ser1253insTer) rs397509099
NM_007294.3(BRCA1):c.3756_3760del (p.Ser1253fs) rs886040164
NM_007294.3(BRCA1):c.3758_3759del (p.Leu1252_Ser1253insTer) rs1555587135
NM_007294.3(BRCA1):c.3759T>G (p.Ser1253=) rs80356852
NM_007294.3(BRCA1):c.3759_3760del (p.Lys1254fs) rs80357520
NM_007294.3(BRCA1):c.3759del (p.Lys1254fs) rs431825398
NM_007294.3(BRCA1):c.3759dupT (p.Lys1254Terfs) rs80357687
NM_007294.3(BRCA1):c.375_376insT (p.Gln126fs) rs397509101
NM_007294.3(BRCA1):c.3760_3761insT (p.Lys1254fs) rs80357986
NM_007294.3(BRCA1):c.3761_3762insT (p.Lys1254fs) rs80357928
NM_007294.3(BRCA1):c.3761_3762insTT (p.Lys1254fs) rs80357928
NM_007294.3(BRCA1):c.3762_3763del (p.Asn1255fs) rs80357645
NM_007294.3(BRCA1):c.3762_3763insTT (p.Asn1255fs) rs1555587113
NM_007294.3(BRCA1):c.3763_3764del (p.Asn1255fs) rs397509103
NM_007294.3(BRCA1):c.3764dupA (p.Asn1255Lysfs) rs80357848
NM_007294.3(BRCA1):c.3765_3766CA[1] (p.Thr1256fs) rs730881440
NM_007294.3(BRCA1):c.3765del (p.Asn1255fs) rs886040165
NM_007294.3(BRCA1):c.3766dup (p.Thr1256fs) rs80357704
NM_007294.3(BRCA1):c.3768A>G (p.Thr1256=) rs786202803
NM_007294.3(BRCA1):c.3768_3769AG[1] (p.Glu1257fs) rs80357579
NM_007294.3(BRCA1):c.376C>T (p.Gln126Ter) rs1085307902
NM_007294.3(BRCA1):c.376_377insT (p.Gln126fs) rs1555596382
NM_007294.3(BRCA1):c.3770_3777del (p.Glu1257fs) rs886038024
NM_007294.3(BRCA1):c.3771_3772del (p.Asn1259fs) rs80357810
NM_007294.3(BRCA1):c.3771_3772delinsC (p.Glu1257fs) rs397507218
NM_007294.3(BRCA1):c.3771_3778del (p.Glu1257fs) rs397509104
NM_007294.3(BRCA1):c.3772G>T (p.Glu1258Ter) rs397509105
NM_007294.3(BRCA1):c.3772_3773GA[1] (p.Asn1259fs) rs397509106
NM_007294.3(BRCA1):c.3772_3776del (p.Glu1258fs) rs1135401867
NM_007294.3(BRCA1):c.3774G>A (p.Glu1258=) rs431825399
NM_007294.3(BRCA1):c.3778_3779insA (p.Leu1260fs) rs80357849
NM_007294.3(BRCA1):c.3779T>G (p.Leu1260Ter) rs886038025
NM_007294.3(BRCA1):c.3779del (p.Leu1260fs) rs80357798
NM_007294.3(BRCA1):c.3780A>G (p.Leu1260=) rs753081589
NM_007294.3(BRCA1):c.3780dup (p.Leu1261fs) rs1555587063
NM_007294.3(BRCA1):c.3782T>G (p.Leu1261Ter) rs397507219
NM_007294.3(BRCA1):c.3782del (p.Leu1261fs) rs80357545
NM_007294.3(BRCA1):c.3783A>G (p.Leu1261=) rs80356831
NM_007294.3(BRCA1):c.3785C>A (p.Ser1262Ter) rs80357269
NM_007294.3(BRCA1):c.378A>G (p.Gln126=) rs786201256
NM_007294.3(BRCA1):c.3794del (p.Asn1265fs) rs80357767
NM_007294.3(BRCA1):c.3797G>C (p.Ser1266Thr) rs80357160
NM_007294.3(BRCA1):c.3798C>T (p.Ser1266=) rs200648498
NM_007294.3(BRCA1):c.37_40del (p.Asn13fs) rs80357530
NM_007294.3(BRCA1):c.3800T>G (p.Leu1267Ter) rs587782190
NM_007294.3(BRCA1):c.3804T>C (p.Asn1268=) rs140588714
NM_007294.3(BRCA1):c.3810C>A (p.Cys1270Ter) rs886040166
NM_007294.3(BRCA1):c.3813dup (p.Asn1272Ter) rs397509108
NM_007294.3(BRCA1):c.3814_3815insT (p.Asn1272fs) rs397509109
NM_007294.3(BRCA1):c.3815_3816insT (p.Gln1273fs) rs1555587013
NM_007294.3(BRCA1):c.3817C>T (p.Gln1273Ter) rs80357208
NM_007294.3(BRCA1):c.3819_3823del (p.Gln1273fs) rs886037785
NM_007294.3(BRCA1):c.3820del (p.Gln1273_Val1274insTer) rs80357616
NM_007294.3(BRCA1):c.3820dupG (p.Val1274Glyfs) rs80357616
NM_007294.3(BRCA1):c.3821dup (p.Ile1275fs) rs886040167
NM_007294.3(BRCA1):c.3822A>C (p.Val1274=) rs372396487
NM_007294.3(BRCA1):c.3824dup (p.Leu1276fs) rs1555586989
NM_007294.3(BRCA1):c.3825dup (p.Leu1276fs) rs397507220
NM_007294.3(BRCA1):c.3826T>C (p.Leu1276=) rs876659178
NM_007294.3(BRCA1):c.3830dup (p.Ala1279fs) rs80357878
NM_007294.3(BRCA1):c.3833del (p.Lys1278fs) rs1135401868
NM_007294.3(BRCA1):c.3834G>A (p.Lys1278=) rs876660942
NM_007294.3(BRCA1):c.3835del (p.Ala1279fs) rs1060505047
NM_007294.3(BRCA1):c.3837_3840del (p.Ser1280fs) rs886040168
NM_007294.3(BRCA1):c.3839_3843del (p.Ala1279_Ser1280insTer) rs886040169
NM_007294.3(BRCA1):c.3839_3843delinsAGGC (p.Ser1280_Gln1281delinsTer) rs273900717
NM_007294.3(BRCA1):c.3840_3850del (p.Gln1281fs) rs886040170
NM_007294.3(BRCA1):c.3841C>T (p.Gln1281Ter) rs80356866
NM_007294.3(BRCA1):c.3841_3842del (p.Gln1281fs) rs80357584
NM_007294.3(BRCA1):c.3844del (p.Glu1282fs) rs397509113
NM_007294.3(BRCA1):c.3851_3852dup (p.Leu1285fs) rs397507221
NM_007294.3(BRCA1):c.3852C>T (p.His1284=) rs776070899
NM_007294.3(BRCA1):c.3853del (p.Ser1286fs) rs397507222
NM_007294.3(BRCA1):c.3856del (p.Ser1286fs) rs80357855
NM_007294.3(BRCA1):c.3858T>C (p.Ser1286=) rs794726998
NM_007294.3(BRCA1):c.3858_3861del (p.Ser1286fs) rs80357842
NM_007294.3(BRCA1):c.385_386delinsC (p.Gly129fs) rs886040171
NM_007294.3(BRCA1):c.3862G>T (p.Glu1288Ter) rs876659708
NM_007294.3(BRCA1):c.3862del (p.Glu1288fs) rs273900718
NM_007294.3(BRCA1):c.3867_3871del (p.Lys1290fs) rs80357560
NM_007294.3(BRCA1):c.3868A>T (p.Lys1290Ter) rs80357254
NM_007294.3(BRCA1):c.3869_3870del (p.Lys1290fs) rs80357918
NM_007294.3(BRCA1):c.386del (p.Gly129fs) rs1135401836
NM_007294.3(BRCA1):c.3871_3872insC (p.Cys1291fs) rs397509114
NM_007294.3(BRCA1):c.3872_3873insC (p.Ser1292fs) rs1555586891
NM_007294.3(BRCA1):c.3874del (p.Ser1292fs) rs587780802
NM_007294.3(BRCA1):c.3876del (p.Ala1293fs) rs397509115
NM_007294.3(BRCA1):c.3880_3883del (p.Ser1294fs) rs397509116
NM_007294.3(BRCA1):c.3885del (p.Leu1295fs) rs886040172
NM_007294.3(BRCA1):c.3889del (p.Ser1297fs) rs886038027
NM_007294.3(BRCA1):c.3893C>A (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3893C>G (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3895C>T (p.Gln1299Ter) rs80357038
NM_007294.3(BRCA1):c.3900C>T (p.Cys1300=) rs730881454
NM_007294.3(BRCA1):c.3901_3902del (p.Cys1300_Ser1301insTer) rs80357646
NM_007294.3(BRCA1):c.3904G>T (p.Glu1302Ter) rs80357461
NM_007294.3(BRCA1):c.3907_3908delinsGGA (p.Leu1303fs) rs80357634
NM_007294.3(BRCA1):c.3908_3909dup (p.Glu1304fs) rs886040174
NM_007294.3(BRCA1):c.3908dup (p.Leu1303fs) rs80357634
NM_007294.3(BRCA1):c.390C>A (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.390C>G (p.Tyr130Ter) rs80356888
NM_007294.3(BRCA1):c.390C>T (p.Tyr130=) rs80356888
NM_007294.3(BRCA1):c.3910G>T (p.Glu1304Ter) rs886038028
NM_007294.3(BRCA1):c.3910del (p.Glu1304fs) rs397509117
NM_007294.3(BRCA1):c.3914del (p.Asp1305fs) rs397509118
NM_007294.3(BRCA1):c.3916_3917del (p.Leu1306fs) rs80357678
NM_007294.3(BRCA1):c.3917del (p.Asp1305_Leu1306insTer) rs886040175
NM_007294.3(BRCA1):c.3918G>A (p.Leu1306=) rs786202068
NM_007294.3(BRCA1):c.391A>T (p.Arg131Ter) rs80357207
NM_007294.3(BRCA1):c.3926del (p.Asn1309fs) rs397509119
NM_007294.3(BRCA1):c.3927_3930del (p.Asn1309fs) rs397509120
NM_007294.3(BRCA1):c.3928dup (p.Thr1310fs) rs886040176
NM_007294.3(BRCA1):c.3931_3934del (p.Asn1311fs) rs80357864
NM_007294.3(BRCA1):c.3931_3934dup (p.Thr1312fs) rs80357864
NM_007294.3(BRCA1):c.3932del (p.Asn1311fs) rs80357504
NM_007294.3(BRCA1):c.3936C>T (p.Thr1312=) rs753210219
NM_007294.3(BRCA1):c.3937C>T (p.Gln1313Ter) rs80357318
NM_007294.3(BRCA1):c.3947_3950del (p.Pro1315_Phe1316insTer) rs886040177
NM_007294.3(BRCA1):c.3952_3955del (p.Ile1318fs) rs886040178
NM_007294.3(BRCA1):c.3954del (p.Ile1318fs) rs1135401870
NM_007294.3(BRCA1):c.3956_3957del (p.Gly1319fs) rs1135401871
NM_007294.3(BRCA1):c.3959del (p.Ser1320fs) rs886040179
NM_007294.3(BRCA1):c.3961del (p.Ser1321fs) rs886040180
NM_007294.3(BRCA1):c.3964A>T (p.Lys1322Ter) rs80357343
NM_007294.3(BRCA1):c.3966del (p.Lys1322fs) rs80357979
NM_007294.3(BRCA1):c.3967C>T (p.Gln1323Ter) rs80357262
NM_007294.3(BRCA1):c.3967del (p.Gln1323fs) rs397509122
NM_007294.3(BRCA1):c.3968_3971del (p.Gln1323fs) rs886040181
NM_007294.3(BRCA1):c.3969_3970del (p.Gln1323fs) rs587782834
NM_007294.3(BRCA1):c.396C>A (p.Asn132Lys) rs80357413
NM_007294.3(BRCA1):c.3972_3974delinsAA (p.Met1324fs) rs886040182
NM_007294.3(BRCA1):c.3972del (p.Met1324fs) rs80357987
NM_007294.3(BRCA1):c.3973del (p.Arg1325fs) rs80357904
NM_007294.3(BRCA1):c.3975G>A (p.Arg1325=) rs761424661
