ClinVar Miner

List of variants in gene BRCA1 reported as pathogenic by Color

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 285
Download table as spreadsheet
HGVS dbSNP
NM_007294.3(BRCA1):c.1011dupA (p.Val340Glyfs) rs80357569
NM_007294.3(BRCA1):c.1012A>T (p.Lys338Ter) rs397508826
NM_007294.3(BRCA1):c.1018delG (p.Val340Terfs) rs80357774
NM_007294.3(BRCA1):c.1054G>T (p.Glu352Ter) rs80357472
NM_007294.3(BRCA1):c.1082_1092delCAGAGAATCCT (p.Ser361Terfs) rs80359880
NM_007294.3(BRCA1):c.1102G>T (p.Glu368Ter) rs80357139
NM_007294.3(BRCA1):c.116G>A (p.Cys39Tyr) rs80357498
NM_007294.3(BRCA1):c.1175_1214del40 (p.Leu392Glnfs) rs80359874
NM_007294.3(BRCA1):c.1214C>G (p.Ser405Ter) rs80357481
NM_007294.3(BRCA1):c.1252G>T (p.Glu418Ter) rs80357083
NM_007294.3(BRCA1):c.1287dupA (p.Asp430Argfs) rs80357576
NM_007294.3(BRCA1):c.1297delG (p.Ala433Profs) rs80357794
NM_007294.3(BRCA1):c.131G>T (p.Cys44Phe) rs80357446
NM_007294.3(BRCA1):c.135-1G>T rs80358158
NM_007294.3(BRCA1):c.1354delG (p.Val452Terfs) rs886039946
NM_007294.3(BRCA1):c.1360_1361delAG (p.Ser454Terfs) rs80357969
NM_007294.3(BRCA1):c.1390_1391insG (p.Thr464Serfs) rs397508867
NM_007294.3(BRCA1):c.1416delC (p.Asn473Thrfs) rs1555591774
NM_007294.3(BRCA1):c.143delT (p.Met48Serfs) rs80357637
NM_007294.3(BRCA1):c.1444_1447delATTA (p.Ile482Terfs) rs80357801
NM_007294.3(BRCA1):c.1471C>T (p.Gln491Ter) rs62625303
NM_007294.3(BRCA1):c.1492delC (p.Leu498Serfs) rs80357527
NM_007294.3(BRCA1):c.1504_1507delTTAA (p.Leu502Serfs) rs886039955
NM_007294.3(BRCA1):c.1504_1508delTTAAA (p.Leu502Alafs) rs80357888
NM_007294.3(BRCA1):c.1505_1509delTAAAG (p.Leu502Serfs) rs876659139
NM_007294.3(BRCA1):c.1510delC (p.Arg504Valfs) rs80357908
NM_007294.3(BRCA1):c.1513A>T (p.Lys505Ter) rs397508877
NM_007294.3(BRCA1):c.1521_1531delACCTACATCAG (p.Thr509Serfs) rs1555591596
NM_007294.3(BRCA1):c.1529C>G (p.Ser510Ter) rs80357427
NM_007294.3(BRCA1):c.1556delA (p.Lys519Argfs) rs80357662
NM_007294.3(BRCA1):c.1579_1580delAA (p.Lys527Aspfs) rs431825387
NM_007294.3(BRCA1):c.1601_1602delAG (p.Gln534Argfs) rs878854933
NM_007294.3(BRCA1):c.1612C>T (p.Gln538Ter) rs80356893
NM_007294.3(BRCA1):c.1630C>T (p.Gln544Ter) rs80356952
NM_007294.3(BRCA1):c.1636_1654del19 (p.Met546Valfs) rs80359881
NM_007294.3(BRCA1):c.1673_1674delAA (p.Lys558Argfs) rs80357600
NM_007294.3(BRCA1):c.1674delA (p.Gly559Valfs) rs80357600
NM_007294.3(BRCA1):c.1687C>T (p.Gln563Ter) rs80356898
NM_007294.3(BRCA1):c.1729G>T (p.Glu577Ter) rs397508903
NM_007294.3(BRCA1):c.1765delA (p.Ser589Alafs) rs1555591273
NM_007294.3(BRCA1):c.1812delA (p.Ala605Hisfs) rs80357927
NM_007294.3(BRCA1):c.181T>G (p.Cys61Gly) rs28897672
NM_007294.3(BRCA1):c.1823_1826delAGAA (p.Lys608Ilefs) rs80357585
NM_007294.3(BRCA1):c.182G>A (p.Cys61Tyr) rs80357093
NM_007294.3(BRCA1):c.1860delT (p.His621Metfs) rs730881459
NM_007294.3(BRCA1):c.188T>A (p.Leu63Ter) rs80357086
NM_007294.3(BRCA1):c.190T>C (p.Cys64Arg) rs80357064
NM_007294.3(BRCA1):c.190T>G (p.Cys64Gly) rs80357064
NM_007294.3(BRCA1):c.191G>A (p.Cys64Tyr) rs55851803
NM_007294.3(BRCA1):c.1929_1930delTTinsA (p.Ser643Argfs) rs886039982
NM_007294.3(BRCA1):c.1953_1956delGAAA (p.Lys653Serfs) rs80357526
NM_007294.3(BRCA1):c.1960A>T (p.Lys654Ter) rs80357355
NM_007294.3(BRCA1):c.1961delA (p.Lys654Serfs) rs80357522
NM_007294.3(BRCA1):c.1961dupA (p.Tyr655Valfs) rs80357522
NM_007294.3(BRCA1):c.1999C>T (p.Gln667Ter) rs80356889
NM_007294.3(BRCA1):c.1A>G (p.Met1Val) rs80357287
NM_007294.3(BRCA1):c.2014A>T (p.Lys672Ter) rs397508929
NM_007294.3(BRCA1):c.2019delA (p.Glu673Aspfs) rs80357626
NM_007294.3(BRCA1):c.2035A>T (p.Lys679Ter) rs80357082
NM_007294.3(BRCA1):c.2059C>T (p.Gln687Ter) rs273898674
NM_007294.3(BRCA1):c.2070_2071delAA (p.Arg691Thrfs) rs80357688
NM_007294.3(BRCA1):c.2071delA (p.Arg691Aspfs) rs80357688
NM_007294.3(BRCA1):c.2101A>T (p.Lys701Ter) rs876660282
NM_007294.3(BRCA1):c.2105dupT (p.Leu702Phefs) rs80357880
NM_007294.3(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.3(BRCA1):c.212+1G>A rs80358042
NM_007294.3(BRCA1):c.212+1G>T rs80358042
NM_007294.3(BRCA1):c.212G>C (p.Arg71Thr) rs80356913
NM_007294.3(BRCA1):c.213-11T>G rs80358061
NM_007294.3(BRCA1):c.213-12A>G rs80358163
NM_007294.3(BRCA1):c.2131_2132delAA (p.Lys711Valfs) rs398122653
NM_007294.3(BRCA1):c.2138C>G (p.Ser713Ter) rs80357233
NM_007294.3(BRCA1):c.2156_2163dup (p.Val722Lysfs) rs1555590322
NM_007294.3(BRCA1):c.2199delG (p.Lys734Asnfs) rs80357944
NM_007294.3(BRCA1):c.2215A>T (p.Lys739Ter) rs56329598
NM_007294.3(BRCA1):c.2216_2217delAA (p.Lys739Serfs) rs397508952
NM_007294.3(BRCA1):c.2246_2280delATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACT (p.Asp749Glyfs) rs886037998
NM_007294.3(BRCA1):c.2269delG (p.Val757Phefs) rs80357583