NM_007294.3(BRCA1):c.3979C>T (p.Gln1327Ter) rs876659720
NM_007294.3(BRCA1):c.397del (p.Arg133fs) rs886037973
NM_007294.3(BRCA1):c.3981del (p.Gln1327fs) rs397509123
NM_007294.3(BRCA1):c.3982dup (p.Ser1328fs) rs397509124
NM_007294.3(BRCA1):c.3985_3987delinsTTTC (p.Glu1329fs) rs886040183
NM_007294.3(BRCA1):c.3990C>T (p.Ser1330=) rs876660808
NM_007294.3(BRCA1):c.3990_3993del (p.Ser1330fs) rs886040184
NM_007294.3(BRCA1):c.3991C>T (p.Gln1331Ter) rs397507224
NM_007294.3(BRCA1):c.3993G>A (p.Gln1331=) rs70953658
NM_007294.3(BRCA1):c.3995_4001del (p.Gly1332fs) rs886040185
NM_007294.3(BRCA1):c.3999_4008del (p.Gly1334fs) rs754792932
NM_007294.3(BRCA1):c.3999del (p.Gly1334fs) rs397509125
NM_007294.3(BRCA1):c.399_400del (p.Ala134fs) rs80357568
NM_007294.3(BRCA1):c.4001del (p.Gly1334fs) rs397509127
NM_007294.3(BRCA1):c.4002T>C (p.Gly1334=) rs1131692083
NM_007294.3(BRCA1):c.4002_4005del (p.Leu1335fs) rs397509128
NM_007294.3(BRCA1):c.4013del (p.Lys1338fs) rs886038029
NM_007294.3(BRCA1):c.4015G>T (p.Glu1339Ter) rs80357021
NM_007294.3(BRCA1):c.4015dup (p.Glu1339fs) rs886038030
NM_007294.3(BRCA1):c.4016_4017insTT (p.Glu1339fs) rs886040187
NM_007294.3(BRCA1):c.4018T>C (p.Leu1340=) rs786201646
NM_007294.3(BRCA1):c.4018_4019dup (p.Leu1340fs) rs1555586639
NM_007294.3(BRCA1):c.4026A>C (p.Ser1342=) rs80356828
NM_007294.3(BRCA1):c.4026A>G (p.Ser1342=) rs80356828
NM_007294.3(BRCA1):c.4033G>T (p.Glu1345Ter) rs886040188
NM_007294.3(BRCA1):c.4034_4037AAGA[1] (p.Arg1347fs) rs431825404
NM_007294.3(BRCA1):c.4035del (p.Glu1346fs) rs80357711
NM_007294.3(BRCA1):c.4036del (p.Glu1346fs) rs886040189
NM_007294.3(BRCA1):c.4038_4039del (p.Gly1348fs) rs273900721
NM_007294.3(BRCA1):c.4039A>G (p.Arg1347Gly) rs28897689
NM_007294.3(BRCA1):c.4039_4040AG[1] (p.Gly1348fs) rs80357727
NM_007294.3(BRCA1):c.4039dup (p.Arg1347fs) rs273900721
NM_007294.3(BRCA1):c.403A>T (p.Lys135Ter) rs879255485
NM_007294.3(BRCA1):c.4042G>T (p.Gly1348Ter) rs886040191
NM_007294.3(BRCA1):c.4043del (p.Gly1348fs) rs397509130
NM_007294.3(BRCA1):c.4046C>T (p.Thr1349Met) rs80357345
NM_007294.3(BRCA1):c.4047G>A (p.Thr1349=) rs758515222
NM_007294.3(BRCA1):c.4049dup (p.Glu1352fs) rs397509131
NM_007294.3(BRCA1):c.4050C>T (p.Gly1350=) rs779507799
NM_007294.3(BRCA1):c.4050_4051insG (p.Leu1351fs) rs483353092
NM_007294.3(BRCA1):c.4051T>C (p.Leu1351=) rs139858874
NM_007294.3(BRCA1):c.4051_4052insG (p.Leu1351fs) rs1555586564
NM_007294.3(BRCA1):c.4052T>A (p.Leu1351Ter) rs397509132
NM_007294.3(BRCA1):c.4052dupT (p.Leu1351Phefs) rs80357779
NM_007294.3(BRCA1):c.4054G>T (p.Glu1352Ter) rs80357202
NM_007294.3(BRCA1):c.4057G>T (p.Glu1353Ter) rs80357178
NM_007294.3(BRCA1):c.4057_4061del (p.Glu1352_Glu1353insTer) rs397509133
NM_007294.3(BRCA1):c.4062_4065del (p.Asn1355fs) rs398122679
NM_007294.3(BRCA1):c.4062_4066del (p.Asn1354fs) rs886040192
NM_007294.3(BRCA1):c.4062_4068del (p.Asn1354fs) rs397509134
NM_007294.3(BRCA1):c.4064_4066delinsT (p.Asn1355fs) rs1060502345
NM_007294.3(BRCA1):c.4065_4068del (p.Asn1355fs) rs80357508
NM_007294.3(BRCA1):c.4066C>T (p.Gln1356Ter) rs886040193
NM_007294.3(BRCA1):c.4066_4069del (p.Gln1356fs) rs397509135
NM_007294.3(BRCA1):c.4066del (p.Gln1356fs) rs886040194
NM_007294.3(BRCA1):c.4069G>T (p.Glu1357Ter) rs886040195
NM_007294.3(BRCA1):c.406del (p.Arg136fs) rs80357709
NM_007294.3(BRCA1):c.406dupA (p.Arg136Lysfs) rs80357709
NM_007294.3(BRCA1):c.4070_4071insTTGA (p.Glu1357delinsAspTer) rs1555586517
NM_007294.3(BRCA1):c.4071A>G (p.Glu1357=) rs786201475
NM_007294.3(BRCA1):c.4071del (p.Glu1358fs) rs886040197
NM_007294.3(BRCA1):c.4072G>T (p.Glu1358Ter) rs397509136
NM_007294.3(BRCA1):c.4074G>A (p.Glu1358=) rs80356846
NM_007294.3(BRCA1):c.4074_4090del (p.Gln1359fs) rs886040198
NM_007294.3(BRCA1):c.4075C>T (p.Gln1359Ter) rs80357456
NM_007294.3(BRCA1):c.4079del (p.Ser1360fs) rs886040199
NM_007294.3(BRCA1):c.407del (p.Arg136fs) rs886040200
NM_007294.3(BRCA1):c.4081A>C (p.Met1361Leu) rs80357218
NM_007294.3(BRCA1):c.4085del (p.Asp1362fs) rs80357737
NM_007294.3(BRCA1):c.4088C>A (p.Ser1363Ter) rs398122680
NM_007294.3(BRCA1):c.4088C>G (p.Ser1363Ter) rs398122680
NM_007294.3(BRCA1):c.4092C>T (p.Asn1364=) rs786201566
NM_007294.3(BRCA1):c.4092_4093del (p.Leu1365fs) rs397509137
NM_007294.3(BRCA1):c.4094T>G (p.Leu1365Ter) rs398122681
NM_007294.3(BRCA1):c.4094del (p.Asn1364_Leu1365insTer) rs397509138
NM_007294.3(BRCA1):c.4096+1G>A rs80358178
NM_007294.3(BRCA1):c.4096+3A>G rs80358015
NM_007294.3(BRCA1):c.4097-11T>C rs80358072
NM_007294.3(BRCA1):c.4097-141A>C rs799916
NM_007294.3(BRCA1):c.4097-1G>A rs80358070
NM_007294.3(BRCA1):c.4099G>T (p.Glu1367Ter) rs786202998
NM_007294.3(BRCA1):c.40_41del (p.Val14fs) rs886040186
NM_007294.3(BRCA1):c.40del (p.Val14fs) rs886040201
NM_007294.3(BRCA1):c.4107_4108insATCT (p.Ser1370fs) rs886040202
NM_007294.3(BRCA1):c.4107_4110dup (p.Gly1371fs) rs397509139
NM_007294.3(BRCA1):c.4108_4109insATCT (p.Ser1370fs) rs1555586260
NM_007294.3(BRCA1):c.4110T>C (p.Ser1370=) rs1131692067
NM_007294.3(BRCA1):c.4110_4111del (p.Gly1371fs) rs80357529
NM_007294.3(BRCA1):c.4111_4112insATCT (p.Gly1371fs) rs80357935
NM_007294.3(BRCA1):c.4112_4113insATCT (p.Cys1372fs) rs1555586240
NM_007294.3(BRCA1):c.4113G>A (p.Gly1371=) rs147448807
NM_007294.3(BRCA1):c.4113del (p.Cys1372fs) rs80357861
NM_007294.3(BRCA1):c.4114_4115TG[1] (p.Cys1372_Glu1373delinsTer) rs80357804
NM_007294.3(BRCA1):c.4116T>A (p.Cys1372Ter) rs397509140
NM_007294.3(BRCA1):c.4116del (p.Cys1372fs) rs886040204
NM_007294.3(BRCA1):c.4117G>T (p.Glu1373Ter) rs80357259
NM_007294.3(BRCA1):c.4117_4118insTT (p.Glu1373fs) rs1555586212
NM_007294.3(BRCA1):c.4118_4119AG[1] (p.Glu1373_Ser1374insTer) rs80357787
NM_007294.3(BRCA1):c.411_414del (p.Leu138fs) rs886040203
NM_007294.3(BRCA1):c.411del (p.Leu138fs) rs886040205
NM_007294.3(BRCA1):c.411dup (p.Leu138fs) rs886040205
NM_007294.3(BRCA1):c.4122_4123del (p.Ser1374fs) rs80357691
NM_007294.3(BRCA1):c.4123G>T (p.Glu1375Ter) rs80357397
NM_007294.3(BRCA1):c.4126_4129del (p.Thr1376fs) rs886040206
NM_007294.3(BRCA1):c.4127del (p.Thr1376fs) rs886040207
NM_007294.3(BRCA1):c.4128_4129del (p.Ser1377fs) rs80357921
NM_007294.3(BRCA1):c.4129del (p.Ser1377fs) rs886040208
NM_007294.3(BRCA1):c.412_418del (p.Leu138fs) rs80357816
NM_007294.3(BRCA1):c.4131C>T (p.Ser1377=) rs80356871
NM_007294.3(BRCA1):c.4134_4135CT[1] (p.Val1378_Ser1379insTer) rs397509141
NM_007294.3(BRCA1):c.4137_4138del (p.Glu1380fs) rs886040209
NM_007294.3(BRCA1):c.4137del (p.Glu1380fs) rs1064793746
NM_007294.3(BRCA1):c.4139_4140del (p.Glu1380fs) rs886038032
NM_007294.3(BRCA1):c.4146C>A (p.Cys1382Ter) rs1057517574
NM_007294.3(BRCA1):c.4146_4155dup (p.Ser1386fs) rs483353079
NM_007294.3(BRCA1):c.4148C>G (p.Ser1383Ter) rs80357071
NM_007294.3(BRCA1):c.4158_4162del (p.Ser1387fs) rs397509142
NM_007294.3(BRCA1):c.4159_4160TC[1] (p.Gln1388fs) rs80357565
NM_007294.3(BRCA1):c.415C>T (p.Gln139Ter) rs80357372
NM_007294.3(BRCA1):c.4162C>T (p.Gln1388Ter) rs876660601
NM_007294.3(BRCA1):c.4162_4163del (p.Gln1388fs) rs886040210
NM_007294.3(BRCA1):c.4163_4164AG[1] (p.Gln1388_Ser1389insTer) rs80357572
NM_007294.3(BRCA1):c.4163_4164AG[3] (p.Ser1389fs) rs80357572
NM_007294.3(BRCA1):c.4163_4166del (p.Gln1388fs) rs80357532
NM_007294.3(BRCA1):c.4163dup (p.Ser1389fs) rs80357788
NM_007294.3(BRCA1):c.4167_4168del (p.Ser1389fs) rs397509144
NM_007294.3(BRCA1):c.4167_4168insAG (p.Asp1390fs) rs80357847
NM_007294.3(BRCA1):c.4167_4170del (p.Ser1389fs) rs80357538
NM_007294.3(BRCA1):c.4167del (p.Ser1389fs) rs397509145
NM_007294.3(BRCA1):c.4168_4169del (p.Asp1390fs) rs1555586103
NM_007294.3(BRCA1):c.4168_4169dup (p.Asp1390fs) rs1555586100
NM_007294.3(BRCA1):c.416dup (p.Ser140fs) rs786203432
NM_007294.3(BRCA1):c.4175del (p.Ile1391_Leu1392insTer) rs886040211
NM_007294.3(BRCA1):c.4179C>G (p.Thr1393=) rs753735698
NM_007294.3(BRCA1):c.4179C>T (p.Thr1393=) rs753735698