NM_007294.3(BRCA1):c.2293G>T (p.Glu765Ter) rs80357449
NM_007294.3(BRCA1):c.2309C>A (p.Ser770Ter) rs80357063
NM_007294.3(BRCA1):c.2338C>T (p.Gln780Ter) rs80356945
NM_007294.3(BRCA1):c.2359delG (p.Glu787Lysfs) rs80357739
NM_007294.3(BRCA1):c.2389G>T (p.Glu797Ter) rs62625306
NM_007294.3(BRCA1):c.2405_2406delTG (p.Val802Glufs) rs80357706
NM_007294.3(BRCA1):c.2407_2408delAG (p.Gln804Valfs) rs786202919
NM_007294.3(BRCA1):c.2411_2412delAG (p.Gln804Leufs) rs80357664
NM_007294.3(BRCA1):c.2416_2417delGC (p.Ala806Serfs) rs1555589706
NM_007294.3(BRCA1):c.2433delC (p.Lys812Argfs) rs80357524
NM_007294.3(BRCA1):c.2457delC (p.Asp821Ilefs) rs80357669
NM_007294.3(BRCA1):c.2475delC (p.Asp825Glufs) rs80357970
NM_007294.3(BRCA1):c.250G>T (p.Glu84Ter) rs398122661
NM_007294.3(BRCA1):c.2515delC (p.His839Thrfs) rs80357607
NM_007294.3(BRCA1):c.2551G>T (p.Glu851Ter) rs398122662
NM_007294.3(BRCA1):c.2561_2565delCTCAG (p.Ala854Valfs) rs397508981
NM_007294.3(BRCA1):c.2641G>T (p.Glu881Ter) rs397508988
NM_007294.3(BRCA1):c.2679_2682delGAAA (p.Lys893Asnfs) rs80357596
NM_007294.3(BRCA1):c.2681_2682delAA (p.Lys894Thrfs) rs80357971
NM_007294.3(BRCA1):c.2685_2686delAA (p.Pro897Lysfs) rs80357636
NM_007294.3(BRCA1):c.2687_2693delGTCCAAA (p.Ser896Lysfs) rs886040062
NM_007294.3(BRCA1):c.2719_2722delGAAG (p.Glu907Lysfs) rs80357731
NM_007294.3(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.3(BRCA1):c.2728delC (p.Gln910Lysfs) rs397509005
NM_007294.3(BRCA1):c.2761C>T (p.Gln921Ter) rs80357377
NM_007294.3(BRCA1):c.2764_2767delACAG (p.Thr922Leufs) rs80357822
NM_007294.3(BRCA1):c.2766delA (p.Val923Leufs) rs80357812
NM_007294.3(BRCA1):c.2800C>T (p.Gln934Ter) rs80357223
NM_007294.3(BRCA1):c.2806_2809delGATA (p.Asp936Serfs) rs80357832
NM_007294.3(BRCA1):c.2834_2836delGTAinsC (p.Ser945Thrfs) rs386134270
NM_007294.3(BRCA1):c.2835dupT (p.Ile946Tyrfs) rs80357519
NM_007294.3(BRCA1):c.2864C>A (p.Ser955Ter) rs80357295
NM_007294.3(BRCA1):c.2866_2870delTCTCA (p.Ser956Valfs) rs80357819
NM_007294.3(BRCA1):c.288_292delCACAGinsAACCTGT (p.Asp96Glufs) rs483353091
NM_007294.3(BRCA1):c.2915delG (p.Gly972Aspfs) rs80357573
NM_007294.3(BRCA1):c.2934T>G (p.Tyr978Ter) rs80357115
NM_007294.3(BRCA1):c.2940delA (p.Pro981Hisfs) rs80357876
NM_007294.3(BRCA1):c.2989_2990dupAA (p.Asn997Lysfs) rs80357829
NM_007294.3(BRCA1):c.2T>G (p.Met1Arg) rs80357111
NM_007294.3(BRCA1):c.3005delA (p.Asn1002Thrfs) rs80357601