NM_007294.3(BRCA1):c.4182T>C (p.Thr1394=) rs864622540
NM_007294.3(BRCA1):c.4182_4183dup (p.Gln1395fs) rs80357742
NM_007294.3(BRCA1):c.4183C>T (p.Gln1395Ter) rs80357260
NM_007294.3(BRCA1):c.4185+112C>A rs2070833
NM_007294.3(BRCA1):c.4185+1392_4185+1393insG rs34293035
NM_007294.3(BRCA1):c.4185+1393_4185+1394insGA rs201979969
NM_007294.3(BRCA1):c.4185+1458A>G rs8176160
NM_007294.3(BRCA1):c.4185+1571G>T rs8176161
NM_007294.3(BRCA1):c.4185+1787T>G rs8176162
NM_007294.3(BRCA1):c.4185+201_4185+206dup rs138544133
NM_007294.3(BRCA1):c.4185+2046T>C rs8176163
NM_007294.3(BRCA1):c.4185+2211C>T rs8176165
NM_007294.3(BRCA1):c.4185+2361G>A rs147509580
NM_007294.3(BRCA1):c.4185+2684A>G rs8176166
NM_007294.3(BRCA1):c.4185+2981A>G rs8176167
NM_007294.3(BRCA1):c.4185+3033A>G rs79996471
NM_007294.3(BRCA1):c.4185+3045del rs144110800
NM_007294.3(BRCA1):c.4185+3333T>C rs8176168
NM_007294.3(BRCA1):c.4185+3334G>A rs8176169
NM_007294.3(BRCA1):c.4185+3470A>G rs8176170
NM_007294.3(BRCA1):c.4185+3489C>T rs8176171
NM_007294.3(BRCA1):c.4185+355C>T rs148953585
NM_007294.3(BRCA1):c.4185+563A>G rs8176155
NM_007294.3(BRCA1):c.4185+676A>C rs2070834
NM_007294.3(BRCA1):c.4185+879del rs77684117
NM_007294.3(BRCA1):c.4185+880del rs200098203
NM_007294.3(BRCA1):c.4185+883_4185+885del rs200781379
NM_007294.3(BRCA1):c.4186-1207C>T rs8067269
NM_007294.3(BRCA1):c.4186-1247A>T rs8176182
NM_007294.3(BRCA1):c.4186-1451C>T rs8176181
NM_007294.3(BRCA1):c.4186-1457del rs571319167
NM_007294.3(BRCA1):c.4186-2050A>G rs8176178
NM_007294.3(BRCA1):c.4186-2187C>T rs562679568
NM_007294.3(BRCA1):c.4186-2483A>G rs8176177
NM_007294.3(BRCA1):c.4186-2852T>C rs8176176
NM_007294.3(BRCA1):c.4186-3102_4186-3101insT rs8176175
NM_007294.3(BRCA1):c.4186-3361C>T rs3950989
NM_007294.3(BRCA1):c.4186-3420A>T rs8176174
NM_007294.3(BRCA1):c.4186-3540_4186-3535dup rs376686434
NM_007294.3(BRCA1):c.4186-3910T>C rs151196052
NM_007294.3(BRCA1):c.4186-4027G>A rs8176173
NM_007294.3(BRCA1):c.4186-514T>C rs75754723
NM_007294.3(BRCA1):c.4186-591_4186-588dup rs527906133
NM_007294.3(BRCA1):c.4186C>T (p.Gln1396Ter) rs80357011
NM_007294.3(BRCA1):c.418dup (p.Ser140fs) rs886040212
NM_007294.3(BRCA1):c.4193_4194insGG (p.Asp1398fs) rs886038033
NM_007294.3(BRCA1):c.4194_4195insGG (p.Thr1399fs) rs1555584262
NM_007294.3(BRCA1):c.4195_4196del (p.Thr1399fs) rs80357649
NM_007294.3(BRCA1):c.4197C>G (p.Thr1399=) rs876659552
NM_007294.3(BRCA1):c.4197del (p.Met1400fs) rs886040213
NM_007294.3(BRCA1):c.4201C>T (p.Gln1401Ter) rs397509151
NM_007294.3(BRCA1):c.4204C>T (p.His1402Tyr) rs80357365
NM_007294.3(BRCA1):c.4205del (p.His1402fs) rs886040214
NM_007294.3(BRCA1):c.4206_4207del (p.His1402fs) rs886040215
NM_007294.3(BRCA1):c.4209C>T (p.Asn1403=) rs786201224
NM_007294.3(BRCA1):c.420T>C (p.Ser140=) rs730881448
NM_007294.3(BRCA1):c.4210del (p.Asn1403_Leu1404insTer) rs80357765
NM_007294.3(BRCA1):c.4214del (p.Ile1405fs) rs273900728
NM_007294.3(BRCA1):c.4216A>T (p.Lys1406Ter) rs886040216
NM_007294.3(BRCA1):c.4218G>A (p.Lys1406=) rs1800707
NM_007294.3(BRCA1):c.4218del (p.Lys1406fs) rs886040217
NM_007294.3(BRCA1):c.4222C>T (p.Gln1408Ter) rs80356989
NM_007294.3(BRCA1):c.4225C>T (p.Gln1409Ter) rs886040218
NM_007294.3(BRCA1):c.4227G>A (p.Gln1409=) rs786201618
NM_007294.3(BRCA1):c.4228G>T (p.Glu1410Ter) rs397509152
NM_007294.3(BRCA1):c.4237G>T (p.Glu1413Ter) rs397509153
NM_007294.3(BRCA1):c.4239del (p.Glu1413fs) rs886040219
NM_007294.3(BRCA1):c.4240dup (p.Leu1414fs) rs397509154
NM_007294.3(BRCA1):c.4242A>G (p.Leu1414=) rs1057521982
NM_007294.3(BRCA1):c.4243G>T (p.Glu1415Ter) rs1057519558
NM_007294.3(BRCA1):c.4243_4244insT (p.Glu1415fs) rs1555584178
NM_007294.3(BRCA1):c.4243del (p.Glu1415fs) rs80357981
NM_007294.3(BRCA1):c.4245A>G (p.Glu1415=) rs41293453
NM_007294.3(BRCA1):c.4249_4250GT[1] (p.Leu1418fs) rs80357977
NM_007294.3(BRCA1):c.4250del (p.Val1417fs) rs587782879
NM_007294.3(BRCA1):c.4251G>A (p.Val1417=) rs777057839
NM_007294.3(BRCA1):c.4253T>G (p.Leu1418Ter) rs397509157
NM_007294.3(BRCA1):c.4255G>C (p.Glu1419Gln) rs80357309
NM_007294.3(BRCA1):c.4255G>T (p.Glu1419Ter) rs80357309
NM_007294.3(BRCA1):c.4258C>T (p.Gln1420Ter) rs80357305
NM_007294.3(BRCA1):c.425C>A (p.Pro142His) rs55971303
NM_007294.3(BRCA1):c.4263T>C (p.His1421=) rs1131692074
NM_007294.3(BRCA1):c.4266del (p.Ser1423fs) rs397509158
NM_007294.3(BRCA1):c.4266dup (p.Ser1423fs) rs397509158
NM_007294.3(BRCA1):c.4269C>T (p.Ser1423=) rs786202278
NM_007294.3(BRCA1):c.426C>T (p.Pro142=) rs542687218
NM_007294.3(BRCA1):c.4270C>T (p.Gln1424Ter) rs886040220
NM_007294.3(BRCA1):c.4272G>A (p.Gln1424=) rs398122684
NM_007294.3(BRCA1):c.427G>A (p.Glu143Lys) rs80356991
NM_007294.3(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.3(BRCA1):c.4282_4283del (p.Ser1428fs) rs397509159
NM_007294.3(BRCA1):c.4284_4285delinsG (p.Ser1428fs) rs886040221
NM_007294.3(BRCA1):c.4284_4285insG (p.Tyr1429fs) rs1555584122
NM_007294.3(BRCA1):c.4285_4286insG (p.Tyr1429Ter) rs80357716
NM_007294.3(BRCA1):c.4285dup (p.Tyr1429fs) rs1555584118
NM_007294.3(BRCA1):c.4286_4287insG (p.Tyr1429Ter) rs1555584110
NM_007294.3(BRCA1):c.4287C>A (p.Tyr1429Ter) rs397509160
NM_007294.3(BRCA1):c.4289dup (p.Ser1431fs) rs80357556
NM_007294.3(BRCA1):c.4290_4296del (p.Pro1430_Ser1431insTer) rs886040222
NM_007294.3(BRCA1):c.42C>A (p.Val14=) rs80356827
NM_007294.3(BRCA1):c.42C>T (p.Val14=) rs80356827
NM_007294.3(BRCA1):c.4300dupA (p.Ser1434Lysfs) rs80357790
NM_007294.3(BRCA1):c.4305C>T (p.Asp1435=) rs730881445
NM_007294.3(BRCA1):c.4305_4306CT[1] (p.Ser1436fs) rs397509161
NM_007294.3(BRCA1):c.4308T>C (p.Ser1436=) rs1060915
NM_007294.3(BRCA1):c.4309del (p.Ser1437fs) rs886040223
NM_007294.3(BRCA1):c.4310del (p.Ser1437fs) rs1135401874
NM_007294.3(BRCA1):c.4311T>C (p.Ser1437=) rs1131692092
NM_007294.3(BRCA1):c.4314C>G (p.Ala1438=) rs80356856
NM_007294.3(BRCA1):c.431del (p.Asn144fs) rs397509162
NM_007294.3(BRCA1):c.431dup (p.Asn144fs) rs397509162
NM_007294.3(BRCA1):c.4321dupG (p.Asp1441Glyfs) rs80357748
NM_007294.3(BRCA1):c.4327C>T (p.Arg1443Ter) rs41293455
NM_007294.3(BRCA1):c.4331_4332del (p.Asn1444fs) rs397509163
NM_007294.3(BRCA1):c.4331_4338del (p.Asn1444fs) rs80357825
NM_007294.3(BRCA1):c.4332T>C (p.Asn1444=) rs752824502
NM_007294.3(BRCA1):c.4335_4338dup (p.Gln1447fs) rs397509164
NM_007294.3(BRCA1):c.4339C>T (p.Gln1447Ter) rs80357067
NM_007294.3(BRCA1):c.433_436CCTT[1] (p.Ser146fs) rs397509168
NM_007294.3(BRCA1):c.4342dup (p.Ser1448fs) rs886040225
NM_007294.3(BRCA1):c.4347A>G (p.Thr1449=) rs80356840
NM_007294.3(BRCA1):c.4348del (p.Ser1450fs) rs1135401932
NM_007294.3(BRCA1):c.4348dup (p.Ser1450fs) rs80357548
NM_007294.3(BRCA1):c.4349C>G (p.Ser1450Ter) rs886040226
NM_007294.3(BRCA1):c.4353A>G (p.Glu1451=) rs786202387
NM_007294.3(BRCA1):c.4354A>T (p.Lys1452Ter) rs398122685
NM_007294.3(BRCA1):c.4357+117G>A rs3737559
NM_007294.3(BRCA1):c.4357+1212T>C rs8176187
NM_007294.3(BRCA1):c.4357+1386T>C rs77473713
NM_007294.3(BRCA1):c.4357+1513_4357+1514insT rs200147389
NM_007294.3(BRCA1):c.4357+1563T>G rs8176188
NM_007294.3(BRCA1):c.4357+1723G>A rs8176190
NM_007294.3(BRCA1):c.4357+1G>A rs80358027
NM_007294.3(BRCA1):c.4357+2045G>T rs143578208
NM_007294.3(BRCA1):c.4357+2077C>G rs6416927
NM_007294.3(BRCA1):c.4357+2128T>C rs77008361
NM_007294.3(BRCA1):c.4357+2313T>G rs149328571
NM_007294.3(BRCA1):c.4357+2519C>T rs4793197
NM_007294.3(BRCA1):c.4357+259A>G rs543852008
NM_007294.3(BRCA1):c.4357+2723C>G rs8176192
NM_007294.3(BRCA1):c.4357+380A>G rs8176185
NM_007294.3(BRCA1):c.4357+651A>G rs530463308
NM_007294.3(BRCA1):c.4357+794G>A rs8176186
NM_007294.3(BRCA1):c.4357+877C>G rs150670602
NM_007294.3(BRCA1):c.4358-1130del rs8176205
NM_007294.3(BRCA1):c.4358-1132A>T rs8176204
NM_007294.3(BRCA1):c.4358-1142A>G rs8176203
NM_007294.3(BRCA1):c.4358-1147_4358-1146insA rs11368665