NM_007294.3(BRCA1):c.3013delG (p.Glu1005Asnfs) rs80357937
NM_007294.3(BRCA1):c.3018_3021delTTCA (p.His1006Glnfs) rs80357749
NM_007294.3(BRCA1):c.3048_3052dupTGAGA (p.Asn1018Metfs) rs80357856
NM_007294.3(BRCA1):c.3049G>T (p.Glu1017Ter) rs80357004
NM_007294.3(BRCA1):c.3178G>T (p.Glu1060Ter) rs80357424
NM_007294.3(BRCA1):c.3193dupG (p.Asp1065Glyfs) rs80357511
NM_007294.3(BRCA1):c.321delT (p.Phe107Leufs) rs80357544
NM_007294.3(BRCA1):c.3228_3229delAG (p.Gly1077Alafs) rs80357635
NM_007294.3(BRCA1):c.3253A>T (p.Arg1085Ter) rs1432504119
NM_007294.3(BRCA1):c.3254_3255dupGA (p.Leu1086Aspfs) rs80357624
NM_007294.3(BRCA1):c.3257T>G (p.Leu1086Ter) rs80357006
NM_007294.3(BRCA1):c.3285delA (p.Lys1095Asnfs) rs397509051
NM_007294.3(BRCA1):c.3326_3329delAAAA (p.Lys1109Serfs) rs80357575
NM_007294.3(BRCA1):c.3329delA (p.Lys1110Serfs) rs80357575
NM_007294.3(BRCA1):c.3331_3334delCAAG (p.Gln1111Asnfs) rs80357701
NM_007294.3(BRCA1):c.3333delA (p.Glu1112Asnfs) rs80357966
NM_007294.3(BRCA1):c.3342_3345delAGAA (p.Glu1115Terfs) rs397509058
NM_007294.3(BRCA1):c.3358_3359delGT (p.Val1120Terfs) rs80357945
NM_007294.3(BRCA1):c.3400G>T (p.Glu1134Ter) rs80357018
NM_007294.3(BRCA1):c.3403C>T (p.Gln1135Ter) rs80357136
NM_007294.3(BRCA1):c.342delT (p.Pro115Leufs) rs886040129
NM_007294.3(BRCA1):c.3436_3439delTGTT (p.Cys1146Leufs) rs397509067
NM_007294.3(BRCA1):c.3481_3491delGAAGATACTAG (p.Glu1161Phefs) rs80357877
NM_007294.3(BRCA1):c.3485delA (p.Asp1162Valfs) rs80357509
NM_007294.3(BRCA1):c.3514G>T (p.Glu1172Ter) rs397509079
NM_007294.3(BRCA1):c.3598C>T (p.Gln1200Ter) rs62625307
NM_007294.3(BRCA1):c.3599_3600delAG (p.Gln1200Argfs) rs398122674
NM_007294.3(BRCA1):c.3607C>T (p.Arg1203Ter) rs62625308
NM_007294.3(BRCA1):c.3624dupA (p.Leu1209Ilefs) rs80357512
NM_007294.3(BRCA1):c.3627dupA (p.Glu1210Argfs) rs80357729
NM_007294.3(BRCA1):c.3629_3630delAG (p.Glu1210Valfs) rs80357589
NM_007294.3(BRCA1):c.3640G>T (p.Glu1214Ter) rs80356923
NM_007294.3(BRCA1):c.3648dupA (p.Ser1217Ilefs) rs80357902
NM_007294.3(BRCA1):c.3664G>T (p.Glu1222Ter) rs80357356
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.3672delC (p.Cys1225Alafs) rs398122677
NM_007294.3(BRCA1):c.3675C>A (p.Cys1225Ter) rs879254023
NM_007294.3(BRCA1):c.3689T>G (p.Leu1230Ter) rs80357162
NM_007294.3(BRCA1):c.3700_3704delGTAAA (p.Val1234Glnfs) rs80357609
NM_007294.3(BRCA1):c.3710delT (p.Ile1237Asnfs) rs80357564