NM_007294.3(BRCA1):c.4358-1181T>C rs4239147
NM_007294.3(BRCA1):c.4358-1194T>C rs182653629
NM_007294.3(BRCA1):c.4358-1226C>T rs4239148
NM_007294.3(BRCA1):c.4358-1277A>T rs4318274
NM_007294.3(BRCA1):c.4358-1413C>T rs117089582
NM_007294.3(BRCA1):c.4358-1475del rs35184764
NM_007294.3(BRCA1):c.4358-1597C>T rs8176202
NM_007294.3(BRCA1):c.4358-1705T>C rs8176201
NM_007294.3(BRCA1):c.4358-1745T>C rs8176200
NM_007294.3(BRCA1):c.4358-1893A>C rs8176199
NM_007294.3(BRCA1):c.4358-1906T>A rs8176198
NM_007294.3(BRCA1):c.4358-2324C>T rs111819895
NM_007294.3(BRCA1):c.4358-2351G>A rs8176197
NM_007294.3(BRCA1):c.4358-2359T>C rs8176196
NM_007294.3(BRCA1):c.4358-2455C>T rs147065412
NM_007294.3(BRCA1):c.4358-2590T>G rs8176194
NM_007294.3(BRCA1):c.4358-2704C>T rs562625234
NM_007294.3(BRCA1):c.4358-2885G>A rs8176193
NM_007294.3(BRCA1):c.4358-722dup rs68171917
NM_007294.3(BRCA1):c.4358-755A>G rs12940378
NM_007294.3(BRCA1):c.4358_4484del127 rs1555582530
NM_007294.3(BRCA1):c.4364T>G (p.Leu1455Ter) rs886040227
NM_007294.3(BRCA1):c.4370C>A (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4370C>G (p.Ser1457Ter) rs80357130
NM_007294.3(BRCA1):c.4370_4371CA[1] (p.Gln1458fs) rs879255317
NM_007294.3(BRCA1):c.4372C>T (p.Gln1458Ter) rs80356932
NM_007294.3(BRCA1):c.4373_4389del (p.Gln1458fs) rs80359885
NM_007294.3(BRCA1):c.4375A>T (p.Lys1459Ter) rs886040228
NM_007294.3(BRCA1):c.4379del (p.Ser1460fs) rs786203149
NM_007294.3(BRCA1):c.4380T>C (p.Ser1460=) rs786203100
NM_007294.3(BRCA1):c.4386dup (p.Tyr1463fs) rs786204267
NM_007294.3(BRCA1):c.4387del (p.Tyr1463fs) rs397507229
NM_007294.3(BRCA1):c.4389C>A (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4389C>G (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4389_4392dup (p.Ile1465fs) rs879255282
NM_007294.3(BRCA1):c.4391_4393delinsTT (p.Pro1464fs) rs273900730
NM_007294.3(BRCA1):c.4391_4403delinsTT (p.Pro1464fs) rs273900731
NM_007294.3(BRCA1):c.4391del (p.Pro1464fs) rs80357916
NM_007294.3(BRCA1):c.4391dup (p.Ile1465fs) rs80357916
NM_007294.3(BRCA1):c.4392T>A (p.Pro1464=) rs794727102
NM_007294.3(BRCA1):c.4392del (p.Pro1464_Ile1465insTer) rs1064793577
NM_007294.3(BRCA1):c.4393del (p.Pro1464_Ile1465insTer) rs397507230
NM_007294.3(BRCA1):c.4394dup (p.Ser1466fs) rs1555582670
NM_007294.3(BRCA1):c.4397_4398insA (p.Ser1466fs) rs886040229
NM_007294.3(BRCA1):c.4398_4399insA (p.Gln1467fs) rs1555582663
NM_007294.3(BRCA1):c.4399C>T (p.Gln1467Ter) rs397509171
NM_007294.3(BRCA1):c.439T>C (p.Leu147=) rs794727800
NM_007294.3(BRCA1):c.4401del (p.Asn1468fs) rs587781611
NM_007294.3(BRCA1):c.4402A>C (p.Asn1468His) rs80357022
NM_007294.3(BRCA1):c.4408G>T (p.Glu1470Ter) rs886040230
NM_007294.3(BRCA1):c.441+1028T>A rs35908185
NM_007294.3(BRCA1):c.441+1037T>C rs67060599
NM_007294.3(BRCA1):c.441+1173dup rs36085989
NM_007294.3(BRCA1):c.441+1321G>A rs149949159
NM_007294.3(BRCA1):c.441+1379G>T rs139218576
NM_007294.3(BRCA1):c.441+1382A>T rs556333401
NM_007294.3(BRCA1):c.441+1383T>A rs537597375
NM_007294.3(BRCA1):c.441+1416C>T rs34765977
NM_007294.3(BRCA1):c.441+1653A>C rs10445321
NM_007294.3(BRCA1):c.441+1734G>A rs10445303
NM_007294.3(BRCA1):c.441+18CTT[6] rs147856441
NM_007294.3(BRCA1):c.441+1965T>C rs10445320
NM_007294.3(BRCA1):c.441+1990C>T rs183687593
NM_007294.3(BRCA1):c.441+2009G>A rs545752115
NM_007294.3(BRCA1):c.441+280G>A rs8176137
NM_007294.3(BRCA1):c.441+2T>G rs397509173
NM_007294.3(BRCA1):c.441+52_441+63del rs536390258
NM_007294.3(BRCA1):c.441+868C>T rs184910839
NM_007294.3(BRCA1):c.4412del (p.Gly1471fs) rs1064793951
NM_007294.3(BRCA1):c.4413C>T (p.Gly1471=) rs749522068
NM_007294.3(BRCA1):c.4416T>C (p.Leu1472=) rs780239567
NM_007294.3(BRCA1):c.4416_4417delinsG (p.Ser1473fs) rs397509174
NM_007294.3(BRCA1):c.4417del (p.Ser1473fs) rs886040231
NM_007294.3(BRCA1):c.4419T>A (p.Ser1473=) rs730881455
NM_007294.3(BRCA1):c.442-1431G>A rs111387199
NM_007294.3(BRCA1):c.442-1770C>G rs142854457
NM_007294.3(BRCA1):c.442-34C>T rs799923
NM_007294.3(BRCA1):c.442-678C>T rs10445316
NM_007294.3(BRCA1):c.442-680T>C rs799924
NM_007294.3(BRCA1):c.442-680_442-679del rs530582154
NM_007294.3(BRCA1):c.442-696_442-695dup rs200639029
NM_007294.3(BRCA1):c.442-707_442-706del rs201678971
NM_007294.3(BRCA1):c.442-714T>C rs799925
NM_007294.3(BRCA1):c.442-715A>T rs10445317
NM_007294.3(BRCA1):c.442-716A>G rs10445318
NM_007294.3(BRCA1):c.442-730_442-729insAT rs200083681
NM_007294.3(BRCA1):c.442-740_442-738del rs538378944
NM_007294.3(BRCA1):c.442-810_442-809insACA rs574913562
NM_007294.3(BRCA1):c.442-983G>A rs148500539
NM_007294.3(BRCA1):c.4422T>C (p.Ala1474=) rs756281673
NM_007294.3(BRCA1):c.4427dup (p.Phe1477fs) rs397507231
NM_007294.3(BRCA1):c.4432G>T (p.Glu1478Ter) rs876659878
NM_007294.3(BRCA1):c.4435del (p.Val1479fs) rs397509176
NM_007294.3(BRCA1):c.4447del (p.Ser1483fs) rs397509177
NM_007294.3(BRCA1):c.4452_4455del (p.Thr1485fs) rs397509178
NM_007294.3(BRCA1):c.4453_4474del (p.Thr1485fs) rs886040232
NM_007294.3(BRCA1):c.4456del (p.Ser1486fs) rs397509179
NM_007294.3(BRCA1):c.4457del (p.Ser1486fs) rs397509180
NM_007294.3(BRCA1):c.445G>T (p.Glu149Ter) rs876658381
NM_007294.3(BRCA1):c.445del (p.Glu149fs) rs1060502327
NM_007294.3(BRCA1):c.4463dup (p.Asn1488fs) rs80357620
NM_007294.3(BRCA1):c.4468G>T (p.Glu1490Ter) rs138608489
NM_007294.3(BRCA1):c.4474G>T (p.Gly1492Ter) rs863224511
NM_007294.3(BRCA1):c.4480G>T (p.Glu1494Ter) rs80357148
NM_007294.3(BRCA1):c.4482_4483del (p.Arg1495fs) rs80357854
NM_007294.3(BRCA1):c.4483del (p.Arg1495fs) rs80357854
NM_007294.3(BRCA1):c.4484+14A>G rs80358022
NM_007294.3(BRCA1):c.4484+385A>G rs8176206
NM_007294.3(BRCA1):c.4484+463C>T rs56295923
NM_007294.3(BRCA1):c.4484+899C>T rs181392764
NM_007294.3(BRCA1):c.4485-137T>A rs2236762
NM_007294.3(BRCA1):c.4485-203_4485-199del rs34250703
NM_007294.3(BRCA1):c.4485-340G>A rs8176209
NM_007294.3(BRCA1):c.4485-413_4485-400del rs566416929
NM_007294.3(BRCA1):c.4485-546_4485-545insTTCC rs8176207
NM_007294.3(BRCA1):c.4485-63C>G rs273900734
NM_007294.3(BRCA1):c.4487C>A (p.Ser1496Ter) rs80356953
NM_007294.3(BRCA1):c.4487C>G (p.Ser1496Ter) rs80356953
NM_007294.3(BRCA1):c.4493del (p.Pro1498fs) rs398122687
NM_007294.3(BRCA1):c.4503C>A (p.Cys1501Ter) rs747539984
NM_007294.3(BRCA1):c.4503C>T (p.Cys1501=) rs747539984
NM_007294.3(BRCA1):c.4506A>G (p.Pro1502=) rs778400777
NM_007294.3(BRCA1):c.4507_4511del (p.Ser1503fs) rs1135401877
NM_007294.3(BRCA1):c.4508C>A (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4508C>G (p.Ser1503Ter) rs80357437
NM_007294.3(BRCA1):c.4516del (p.Asp1506fs) rs273900736
NM_007294.3(BRCA1):c.4518T>C (p.Asp1506=) rs73983787
NM_007294.3(BRCA1):c.4523G>A (p.Trp1508Ter) rs786202631
NM_007294.3(BRCA1):c.4523_4526delinsTGCCCATCATTAGATGAG (p.Trp1508_Tyr1509delinsLeuProIleIleArgTer) rs1064794004
NM_007294.3(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.3(BRCA1):c.4527C>A (p.Tyr1509Ter) rs886040233
NM_007294.3(BRCA1):c.4528del (p.Met1510fs) rs397509182
NM_007294.3(BRCA1):c.4531_4532CA[1] (p.His1511fs) rs80357534
NM_007294.3(BRCA1):c.4532dup (p.His1511fs) rs1555582009
NM_007294.3(BRCA1):c.4534_4535del (p.Ser1512fs) rs397509183
NM_007294.3(BRCA1):c.4535G>T (p.Ser1512Ile) rs1800744
NM_007294.3(BRCA1):c.4545G>A (p.Gly1515=) rs755731300
NM_007294.3(BRCA1):c.4545G>T (p.Gly1515=) rs755731300
NM_007294.3(BRCA1):c.4552C>T (p.Gln1518Ter) rs80356881
NM_007294.3(BRCA1):c.4554G>A (p.Gln1518=) rs786202635
NM_007294.3(BRCA1):c.4557T>C (p.Asn1519=) rs876659243
NM_007294.3(BRCA1):c.4560A>G (p.Arg1520=) rs761293595
NM_007294.3(BRCA1):c.4566C>A (p.Tyr1522Ter) rs886040234
NM_007294.3(BRCA1):c.4566C>G (p.Tyr1522Ter) rs886040234
NM_007294.3(BRCA1):c.4569_4570insCC (p.Ser1524fs) rs886040235
NM_007294.3(BRCA1):c.4569_4572del (p.Ser1524fs) rs886040236
NM_007294.3(BRCA1):c.456_457del (p.Ser153fs) rs80357882
NM_007294.3(BRCA1):c.456del (p.Ser153fs) rs876659830
NM_007294.3(BRCA1):c.4570del (p.Ser1524fs) rs878853293
NM_007294.3(BRCA1):c.4571_4572insCC (p.Gln1525fs) rs1555581948
NM_007294.3(BRCA1):c.4573C>T (p.Gln1525Ter) rs886040237
NM_007294.3(BRCA1):c.4574_4575del (p.Gln1525fs) rs80357813
NM_007294.3(BRCA1):c.4575_4585del (p.Gln1525fs) rs397509184
NM_007294.3(BRCA1):c.4576G>T (p.Glu1526Ter) rs878853294
NM_007294.3(BRCA1):c.457_458del (p.Ser153fs) rs397509185
NM_007294.3(BRCA1):c.4584C>T (p.Leu1528=) rs1131692080
NM_007294.3(BRCA1):c.4587_4590del (p.Ile1529fs) rs431825409
NM_007294.3(BRCA1):c.4591del (p.Val1531fs) rs886040238
NM_007294.3(BRCA1):c.4593dup (p.Val1532fs) rs886040239
NM_007294.3(BRCA1):c.4595_4596insCT (p.Asp1533fs) rs80357699
NM_007294.3(BRCA1):c.4596_4597insCT (p.Asp1533fs) rs1555581894
NM_007294.3(BRCA1):c.4599T>C (p.Asp1533=) rs1131692095
NM_007294.3(BRCA1):c.45del (p.Asn16fs) rs730881457
NM_007294.3(BRCA1):c.4600G>A (p.Val1534Met) rs55815649
NM_007294.3(BRCA1):c.4603G>T (p.Glu1535Ter) rs80357366
NM_007294.3(BRCA1):c.4609C>T (p.Gln1537Ter) rs80357229
NM_007294.3(BRCA1):c.4609_4610insCC (p.Gln1537fs) rs886038035
NM_007294.3(BRCA1):c.460_467del (p.Val154fs) rs1060502362
NM_007294.3(BRCA1):c.4610_4611insCC (p.Gln1537fs) rs1555581882
NM_007294.3(BRCA1):c.4611_4612insG (p.Gln1538fs) rs80357915
NM_007294.3(BRCA1):c.4612C>T (p.Gln1538Ter) rs80356992
NM_007294.3(BRCA1):c.4612_4613insG (p.Gln1538fs) rs1555581879
NM_007294.3(BRCA1):c.4618G>T (p.Glu1540Ter) rs80357277
NM_007294.3(BRCA1):c.4618_4621delinsAAA (p.Glu1540fs) rs886040240
NM_007294.3(BRCA1):c.4620_4621AG[1] (p.Glu1541fs) rs886040241
NM_007294.3(BRCA1):c.4621G>T (p.Glu1541Ter) rs80357248
NM_007294.3(BRCA1):c.4625_4626del (p.Ser1542fs) rs80357542
NM_007294.3(BRCA1):c.4626T>C (p.Ser1542=) rs786202425
NM_007294.3(BRCA1):c.4635C>T (p.His1545=) rs373686790
NM_007294.3(BRCA1):c.4636G>A (p.Asp1546Asn) rs28897691
NM_007294.3(BRCA1):c.4636G>T (p.Asp1546Tyr) rs28897691
NM_007294.3(BRCA1):c.463C>G (p.Gln155Glu) rs80357180
NM_007294.3(BRCA1):c.463C>T (p.Gln155Ter) rs80357180
NM_007294.3(BRCA1):c.4644G>A (p.Thr1548=) rs28897692
NM_007294.3(BRCA1):c.4646_4665del (p.Glu1549fs) rs397509186
NM_007294.3(BRCA1):c.464_465del (p.Gln155fs) rs886037974
NM_007294.3(BRCA1):c.4650A>G (p.Thr1550=) rs876658608
NM_007294.3(BRCA1):c.4653T>C (p.Ser1551=) rs587780863
NM_007294.3(BRCA1):c.4654_4673del (p.Tyr1552fs) rs876659293
NM_007294.3(BRCA1):c.4655_4658del (p.Tyr1552fs) rs80357561
NM_007294.3(BRCA1):c.4655dup (p.Tyr1552Ter) rs587782143
NM_007294.3(BRCA1):c.4656C>G (p.Tyr1552Ter) rs80357151
NM_007294.3(BRCA1):c.4657T>C (p.Leu1553=) rs80357431
NM_007294.3(BRCA1):c.465del (p.Gln155fs) rs1555594954
NM_007294.3(BRCA1):c.4665G>A (p.Arg1555=) rs878854952
NM_007294.3(BRCA1):c.4666C>T (p.Gln1556Ter) rs1555581812
NM_007294.3(BRCA1):c.4668dup (p.Asp1557fs) rs886040242
NM_007294.3(BRCA1):c.466_467CT[2] (p.Leu156_Ser157insTer) rs80357887
NM_007294.3(BRCA1):c.466dup (p.Leu156fs) rs397507236
NM_007294.3(BRCA1):c.4674del (p.Glu1559fs) rs886040911
NM_007294.3(BRCA1):c.4675+105G>A rs8176213
NM_007294.3(BRCA1):c.4675+1392T>A rs191530878
NM_007294.3(BRCA1):c.4675+1455dup rs533819030
NM_007294.3(BRCA1):c.4675+1515C>G rs111499627
NM_007294.3(BRCA1):c.4675+1G>A rs80358044
NM_007294.3(BRCA1):c.4675+315A>C rs2236763
NM_007294.3(BRCA1):c.4675+509A>G rs8176214
NM_007294.3(BRCA1):c.4675+563A>T rs190123841
NM_007294.3(BRCA1):c.4675+565T>A rs8176215
NM_007294.3(BRCA1):c.4675+567T>A rs8176216
NM_007294.3(BRCA1):c.4675+569T>A rs182629224
NM_007294.3(BRCA1):c.4675+581T>C rs8176217
NM_007294.3(BRCA1):c.4675+693del rs5820482
NM_007294.3(BRCA1):c.4675+903C>T rs74877299
NM_007294.3(BRCA1):c.4676-1011G>A rs183687995
NM_007294.3(BRCA1):c.4676-1025G>A rs138082324
NM_007294.3(BRCA1):c.4676-284_4676-283insACAAGCATTGTTACAGTGAACATT rs8176218
NM_007294.3(BRCA1):c.4676-55C>T rs545107728
NM_007294.3(BRCA1):c.4676-777del rs200424092
NM_007294.3(BRCA1):c.4678G>T (p.Gly1560Ter) rs80357349
NM_007294.3(BRCA1):c.4678_4679del (p.Gly1560fs) rs1555581104
NM_007294.3(BRCA1):c.4681del (p.Thr1561fs) rs397509187
NM_007294.3(BRCA1):c.4683C>T (p.Thr1561=) rs878853265
NM_007294.3(BRCA1):c.4684_4685del (p.Pro1562fs) rs397509188
NM_007294.3(BRCA1):c.4688dup (p.Tyr1563Ter) rs886040243
NM_007294.3(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.3(BRCA1):c.468C>G (p.Leu156=) rs748923729
NM_007294.3(BRCA1):c.4691T>C (p.Leu1564Pro) rs56119278
NM_007294.3(BRCA1):c.4691_4697TGGAATC[3] (p.Ser1569fs) rs879255318
NM_007294.3(BRCA1):c.4695dup (p.Ser1566fs) rs397509189
NM_007294.3(BRCA1):c.4696_4697insA (p.Ser1566fs) rs483353095
NM_007294.3(BRCA1):c.4697_4698insA (p.Gly1567fs) rs1555581078
NM_007294.3(BRCA1):c.4699_4708del (p.Gly1567fs) rs886040244
NM_007294.3(BRCA1):c.4700_4710delinsA (p.Gly1567fs) rs886040245
NM_007294.3(BRCA1):c.4709dup (p.Phe1571fs) rs864622132
NM_007294.3(BRCA1):c.470_477del (p.Ser157fs) rs397509190
NM_007294.3(BRCA1):c.4710C>T (p.Leu1570=) rs786201839
NM_007294.3(BRCA1):c.4712_4716del (p.Leu1570_Phe1571insTer) rs80357718
NM_007294.3(BRCA1):c.4712del (p.Phe1571fs) rs886037790
NM_007294.3(BRCA1):c.4724del (p.Pro1575fs) rs397509191
NM_007294.3(BRCA1):c.4725T>G (p.Pro1575=) rs878854953
NM_007294.3(BRCA1):c.4737T>C (p.Pro1579=) rs878854954
NM_007294.3(BRCA1):c.4740T>C (p.Ser1580=) rs777297026
NM_007294.3(BRCA1):c.4741G>T (p.Glu1581Ter) rs397509193
NM_007294.3(BRCA1):c.4743A>G (p.Glu1581=) rs397509194
NM_007294.3(BRCA1):c.4743del (p.Asp1582fs) rs886040246
NM_007294.3(BRCA1):c.4745del (p.Asp1582fs) rs80357907
NM_007294.3(BRCA1):c.4747_4748AG[1] (p.Arg1583fs) rs80357641
NM_007294.3(BRCA1):c.4752C>T (p.Ala1584=) rs786201422
NM_007294.3(BRCA1):c.4754_4755del (p.Pro1585fs) rs80357837
NM_007294.3(BRCA1):c.4758_4759insA (p.Ser1587fs) rs886040247
NM_007294.3(BRCA1):c.4759_4760insA (p.Ser1587fs) rs1555580980
NM_007294.3(BRCA1):c.475del (p.Gly160fs) rs886037976
NM_007294.3(BRCA1):c.4760C>G (p.Ser1587Ter) rs397509195
NM_007294.3(BRCA1):c.4764T>A (p.Ala1588=) rs753651115
NM_007294.3(BRCA1):c.4764T>C (p.Ala1588=) rs753651115
NM_007294.3(BRCA1):c.4764_4765del (p.Arg1589fs) rs80357795
NM_007294.3(BRCA1):c.4764del (p.Arg1589fs) rs397509196
NM_007294.3(BRCA1):c.4767T>G (p.Arg1589=) rs587780864
NM_007294.3(BRCA1):c.4775_4779delinsC (p.Asn1592fs) rs397507237
NM_007294.3(BRCA1):c.477T>C (p.Leu159=) rs779704727
NM_007294.3(BRCA1):c.4782A>G (p.Pro1594=) rs876659455
NM_007294.3(BRCA1):c.4784del (p.Ser1595fs) rs886040248
NM_007294.3(BRCA1):c.4787C>A (p.Ser1596Ter) rs80357429
NM_007294.3(BRCA1):c.4798T>C (p.Leu1600=) rs775837744
NM_007294.3(BRCA1):c.4799dup (p.Leu1600fs) rs587782392
NM_007294.3(BRCA1):c.4801A>T (p.Lys1601Ter) rs80357303
NM_007294.3(BRCA1):c.4803A>G (p.Lys1601=) rs886037794
NM_007294.3(BRCA1):c.4806del (p.Gln1604fs) rs886038036
NM_007294.3(BRCA1):c.4810C>T (p.Gln1604Ter) rs80357352
NM_007294.3(BRCA1):c.4812A>G (p.Gln1604=) rs28897693
NM_007294.3(BRCA1):c.4813T>C (p.Leu1605=) rs80356833
NM_007294.3(BRCA1):c.4823_4824insG (p.Glu1609fs) rs1555580865
NM_007294.3(BRCA1):c.4833C>T (p.Ala1611=) rs80356842
NM_007294.3(BRCA1):c.4834C>T (p.Gln1612Ter) rs786202064
NM_007294.3(BRCA1):c.4834_4835del (p.Gln1612fs) rs1555580840
NM_007294.3(BRCA1):c.4834del (p.Gln1612fs) rs886040249
NM_007294.3(BRCA1):c.4836dup (p.Ser1613fs) rs397509198
NM_007294.3(BRCA1):c.4837A>G (p.Ser1613Gly) rs1799966
NM_007294.3(BRCA1):c.4837_4838delinsGCC (p.Ser1613fs) rs730880287
NM_007294.3(BRCA1):c.4837del (p.Ser1613fs) rs397509199
NM_007294.3(BRCA1):c.4838_4839insC (p.Pro1614fs) rs397509200
NM_007294.3(BRCA1):c.483_484TG[1] (p.Val162fs) rs80357708
NM_007294.3(BRCA1):c.483_484TG[3] (p.Arg163Ter) rs80357708
NM_007294.3(BRCA1):c.4840C>T (p.Pro1614Ser) rs70953660
NM_007294.3(BRCA1):c.4841dup (p.Ala1615fs) rs1555580813
NM_007294.3(BRCA1):c.4843dup (p.Ala1615fs) rs80357615