NM_007294.3(BRCA1):c.3748G>T (p.Glu1250Ter) rs28897686
NM_007294.3(BRCA1):c.3756_3759delGTCT (p.Ser1253Argfs) rs80357868
NM_007294.3(BRCA1):c.3759_3760delTA (p.Lys1254Glufs) rs80357520
NM_007294.3(BRCA1):c.3759dupT (p.Lys1254Terfs) rs80357687
NM_007294.3(BRCA1):c.3764dupA (p.Asn1255Lysfs) rs80357848
NM_007294.3(BRCA1):c.376C>T (p.Gln126Ter) rs1085307902
NM_007294.3(BRCA1):c.3770_3771delAG (p.Glu1257Glyfs) rs80357579
NM_007294.3(BRCA1):c.3858_3861delTGAG (p.Ser1286Argfs) rs80357842
NM_007294.3(BRCA1):c.3893C>A (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3904G>T (p.Glu1302Ter) rs80357461
NM_007294.3(BRCA1):c.3937C>T (p.Gln1313Ter) rs80357318
NM_007294.3(BRCA1):c.3G>A (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.4035delA (p.Glu1346Lysfs) rs80357711
NM_007294.3(BRCA1):c.4039A>T (p.Arg1347Ter) rs28897689
NM_007294.3(BRCA1):c.4065_4068delTCAA (p.Asn1355Lysfs) rs80357508
NM_007294.3(BRCA1):c.4113delG (p.Cys1372Valfs) rs80357861
NM_007294.3(BRCA1):c.4117G>T (p.Glu1373Ter) rs80357259
NM_007294.3(BRCA1):c.4120_4121delAG (p.Ser1374Terfs) rs80357787
NM_007294.3(BRCA1):c.4158_4162delCTCTC (p.Ser1387Glufs) rs397509142
NM_007294.3(BRCA1):c.415del (p.Gln139Argfs) rs1555596315
NM_007294.3(BRCA1):c.4183C>T (p.Gln1395Ter) rs80357260
NM_007294.3(BRCA1):c.4201C>T (p.Gln1401Ter) rs397509151
NM_007294.3(BRCA1):c.4222C>T (p.Gln1408Ter) rs80356989
NM_007294.3(BRCA1):c.4251_4252delGT (p.Leu1418Argfs) rs80357977
NM_007294.3(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.3(BRCA1):c.4282delA (p.Ser1428Alafs) rs1555584125
NM_007294.3(BRCA1):c.4300dupA (p.Ser1434Lysfs) rs80357790
NM_007294.3(BRCA1):c.4327C>T (p.Arg1443Ter) rs41293455
NM_007294.3(BRCA1):c.4339C>T (p.Gln1447Ter) rs80357067
NM_007294.3(BRCA1):c.4357+1G>A rs80358027
NM_007294.3(BRCA1):c.4357+1G>T rs80358027
NM_007294.3(BRCA1):c.4372C>T (p.Gln1458Ter) rs80356932
NM_007294.3(BRCA1):c.4389C>A (p.Tyr1463Ter) rs80356997
NM_007294.3(BRCA1):c.4391_4393delCTAinsTT (p.Pro1464Leufs) rs273900730
NM_007294.3(BRCA1):c.4392delT (p.Ile1465Terfs) rs1064793577
NM_007294.3(BRCA1):c.4482_4483delAA (p.Arg1495Valfs) rs80357854
NM_007294.3(BRCA1):c.4484G>A (p.Arg1495Lys) rs80357389
NM_007294.3(BRCA1):c.4484G>C (p.Arg1495Thr) rs80357389
NM_007294.3(BRCA1):c.4484G>T (p.Arg1495Met) rs80357389
NM_007294.3(BRCA1):c.4516delG (p.Asp1506Ilefs) rs273900736