NM_007294.3(BRCA1):c.4845T>C (p.Ala1615=) rs144588397
NM_007294.3(BRCA1):c.4851T>C (p.Ala1617=) rs786202627
NM_007294.3(BRCA1):c.485dup (p.Arg163fs) rs587781427
NM_007294.3(BRCA1):c.4860T>C (p.Thr1620=) rs750938749
NM_007294.3(BRCA1):c.4860_4941del (p.Asp1621fs) rs1555580648
NM_007294.3(BRCA1):c.486G>T (p.Val162=) rs769213707
NM_007294.3(BRCA1):c.4873_4885del (p.Tyr1625fs) rs397509201
NM_007294.3(BRCA1):c.4875T>A (p.Tyr1625Ter) rs886040251
NM_007294.3(BRCA1):c.4877del (p.Asn1626fs) rs886040252
NM_007294.3(BRCA1):c.4878dup (p.Ala1627fs) rs886040253
NM_007294.3(BRCA1):c.4883T>C (p.Met1628Thr) rs4986854
NM_007294.3(BRCA1):c.4885dup (p.Glu1629fs) rs886040254
NM_007294.3(BRCA1):c.4887_4893del (p.Glu1629_Glu1630insTer) rs886040255
NM_007294.3(BRCA1):c.4888_4889del (p.Glu1630fs) rs879255490
NM_007294.3(BRCA1):c.488del (p.Arg163fs) rs397509202
NM_007294.3(BRCA1):c.4891del (p.Ser1631fs) rs80357656
NM_007294.3(BRCA1):c.4891dup (p.Ser1631fs) rs80357656
NM_007294.3(BRCA1):c.4893T>C (p.Ser1631=) rs80356850
NM_007294.3(BRCA1):c.4893_4894TG[1] (p.Val1632fs) rs886038037
NM_007294.3(BRCA1):c.4901_4919del (p.Arg1634fs) rs1555580678
NM_007294.3(BRCA1):c.4902G>A (p.Arg1634=) rs746199881
NM_007294.3(BRCA1):c.4903G>T (p.Glu1635Ter) rs200432771
NM_007294.3(BRCA1):c.4903_4904GA[1] (p.Lys1636fs) rs397509203
NM_007294.3(BRCA1):c.4903del (p.Glu1635fs) rs1555580697
NM_007294.3(BRCA1):c.490del (p.Thr164fs) rs863224512
NM_007294.3(BRCA1):c.4910C>T (p.Pro1637Leu) rs80357048
NM_007294.3(BRCA1):c.4910del (p.Pro1637fs) rs397509204
NM_007294.3(BRCA1):c.4914A>G (p.Glu1638=) rs786201216
NM_007294.3(BRCA1):c.491_492CT[1] (p.Leu165fs) rs397509206
NM_007294.3(BRCA1):c.4921del (p.Ala1641fs) rs886040257
NM_007294.3(BRCA1):c.4923T>G (p.Ala1641=) rs876658258
NM_007294.3(BRCA1):c.4929A>C (p.Thr1643=) rs786202022
NM_007294.3(BRCA1):c.4930G>T (p.Glu1644Ter) rs397509205
NM_007294.3(BRCA1):c.4932_4933dup (p.Arg1645fs) rs80357833
NM_007294.3(BRCA1):c.4935_4936insAA (p.Val1646fs) rs1555580653
NM_007294.3(BRCA1):c.4936del (p.Val1646fs) rs80357653
NM_007294.3(BRCA1):c.493del (p.Thr164_Leu165insTer) rs80357551
NM_007294.3(BRCA1):c.4941del (p.Asn1647fs) rs80357905
NM_007294.3(BRCA1):c.4944_4945del (p.Arg1649fs) rs80357655
NM_007294.3(BRCA1):c.4945_4947delinsTTTT (p.Arg1649fs) rs397509207
NM_007294.3(BRCA1):c.4945del (p.Arg1649fs) rs80357655
NM_007294.3(BRCA1):c.494dupT (p.Arg166Glufs) rs80357762
NM_007294.3(BRCA1):c.4955T>C (p.Met1652Thr) rs80356968
NM_007294.3(BRCA1):c.4956G>A (p.Met1652Ile) rs1799967
NM_007294.3(BRCA1):c.4959G>A (p.Val1653=) rs878854955
NM_007294.3(BRCA1):c.495G>A (p.Leu165=) rs745321499
NM_007294.3(BRCA1):c.4962G>A (p.Val1654=) rs549640262
NM_007294.3(BRCA1):c.4964_4979del (p.Val1654_Ser1655insTer) rs397509209
NM_007294.3(BRCA1):c.4964_4982del (p.Ser1655fs) rs80359876
NM_007294.3(BRCA1):c.4966_4984del (p.Gly1656fs) rs80359884
NM_007294.3(BRCA1):c.4969del (p.Gly1656_Leu1657insTer) rs886038038
NM_007294.3(BRCA1):c.4971G>A (p.Leu1657=) rs786202058
NM_007294.3(BRCA1):c.4971G>C (p.Leu1657=) rs786202058
NM_007294.3(BRCA1):c.4972del (p.Thr1658fs) rs1060505044
NM_007294.3(BRCA1):c.4976del (p.Pro1659fs) rs879255295
NM_007294.3(BRCA1):c.4977A>C (p.Pro1659=) rs1131692087
NM_007294.3(BRCA1):c.4981G>T (p.Glu1661Ter) rs80357401
NM_007294.3(BRCA1):c.4985T>C (p.Phe1662Ser) rs28897695
NM_007294.3(BRCA1):c.4986+1349G>T rs8176225
NM_007294.3(BRCA1):c.4986+222A>G rs3092987
NM_007294.3(BRCA1):c.4986+483T>C rs8176220
NM_007294.3(BRCA1):c.4986+484A>T rs8176221
NM_007294.3(BRCA1):c.4986+846G>A rs8176222
NM_007294.3(BRCA1):c.4987-1060G>A rs145869415
NM_007294.3(BRCA1):c.4987-1466G>A rs8176226
NM_007294.3(BRCA1):c.4987-1G>A rs730881495
NM_007294.3(BRCA1):c.4987-20A>G rs80358035
NM_007294.3(BRCA1):c.4987-511T>C rs8176231
NM_007294.3(BRCA1):c.4987-576G>A rs8176229
NM_007294.3(BRCA1):c.4987-608G>T rs8176228
NM_007294.3(BRCA1):c.4987-68A>G rs8176234
NM_007294.3(BRCA1):c.4987-92A>G rs8176233
NM_007294.3(BRCA1):c.4987_5074del88 (p.Val1665Serfs) rs1555579598
NM_007294.3(BRCA1):c.4987del (p.Met1663fs) rs886040912
NM_007294.3(BRCA1):c.4991T>C (p.Leu1664Pro) rs80357314
NM_007294.3(BRCA1):c.4992C>T (p.Leu1664=) rs142459158
NM_007294.3(BRCA1):c.4995_5007dup (p.Arg1670fs) rs1555579747
NM_007294.3(BRCA1):c.4996_4997dup (p.Lys1667fs) rs1555579782
NM_007294.3(BRCA1):c.4997dup (p.Tyr1666Ter) rs876658947
NM_007294.3(BRCA1):c.4998C>A (p.Tyr1666Ter) rs730882165
NM_007294.3(BRCA1):c.4998C>T (p.Tyr1666=) rs730882165
NM_007294.3(BRCA1):c.4999A>T (p.Lys1667Ter) rs80357204
NM_007294.3(BRCA1):c.5005del (p.Ala1669fs) rs80357938
NM_007294.3(BRCA1):c.5007C>T (p.Ala1669=) rs751856943
NM_007294.3(BRCA1):c.5008_5009insC (p.Arg1670fs) rs1555579738
NM_007294.3(BRCA1):c.500_501del (p.Thr167fs) rs886040258
NM_007294.3(BRCA1):c.5010A>G (p.Arg1670=) rs777828258
NM_007294.3(BRCA1):c.5013dup (p.His1672fs) rs886040259
NM_007294.3(BRCA1):c.5019del (p.His1673fs) rs886040260
NM_007294.3(BRCA1):c.5022C>T (p.Ile1674=) rs786203868
NM_007294.3(BRCA1):c.5025T>C (p.Thr1675=) rs876658226
NM_007294.3(BRCA1):c.5026_5027del (p.Leu1676fs) rs397509217
NM_007294.3(BRCA1):c.5026_5036del (p.Leu1676fs) rs80357894
NM_007294.3(BRCA1):c.5027T>A (p.Leu1676Ter) rs786203754
NM_007294.3(BRCA1):c.5027T>G (p.Leu1676Ter) rs786203754
NM_007294.3(BRCA1):c.5027_5031del (p.Thr1675_Leu1676insTer) rs431825410
NM_007294.3(BRCA1):c.5027del (p.Thr1675_Leu1676insTer) rs397509217
NM_007294.3(BRCA1):c.5027dup (p.Leu1676fs) rs397509217
NM_007294.3(BRCA1):c.5028A>G (p.Leu1676=) rs1064793596
NM_007294.3(BRCA1):c.502A>T (p.Lys168Ter) rs886040263
NM_007294.3(BRCA1):c.5030_5033del (p.Thr1677fs) rs80357580
NM_007294.3(BRCA1):c.5030_5033dup (p.Leu1679_Ile1680insTer) rs80357580
NM_007294.3(BRCA1):c.5030_5034CTAAT[1] (p.Leu1679fs) rs80357623
NM_007294.3(BRCA1):c.5031T>A (p.Thr1677=) rs765241963
NM_007294.3(BRCA1):c.5035del (p.Asn1678_Leu1679insTer) rs80357896
NM_007294.3(BRCA1):c.5037A>G (p.Leu1679=) rs754256578
NM_007294.3(BRCA1):c.5038_5041dup (p.Thr1681fs) rs1555579686
NM_007294.3(BRCA1):c.5039_5040del (p.Ile1680fs) rs1135401935
NM_007294.3(BRCA1):c.5040del (p.Thr1681fs) rs80357673
NM_007294.3(BRCA1):c.5041_5042insTTAA (p.Thr1681fs) rs886040264
NM_007294.3(BRCA1):c.5042del (p.Thr1681fs) rs886040265
NM_007294.3(BRCA1):c.5043_5044insTAAT (p.Glu1682Ter) rs1555579675
NM_007294.3(BRCA1):c.5044G>A (p.Glu1682Lys) rs80356958
NM_007294.3(BRCA1):c.5044_5048delinsT (p.Thr1681_Glu1682insTer) rs886040266
NM_007294.3(BRCA1):c.5047G>T (p.Glu1683Ter) rs80356879
NM_007294.3(BRCA1):c.5050_5051del (p.Thr1684fs) rs879255283
NM_007294.3(BRCA1):c.5051del (p.Thr1684fs) rs1135401881
NM_007294.3(BRCA1):c.5052T>C (p.Thr1684=) rs760922019
NM_007294.3(BRCA1):c.5053A>G (p.Thr1685Ala) rs80356890
NM_007294.3(BRCA1):c.5054C>T (p.Thr1685Ile) rs80357043
NM_007294.3(BRCA1):c.5054_5057dup (p.Val1687fs) rs879254050
NM_007294.3(BRCA1):c.5056dup (p.His1686fs) rs80357974
NM_007294.3(BRCA1):c.5058_5059insCAAC (p.Val1687fs) rs886040267
NM_007294.3(BRCA1):c.5059_5060insCAAC (p.Val1687fs) rs1555579630
NM_007294.3(BRCA1):c.505C>T (p.Gln169Ter) rs80357133
NM_007294.3(BRCA1):c.5065dup (p.Met1689fs) rs886040268
NM_007294.3(BRCA1):c.5068A>T (p.Lys1690Ter) rs397507239
NM_007294.3(BRCA1):c.5071dupA (p.Thr1691Asnfs) rs80357672
NM_007294.3(BRCA1):c.5073A>G (p.Thr1691=) rs80356853
NM_007294.3(BRCA1):c.5074+1010T>G rs142829210
NM_007294.3(BRCA1):c.5074+1053A>G rs4793195
NM_007294.3(BRCA1):c.5074+1158G>A rs112966361
NM_007294.3(BRCA1):c.5074+1199C>G rs8176239
NM_007294.3(BRCA1):c.5074+1253T>C rs8176240
NM_007294.3(BRCA1):c.5074+1292C>T rs4793194
NM_007294.3(BRCA1):c.5074+1388A>G rs145654477
NM_007294.3(BRCA1):c.5074+1618A>G rs139038134
NM_007294.3(BRCA1):c.5074+1751G>A rs8176242
NM_007294.3(BRCA1):c.5074+1G>A rs80358053
NM_007294.3(BRCA1):c.5074+205G>A rs113814958