NM_007294.3(BRCA1):c.4523G>A (p.Trp1508Ter) rs786202631
NM_007294.3(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.3(BRCA1):c.4675+1G>A rs80358044
NM_007294.3(BRCA1):c.4678G>T (p.Gly1560Ter) rs80357349
NM_007294.3(BRCA1):c.4688_4694delACCTGGAinsG (p.Tyr1563_Tyr1863del) rs1555581087
NM_007294.3(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.3(BRCA1):c.470_471delCT (p.Ser157Terfs) rs80357887
NM_007294.3(BRCA1):c.4736_4739delCTTC (p.Pro1579Leufs) rs1555581017
NM_007294.3(BRCA1):c.4754_4755delCA (p.Pro1585Argfs) rs80357837
NM_007294.3(BRCA1):c.4834C>T (p.Gln1612Ter) rs786202064
NM_007294.3(BRCA1):c.4936delG (p.Val1646Serfs) rs80357653
NM_007294.3(BRCA1):c.4945delA (p.Arg1649Glufs) rs80357655
NM_007294.3(BRCA1):c.4964_4982del19 (p.Ser1655Tyrfs) rs80359876
NM_007294.3(BRCA1):c.4976del (p.Pro1659Glnfs) rs879255295
NM_007294.3(BRCA1):c.4986+6T>C rs80358086
NM_007294.3(BRCA1):c.4986+6T>G rs80358086
NM_007294.3(BRCA1):c.4986dup (p.Met1663Tyrfs) rs1555580601
NM_007294.3(BRCA1):c.4999A>T (p.Lys1667Ter) rs80357204
NM_007294.3(BRCA1):c.5030_5033delCTAA (p.Thr1677Ilefs) rs80357580
NM_007294.3(BRCA1):c.5035_5039delCTAAT (p.Leu1679Tyrfs) rs80357623
NM_007294.3(BRCA1):c.5035delC (p.Leu1679Terfs) rs80357896
NM_007294.3(BRCA1):c.505C>T (p.Gln169Ter) rs80357133
NM_007294.3(BRCA1):c.5062_5064delGTT (p.Val1688del) rs80358344
NM_007294.3(BRCA1):c.5074+1G>A rs80358053
NM_007294.3(BRCA1):c.5074+1G>T rs80358053
NM_007294.3(BRCA1):c.5074G>A (p.Asp1692Asn) rs80187739
NM_007294.3(BRCA1):c.5080G>T (p.Glu1694Ter) rs80356896
NM_007294.3(BRCA1):c.5109T>G (p.Tyr1703Ter) rs80356974
NM_007294.3(BRCA1):c.5123C>A (p.Ala1708Glu) rs28897696
NM_007294.3(BRCA1):c.5135G>A (p.Trp1712Ter) rs876658672
NM_007294.3(BRCA1):c.5136G>A (p.Trp1712Ter) rs80357418
NM_007294.3(BRCA1):c.5137delG (p.Val1713Terfs) rs80357997
NM_007294.3(BRCA1):c.514delC (p.Gln172Asnfs) rs80357872
NM_007294.3(BRCA1):c.5152+1G>T rs80358094
NM_007294.3(BRCA1):c.5153-2delA rs273901746
NM_007294.3(BRCA1):c.5153G>A (p.Trp1718Ter) rs41293461
NM_007294.3(BRCA1):c.5154G>A (p.Trp1718Ter) rs80357239
NM_007294.3(BRCA1):c.5193+2delT rs273901751
NM_007294.3(BRCA1):c.5212G>A (p.Gly1738Arg) rs80356937
NM_007294.3(BRCA1):c.5239C>T (p.Gln1747Ter) rs80357367
NM_007294.3(BRCA1):c.5239delC (p.Gln1747Lysfs) rs886040282
NM_007294.3(BRCA1):c.5251C>T (p.Arg1751Ter) rs80357123
NM_007294.3(BRCA1):c.5266C>T (p.Gln1756Ter) rs397509247
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs397507247
NM_007294.3(BRCA1):c.5277+1G>A rs80358150
NM_007294.3(BRCA1):c.5278-1G>A rs80358099
NM_007294.3(BRCA1):c.5293G>T (p.Glu1765Ter) rs397509256
NM_007294.3(BRCA1):c.5297T>G (p.Ile1766Ser) rs80357463
NM_007294.3(BRCA1):c.5320_5321delAA (p.Asn1774Hisfs) rs80357818
NM_007294.3(BRCA1):c.5324T>G (p.Met1775Arg) rs41293463
NM_007294.3(BRCA1):c.5332+1G>A rs80358041
NM_007294.3(BRCA1):c.5346G>A (p.Trp1782Ter) rs80357284
NM_007294.3(BRCA1):c.5353C>T (p.Gln1785Ter) rs80356969
NM_007294.3(BRCA1):c.5390C>A (p.Ser1797Ter) rs879255492
NM_007294.3(BRCA1):c.5453A>G (p.Asp1818Gly) rs80357477
NM_007294.3(BRCA1):c.5463_5464insT (p.His1822Serfs) rs1057518636
NM_007294.3(BRCA1):c.5467+1G>A rs80358145
NM_007294.3(BRCA1):c.547+2T>A rs80358047
NM_007294.3(BRCA1):c.5496_5506delGGTGACCCGAGinsA (p.Val1833Serfs) rs273902775
NM_007294.3(BRCA1):c.5503C>T (p.Arg1835Ter) rs41293465
NM_007294.3(BRCA1):c.5558dupA (p.Tyr1853Terfs) rs80357629
NM_007294.3(BRCA1):c.624_625insAGGGATGAAATCAGGAACCA (p.Pro209Argfs)
NM_007294.3(BRCA1):c.66dupA (p.Glu23Argfs) rs80357783
NM_007294.3(BRCA1):c.676delT (p.Cys226Valfs) rs80357941
NM_007294.3(BRCA1):c.688G>T (p.Glu230Ter) rs1555593310
NM_007294.3(BRCA1):c.68_69delAG (p.Glu23Valfs) rs386833395
NM_007294.3(BRCA1):c.697_698delGT (p.Val233Asnfs) rs80357747
NM_007294.3(BRCA1):c.697delG (p.Val233Terfs) rs1555593298
NM_007294.3(BRCA1):c.70_80delTGTCCCATCTG (p.Cys24Serfs) rs80357696
NM_007294.3(BRCA1):c.791_794delGTTC (p.Ser264Metfs) rs80357707
NM_007294.3(BRCA1):c.815_824dupAGCCATGTGG (p.Thr276Alafs) rs387906563
NM_007294.3(BRCA1):c.843_846delCTCA (p.Ser282Tyrfs) rs80357919
NM_007294.3(BRCA1):c.882delA (p.Asp295Thrfs) rs80357587
NM_007294.3(BRCA1):c.895_896delGT (p.Val299Argfs) rs80357670
NM_007294.3(BRCA1):c.904delG (p.Ala302Leufs) rs273903793
NM_007294.3(BRCA1):c.923delG (p.Ser308Thrfs) rs80357953
NM_007294.3(BRCA1):c.962G>A (p.Trp321Ter) rs80357292
NM_007294.3(BRCA1):c.981_982delAT (p.Cys328Terfs) rs80357772
NM_007294.3:c.105dup
NM_007294.3:c.1209del
NM_007294.3:c.1901_1910del
NM_007294.3:c.2149_2152del
NM_007294.3:c.2740_2750delGAGTCTAATAT
NM_007294.3:c.3665del
NM_007294.3:c.4165delA
NM_007294.3:c.4414delC
NM_007299.3(BRCA1):c.787+11_787+12delTT rs80357724

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.