NM_007294.3(BRCA1):c.5074+221A>G rs142117419
NM_007294.3(BRCA1):c.5074+228C>T rs71379207
NM_007294.3(BRCA1):c.5074+265G>A rs147144902
NM_007294.3(BRCA1):c.5074+284C>A rs11654396
NM_007294.3(BRCA1):c.5074+65G>A rs8176235
NM_007294.3(BRCA1):c.5074+760G>A rs533045755
NM_007294.3(BRCA1):c.5074+820T>C rs8176236
NM_007294.3(BRCA1):c.5074+878G>A rs8176237
NM_007294.3(BRCA1):c.5074+909C>T rs139793550
NM_007294.3(BRCA1):c.5074+918G>A rs8176238
NM_007294.3(BRCA1):c.5074+918G>C rs8176238
NM_007294.3(BRCA1):c.5075-1073C>A rs8176250
NM_007294.3(BRCA1):c.5075-1135G>A rs8176248
NM_007294.3(BRCA1):c.5075-1139del rs8176247
NM_007294.3(BRCA1):c.5075-1143G>A rs8176246
NM_007294.3(BRCA1):c.5075-1412T>C rs8176245
NM_007294.3(BRCA1):c.5075-1546A>G rs8176244
NM_007294.3(BRCA1):c.5075-1584T>G rs8176243
NM_007294.3(BRCA1):c.5075-237C>A rs8176257
NM_007294.3(BRCA1):c.5075-238A>G rs8176256
NM_007294.3(BRCA1):c.5075-373C>T rs8176255
NM_007294.3(BRCA1):c.5075-376C>T rs8176254
NM_007294.3(BRCA1):c.5075-53C>T rs8176258
NM_007294.3(BRCA1):c.5075-745A>T rs8176252
NM_007294.3(BRCA1):c.5075-965A>G rs3785546
NM_007294.3(BRCA1):c.5075_5078del (p.Asp1692fs) rs397509223
NM_007294.3(BRCA1):c.5076del (p.Asp1692fs) rs886040269
NM_007294.3(BRCA1):c.507G>A (p.Gln169=) rs759882045
NM_007294.3(BRCA1):c.5080G>T (p.Glu1694Ter) rs80356896
NM_007294.3(BRCA1):c.5083_5084insG (p.Phe1695fs) rs886040270
NM_007294.3(BRCA1):c.5084_5085del (p.Phe1695fs) rs80357760
NM_007294.3(BRCA1):c.5084_5085insG (p.Phe1695fs) rs1555578648
NM_007294.3(BRCA1):c.5085_5086TG[3] (p.Cys1697_Glu1698delinsTer) rs80357710
NM_007294.3(BRCA1):c.5088G>A (p.Val1696=) rs878854956
NM_007294.3(BRCA1):c.5091del (p.Cys1697fs) rs1135401882
NM_007294.3(BRCA1):c.5094A>G (p.Glu1698=) rs764891781
NM_007294.3(BRCA1):c.5095C>A (p.Arg1699=) rs55770810
NM_007294.3(BRCA1):c.5095C>T (p.Arg1699Trp) rs55770810
NM_007294.3(BRCA1):c.5098del (p.Thr1700fs) rs483353099
NM_007294.3(BRCA1):c.5100A>G (p.Thr1700=) rs45519437
NM_007294.3(BRCA1):c.5102_5103del (p.Leu1701fs) rs80357608
NM_007294.3(BRCA1):c.5102del (p.Leu1701fs) rs1555578613
NM_007294.3(BRCA1):c.5106del (p.Lys1702fs) rs80357553
NM_007294.3(BRCA1):c.5109T>C (p.Tyr1703=) rs80356974
NM_007294.3(BRCA1):c.5109T>G (p.Tyr1703Ter) rs80356974
NM_007294.3(BRCA1):c.510del (p.Ile171fs) rs1060505052
NM_007294.3(BRCA1):c.5112del (p.Phe1704_Leu1705insTer) rs397509228
NM_007294.3(BRCA1):c.5113C>T (p.Leu1705=) rs80356858
NM_007294.3(BRCA1):c.5114_5121del (p.Leu1705fs) rs886040271
NM_007294.3(BRCA1):c.5115A>C (p.Leu1705=) rs772885662
NM_007294.3(BRCA1):c.5117G>A (p.Gly1706Glu) rs80356860
NM_007294.3(BRCA1):c.5117G>C (p.Gly1706Ala) rs80356860
NM_007294.3(BRCA1):c.5123C>A (p.Ala1708Glu) rs28897696
NM_007294.3(BRCA1):c.5123del (p.Ala1708fs) rs886038040
NM_007294.3(BRCA1):c.5124G>A (p.Ala1708=) rs1057520432
NM_007294.3(BRCA1):c.5126del (p.Gly1709fs) rs80357874
NM_007294.3(BRCA1):c.5128G>T (p.Gly1710Ter) rs397509229
NM_007294.3(BRCA1):c.5129del (p.Gly1710fs) rs1135401829
NM_007294.3(BRCA1):c.512dup (p.Gln172fs) rs587781487
NM_007294.3(BRCA1):c.5131A>T (p.Lys1711Ter) rs886040272
NM_007294.3(BRCA1):c.5133del (p.Lys1711fs) rs730880288
NM_007294.3(BRCA1):c.5133dup (p.Trp1712fs) rs730880288
NM_007294.3(BRCA1):c.5135G>A (p.Trp1712Ter) rs876658672
NM_007294.3(BRCA1):c.5136G>A (p.Trp1712Ter) rs80357418
NM_007294.3(BRCA1):c.5137del (p.Trp1712_Val1713insTer) rs80357997
NM_007294.3(BRCA1):c.5142T>G (p.Val1714=) rs749319480
NM_007294.3(BRCA1):c.5143A>C (p.Ser1715Arg) rs80357222
NM_007294.3(BRCA1):c.5145del (p.Tyr1716fs) rs80357870
NM_007294.3(BRCA1):c.5148T>A (p.Tyr1716Ter) rs397509230
NM_007294.3(BRCA1):c.5148T>G (p.Tyr1716Ter) rs397509230
NM_007294.3(BRCA1):c.5148_5149insC (p.Phe1717fs) rs1555578542
NM_007294.3(BRCA1):c.514C>T (p.Gln172Ter) rs80356947
NM_007294.3(BRCA1):c.514del (p.Gln172fs) rs80357872
NM_007294.3(BRCA1):c.5150del (p.Phe1717fs) rs80357720
NM_007294.3(BRCA1):c.5152+188dup rs542231412
NM_007294.3(BRCA1):c.5152+1G>T rs80358094
NM_007294.3(BRCA1):c.5152+66G>A rs3092994
NM_007294.3(BRCA1):c.5152+85delT rs8176259
NM_007294.3(BRCA1):c.5153-13A>G rs45471406
NM_007294.3(BRCA1):c.5153-1G>C rs80358137
NM_007294.3(BRCA1):c.5153-1dup rs80357743
NM_007294.3(BRCA1):c.5153-6C>A rs80358129
NM_007294.3(BRCA1):c.5153G>A (p.Trp1718Ter) rs41293461
NM_007294.3(BRCA1):c.5154G>A (p.Trp1718Ter) rs80357239
NM_007294.3(BRCA1):c.5155delG (p.Val1719Terfs) rs80357743
NM_007294.3(BRCA1):c.5156_5157del (p.Val1719fs) rs80357895
NM_007294.3(BRCA1):c.5156_5157insAATA (p.Thr1720fs) rs1555578407
NM_007294.3(BRCA1):c.5157G>T (p.Val1719=) rs28897697
NM_007294.3(BRCA1):c.5158A>G (p.Thr1720Ala) rs56195342
NM_007294.3(BRCA1):c.5160C>G (p.Thr1720=) rs376736915
NM_007294.3(BRCA1):c.5161C>T (p.Gln1721Ter) rs878854957
NM_007294.3(BRCA1):c.5161_5165del (p.Gln1721fs) rs886040274
NM_007294.3(BRCA1):c.5162del (p.Gln1721fs) rs397509233
NM_007294.3(BRCA1):c.5163_5164insC (p.Ser1722fs) rs886040275
NM_007294.3(BRCA1):c.5165dup (p.Ile1723fs) rs1555578376
NM_007294.3(BRCA1):c.5167delinsTTT (p.Ile1723fs) rs730882167
NM_007294.3(BRCA1):c.516A>G (p.Gln172=) rs752940034
NM_007294.3(BRCA1):c.516del (p.Gln172fs) rs879254223
NM_007294.3(BRCA1):c.5173G>T (p.Glu1725Ter) rs80357291
NM_007294.3(BRCA1):c.5173_5176GAAA[1] (p.Arg1726fs) rs80357867
NM_007294.3(BRCA1):c.5175A>G (p.Glu1725=) rs191373374
NM_007294.3(BRCA1):c.5176del (p.Arg1726fs) rs876658478
NM_007294.3(BRCA1):c.5177_5178del (p.Arg1726fs) rs80357730
NM_007294.3(BRCA1):c.5179A>T (p.Lys1727Ter) rs80357347
NM_007294.3(BRCA1):c.5179_5192del (p.Lys1727fs) rs397509234
NM_007294.3(BRCA1):c.5181_5182del (p.Lys1727fs) rs34570933
NM_007294.3(BRCA1):c.5182del (p.Met1728fs) rs34570933
NM_007294.3(BRCA1):c.5186del (p.Leu1729fs) rs398122692
NM_007294.3(BRCA1):c.518del (p.Pro173fs) rs886040276
NM_007294.3(BRCA1):c.5193+1139_5193+1140del rs8176263
NM_007294.3(BRCA1):c.5193+1232_5193+1234del rs536209322
NM_007294.3(BRCA1):c.5193+1271A>G rs8176264
NM_007294.3(BRCA1):c.5193+1354G>A rs8176265
NM_007294.3(BRCA1):c.5193+1457G>A rs2187603
NM_007294.3(BRCA1):c.5193+1590G>A rs8176266
NM_007294.3(BRCA1):c.5193+1602A>G rs8176267
NM_007294.3(BRCA1):c.5193+1690A>G rs8176268
NM_007294.3(BRCA1):c.5193+1724C>A rs8176269
NM_007294.3(BRCA1):c.5193+2032G>A rs139650794
NM_007294.3(BRCA1):c.5193+2230C>G rs146299550
NM_007294.3(BRCA1):c.5193+2256C>G rs141915184
NM_007294.3(BRCA1):c.5193+2337G>A rs115522763
NM_007294.3(BRCA1):c.5193+2545G>A rs8077486
NM_007294.3(BRCA1):c.5193+2582G>A rs186421008
NM_007294.3(BRCA1):c.5193+2588C>T rs111581719
NM_007294.3(BRCA1):c.5193+2803G>A rs35330014
NM_007294.3(BRCA1):c.5193+3012T>G rs4793193
NM_007294.3(BRCA1):c.5193+730A>T rs186955850
NM_007294.3(BRCA1):c.5193G>A (p.Glu1731=) rs876660702
NM_007294.3(BRCA1):c.5194-1179G>T rs8066171
NM_007294.3(BRCA1):c.5194-1242T>G rs146318688
NM_007294.3(BRCA1):c.5194-1244T>G rs8176279
NM_007294.3(BRCA1):c.5194-1264A>G rs8176278
NM_007294.3(BRCA1):c.5194-12G>A rs80358079
NM_007294.3(BRCA1):c.5194-1450A>G rs8176276
NM_007294.3(BRCA1):c.5194-2072G>A rs181752925
NM_007294.3(BRCA1):c.5194-2216G>T rs142638930
NM_007294.3(BRCA1):c.5194-221T>C rs111611613
NM_007294.3(BRCA1):c.5194-2337_5194-2335dup rs746155740
NM_007294.3(BRCA1):c.5194-2381T>G rs186594388
NM_007294.3(BRCA1):c.5194-2501T>C rs8176273
NM_007294.3(BRCA1):c.5194-2801A>G rs185244474
NM_007294.3(BRCA1):c.5194-2912T>C rs189676688
NM_007294.3(BRCA1):c.5194-3017G>A rs11652377
NM_007294.3(BRCA1):c.5194-3028G>A rs146959162
NM_007294.3(BRCA1):c.5194-403T>A rs559234080
NM_007294.3(BRCA1):c.5194-423C>T rs149635371
NM_007294.3(BRCA1):c.5194-426A>G rs8176282
NM_007294.3(BRCA1):c.5194-466G>A rs8176281
NM_007294.3(BRCA1):c.5194-475G>T rs8176280
NM_007294.3(BRCA1):c.519T>A (p.Pro173=) rs876659179
NM_007294.3(BRCA1):c.519del (p.Gln174fs) rs886037784
NM_007294.3(BRCA1):c.51del (p.Met18fs) rs886037967
NM_007294.3(BRCA1):c.5201_5202insC (p.Phe1734_Glu1735insTer) rs1555576982
NM_007294.3(BRCA1):c.5202del (p.Phe1734fs) rs876659867
NM_007294.3(BRCA1):c.5205del (p.Val1736fs) rs587781258
NM_007294.3(BRCA1):c.5207del (p.Val1736fs) rs397509239
NM_007294.3(BRCA1):c.5208_5247delinsTC (p.Arg1737fs) rs886040277
NM_007294.3(BRCA1):c.5209A>T (p.Arg1737Ter) rs80357496
NM_007294.3(BRCA1):c.5209_5248delinsTC (p.Arg1737fs) rs273901753
NM_007294.3(BRCA1):c.5209dup (p.Arg1737fs) rs886040278
NM_007294.3(BRCA1):c.520del (p.Gln174fs) rs80357639
NM_007294.3(BRCA1):c.5210_5211insC (p.Arg1737fs) rs1555576964
NM_007294.3(BRCA1):c.5212G>A (p.Gly1738Arg) rs80356937
NM_007294.3(BRCA1):c.5212G>T (p.Gly1738Ter) rs80356937
NM_007294.3(BRCA1):c.5213_5214GA[1] (p.Asp1739fs) rs1064794467
NM_007294.3(BRCA1):c.5213del (p.Gly1738fs) rs886040279
NM_007294.3(BRCA1):c.5221_5224del (p.Val1741fs) rs886040280
NM_007294.3(BRCA1):c.5229_5230del (p.Arg1744fs) rs80357852
NM_007294.3(BRCA1):c.522A>G (p.Gln174=) rs765432756
NM_007294.3(BRCA1):c.5230_5237del (p.Arg1744fs) rs886040281
NM_007294.3(BRCA1):c.5230del (p.Arg1744fs) rs397509240
NM_007294.3(BRCA1):c.5231del (p.Arg1744fs) rs397509241
NM_007294.3(BRCA1):c.5234dup (p.Asn1745fs) rs886038042
NM_007294.3(BRCA1):c.5236del (p.His1746fs) rs876659483
NM_007294.3(BRCA1):c.5237del (p.His1746fs) rs1555576907
NM_007294.3(BRCA1):c.5239C>T (p.Gln1747Ter) rs80357367
NM_007294.3(BRCA1):c.5239del (p.Gln1747fs) rs886040282
NM_007294.3(BRCA1):c.5239dup (p.Gln1747fs) rs886040282
NM_007294.3(BRCA1):c.5241del (p.Gly1748fs) rs80357791
NM_007294.3(BRCA1):c.5243del (p.Gly1748fs) rs80357676
NM_007294.3(BRCA1):c.5247_5248insTC (p.Lys1750fs) rs1555576878
NM_007294.3(BRCA1):c.5248_5249insTC (p.Lys1750fs) rs1555576871
NM_007294.3(BRCA1):c.5249del (p.Lys1750fs) rs879253993
NM_007294.3(BRCA1):c.5249dup (p.Arg1751fs) rs879253993
NM_007294.3(BRCA1):c.5251C>T (p.Arg1751Ter) rs80357123
NM_007294.3(BRCA1):c.5252G>A (p.Arg1751Gln) rs80357442
NM_007294.3(BRCA1):c.5256A>C (p.Ala1752=) rs80356844
NM_007294.3(BRCA1):c.5257dup (p.Arg1753fs) rs397509245
NM_007294.3(BRCA1):c.5259A>G (p.Arg1753=) rs771577266
NM_007294.3(BRCA1):c.5259del (p.Glu1754fs) rs80357925
NM_007294.3(BRCA1):c.5260G>T (p.Glu1754Ter) rs80357432
NM_007294.3(BRCA1):c.5266C>T (p.Gln1756Ter) rs397509247
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs80357906
NM_007294.3(BRCA1):c.5267_5268insC (p.Gln1756fs) rs886040284
NM_007294.3(BRCA1):c.5268G>A (p.Gln1756=) rs571834423
NM_007294.3(BRCA1):c.5268_5269insC (p.Asp1757fs) rs431825414
NM_007294.3(BRCA1):c.5268_5274del (p.Asp1757fs) rs886038043
NM_007294.3(BRCA1):c.5269_5270insC (p.Asp1757fs) rs1555576840
NM_007294.3(BRCA1):c.5269_5273del (p.Asp1757fs) rs786202040
NM_007294.3(BRCA1):c.5270_5276del (p.Asp1757fs) rs397509248
NM_007294.3(BRCA1):c.5274A>G (p.Arg1758=) rs758739620
NM_007294.3(BRCA1):c.5276del (p.Lys1759fs) rs80357732
NM_007294.3(BRCA1):c.5277+1409G>A rs36113921
NM_007294.3(BRCA1):c.5277+1607G>T rs62076408
NM_007294.3(BRCA1):c.5277+186T>C rs8176284
NM_007294.3(BRCA1):c.5277+1G>A rs80358150
NM_007294.3(BRCA1):c.5277+2029G>C rs371465813
NM_007294.3(BRCA1):c.5277+2217A>G rs8176287
NM_007294.3(BRCA1):c.5277+2307del rs11347376
NM_007294.3(BRCA1):c.5277+2439T>A rs143042094
NM_007294.3(BRCA1):c.5277+2938T>C rs8176288
NM_007294.3(BRCA1):c.5277+315T>C rs183831660
NM_007294.3(BRCA1):c.5277+365del rs201212001
NM_007294.3(BRCA1):c.5277+602T>C rs8176286
NM_007294.3(BRCA1):c.5277+764G>A rs112757145
NM_007294.3(BRCA1):c.5277+853T>G rs116703787
NM_007294.3(BRCA1):c.5277+861G>A rs372544924
NM_007294.3(BRCA1):c.5278-1071G>A rs150614759
NM_007294.3(BRCA1):c.5278-1227C>T rs111563453
NM_007294.3(BRCA1):c.5278-1243T>C rs4793191
NM_007294.3(BRCA1):c.5278-1256A>G rs4793192
NM_007294.3(BRCA1):c.5278-1519A>G rs114112971
NM_007294.3(BRCA1):c.5278-1644A>G rs34685631
NM_007294.3(BRCA1):c.5278-1722C>T rs17671533
NM_007294.3(BRCA1):c.5278-1766A>C rs117151230
NM_007294.3(BRCA1):c.5278-1874G>A rs8176295
NM_007294.3(BRCA1):c.5278-1918G>A rs149958317
NM_007294.3(BRCA1):c.5278-191A>T rs8176297
NM_007294.3(BRCA1):c.5278-2237del rs8176293
NM_007294.3(BRCA1):c.5278-2498G>A rs182249140
NM_007294.3(BRCA1):c.5278-2587C>T rs6503725
NM_007294.3(BRCA1):c.5278-2638C>T rs8176290
NM_007294.3(BRCA1):c.5278-2807T>C rs7212284
NM_007294.3(BRCA1):c.5278-2922A>G rs8176289
NM_007294.3(BRCA1):c.5278-2963G>A rs78695654
NM_007294.3(BRCA1):c.5278-2del rs878853285
NM_007294.3(BRCA1):c.5278-457A>G rs8176296
NM_007294.3(BRCA1):c.5278-464G>A rs545723152
NM_007294.3(BRCA1):c.5278-542G>A rs139210193
NM_007294.3(BRCA1):c.5278-550_5278-547del rs538015792
NM_007294.3(BRCA1):c.5278-573C>T rs143338062
NM_007294.3(BRCA1):c.5278-866G>C rs148509734
NM_007294.3(BRCA1):c.5278-884A>G rs113892722
NM_007294.3(BRCA1):c.5280C>A (p.Ile1760=) rs750040616
NM_007294.3(BRCA1):c.5282del (p.Phe1761fs) rs886040285
NM_007294.3(BRCA1):c.5284del (p.Arg1762fs) rs80357684
NM_007294.3(BRCA1):c.5289del (p.Gly1763_Leu1764insTer) rs80357886
NM_007294.3(BRCA1):c.5289dupG (p.Leu1764Alafs) rs80357886
NM_007294.3(BRCA1):c.528G>A (p.Thr176=) rs34545365
NM_007294.3(BRCA1):c.5291T>C (p.Leu1764Pro) rs80357281
NM_007294.3(BRCA1):c.5293G>T (p.Glu1765Ter) rs397509256
NM_007294.3(BRCA1):c.5297T>G (p.Ile1766Ser) rs80357463
NM_007294.3(BRCA1):c.5299del (p.Cys1767fs) rs886040286
NM_007294.3(BRCA1):c.529del (p.Ser177fs) rs80357758
NM_007294.3(BRCA1):c.5300_5301del (p.Cys1767fs) rs886040287
NM_007294.3(BRCA1):c.5301T>A (p.Cys1767Ter) rs886040288
NM_007294.3(BRCA1):c.5302del (p.Cys1768fs) rs886040289
NM_007294.3(BRCA1):c.5304C>T (p.Cys1768=) rs138493864
NM_007294.3(BRCA1):c.5304del (p.Tyr1769fs) rs80357959
NM_007294.3(BRCA1):c.5307T>A (p.Tyr1769Ter) rs397509258
NM_007294.3(BRCA1):c.5310G>A (p.Gly1770=) rs273901761
NM_007294.3(BRCA1):c.5310G>C (p.Gly1770=) rs273901761
NM_007294.3(BRCA1):c.5310_5311del (p.Pro1771fs) rs587781825
NM_007294.3(BRCA1):c.5310del (p.Phe1772fs) rs80357581
NM_007294.3(BRCA1):c.5310dup (p.Pro1771fs) rs80357581
NM_007294.3(BRCA1):c.5313C>T (p.Pro1771=) rs1131692076
NM_007294.3(BRCA1):c.5315del (p.Phe1772fs) rs397509261
NM_007294.3(BRCA1):c.5319dup (p.Asn1774fs) rs80357823
NM_007294.3(BRCA1):c.531del (p.Val178fs) rs886040290
NM_007294.3(BRCA1):c.531dup (p.Val178fs) rs864622350
NM_007294.3(BRCA1):c.5320_5321del (p.Asn1774fs) rs80357818
NM_007294.3(BRCA1):c.5323_5324del (p.Met1775fs) rs397509262
NM_007294.3(BRCA1):c.5324T>A (p.Met1775Lys) rs41293463
NM_007294.3(BRCA1):c.5324T>G (p.Met1775Arg) rs41293463
NM_007294.3(BRCA1):c.5328C>T (p.Pro1776=) rs759867616
NM_007294.3(BRCA1):c.5328del (p.Thr1777fs) rs80357751
NM_007294.3(BRCA1):c.5328dupC (p.Thr1777Hisfs) rs80357751
NM_007294.3(BRCA1):c.5331_5332+1delinsCAACAT rs878853286
NM_007294.3(BRCA1):c.5332+182_5332+183insA rs201644509
NM_007294.3(BRCA1):c.5332+185A>C rs8176298
NM_007294.3(BRCA1):c.5332+1G>A rs80358041
NM_007294.3(BRCA1):c.5332+392C>T rs8070179
NM_007294.3(BRCA1):c.5332+454del rs35805899
NM_007294.3(BRCA1):c.5332+490T>A rs11079053
NM_007294.3(BRCA1):c.5332+501C>T rs12949768
NM_007294.3(BRCA1):c.5333-153A>G rs8176305
NM_007294.3(BRCA1):c.5333-221C>A rs8176304
NM_007294.3(BRCA1):c.5333-254A>G rs8176303
NM_007294.3(BRCA1):c.5333-304G>A rs55633264
NM_007294.3(BRCA1):c.5333-491G>A rs3092988
NM_007294.3(BRCA1):c.5335C>T (p.Gln1779Ter) rs397509267
NM_007294.3(BRCA1):c.5335del (p.Gln1779fs) rs80357590
NM_007294.3(BRCA1):c.5337A>G (p.Gln1779=) rs876659718
NM_007294.3(BRCA1):c.5338del (p.Leu1780fs) rs886038045
NM_007294.3(BRCA1):c.5340G>A (p.Leu1780=) rs766700840
NM_007294.3(BRCA1):c.5341G>T (p.Glu1781Ter) rs397509268
NM_007294.3(BRCA1):c.5341_5343delinsTG (p.Glu1781fs) rs886040291
NM_007294.3(BRCA1):c.5341del (p.Glu1781fs) rs80357694
NM_007294.3(BRCA1):c.5345G>A (p.Trp1782Ter)