ClinVar Miner

List of variants in gene BRCA2 reported as pathogenic for Hereditary breast and ovarian cancer syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1225
Download table as spreadsheet
HGVS dbSNP
NC_000013.10:g.(?_32890559)_(32893462_?)del
NC_000013.10:g.(?_32890559)_(32929425_?)del
NC_000013.10:g.(?_32890592)_(32899327_?)del
NC_000013.10:g.(?_32890592)_(32900425_?)del
NC_000013.10:g.(?_32890592)_(32932072_?)del
NC_000013.10:g.(?_32893194)_(32893482_?)del
NC_000013.10:g.(?_32893214)_(32893462_?)del
NC_000013.10:g.(?_32899193)_(32899341_?)del
NC_000013.10:g.(?_32899193)_(32937690_?)del
NC_000013.10:g.(?_32899207)_(32899327_?)del
NC_000013.10:g.(?_32899736)_(32913272_?)dup
NC_000013.10:g.(?_32900218)_(32900770_?)del
NC_000013.10:g.(?_32900232)_(32937676_?)del
NC_000013.10:g.(?_32903574)_(32915339_?)del
NC_000013.10:g.(?_32905036)_(32954302_?)del
NC_000013.10:g.(?_32905050)_(32905173_?)del
NC_000013.10:g.(?_32913706)_(32934992_?)dup
NC_000013.10:g.(?_32914029)_(32917012_?)del
NC_000013.10:g.(?_32920944)_(32921053_?)del
NC_000013.10:g.(?_32920958)_(32921039_?)del
NC_000013.10:g.(?_32930545)_(32930766_?)del
NC_000013.10:g.(?_32930559)_(32930752_?)del
NC_000013.10:g.(?_32944519)_(32945257_?)del
NC_000013.10:g.(?_32950787)_(32950948_?)del
NC_000013.10:g.(?_32950801)_(32950934_?)del
NC_000013.10:g.(?_32953448)_(32954288_?)del
NC_000013.10:g.(?_32967023)_(32968862_?)del
NM_000059.3(BRCA2):c.(?_-1)_67+?del
NM_000059.3(BRCA2):c.-39-?_67+?del
NM_000059.3(BRCA2):c.-39-?_793+?del
NM_000059.3(BRCA2):c.100G>T (p.Glu34Ter) rs80358391
NM_000059.3(BRCA2):c.1029del (p.Lys343fs) rs80359260
NM_000059.3(BRCA2):c.1054dup (p.Tyr352fs) rs80359261
NM_000059.3(BRCA2):c.1103C>A (p.Ser368Ter) rs80358407
NM_000059.3(BRCA2):c.1103C>G (p.Ser368Ter) rs80358407
NM_000059.3(BRCA2):c.1117C>T (p.Gln373Ter) rs397507572
NM_000059.3(BRCA2):c.1138del (p.Ser380fs) rs80359264
NM_000059.3(BRCA2):c.1147del (p.Ile383fs) rs80359265
NM_000059.3(BRCA2):c.1156del (p.Glu386fs) rs397507262
NM_000059.3(BRCA2):c.115del (p.Ala39fs) rs397507573
NM_000059.3(BRCA2):c.1184G>A (p.Trp395Ter) rs886040347
NM_000059.3(BRCA2):c.1189C>T (p.Gln397Ter) rs760815829
NM_000059.3(BRCA2):c.1189_1190insTTAG (p.Gln397fs) rs397515635
NM_000059.3(BRCA2):c.1190_1191insTTAG (p.Gln397delinsHisTer) rs80359266
NM_000059.3(BRCA2):c.1192del (p.Gln397_Leu398insTer) rs1060502403
NM_000059.3(BRCA2):c.1202C>A (p.Ser401Ter) rs80358413
NM_000059.3(BRCA2):c.1205del (p.Gly402fs) rs397507265
NM_000059.3(BRCA2):c.1219C>T (p.Gln407Ter) rs781079248
NM_000059.3(BRCA2):c.1225del (p.Glu409fs) rs80359268
NM_000059.3(BRCA2):c.1238del (p.Leu413fs) rs80359271
NM_000059.3(BRCA2):c.1257del (p.Cys419fs) rs80359272
NM_000059.3(BRCA2):c.1261C>T (p.Gln421Ter) rs80358419
NM_000059.3(BRCA2):c.1265del (p.Asn422fs) rs80359273
NM_000059.3(BRCA2):c.1278del (p.Asp427fs) rs80359274
NM_000059.3(BRCA2):c.1294_1295GA[1] (p.Asn433fs) rs80359276
NM_000059.3(BRCA2):c.1302_1305AAGA[2] (p.Lys437fs) rs80359277
NM_000059.3(BRCA2):c.1308_1309del (p.Lys437fs) rs786201950
NM_000059.3(BRCA2):c.1316_1317dup (p.Leu440fs) rs886040359
NM_000059.3(BRCA2):c.1318_1319insCT (p.Leu440fs) rs1135401891
NM_000059.3(BRCA2):c.1327G>T (p.Glu443Ter) rs397507579
NM_000059.3(BRCA2):c.1332_1333del (p.Ser445fs) rs1135401892
NM_000059.3(BRCA2):c.1333dup (p.Ser445fs) rs1555281841
NM_000059.3(BRCA2):c.1342del (p.Arg448fs) rs1555281849
NM_000059.3(BRCA2):c.1362del (p.Lys454fs) rs80359282
NM_000059.3(BRCA2):c.1376T>G (p.Leu459Ter) rs587781799
NM_000059.3(BRCA2):c.1381G>T (p.Glu461Ter) rs587782159
NM_000059.3(BRCA2):c.1384G>T (p.Glu462Ter)
NM_000059.3(BRCA2):c.1387del (p.Thr463fs) rs1566223465
NM_000059.3(BRCA2):c.1389_1390del (p.Val464fs) rs80359283
NM_000059.3(BRCA2):c.1399_1402del (p.Lys467fs) rs398122726
NM_000059.3(BRCA2):c.1402A>T (p.Arg468Ter) rs1555281894
NM_000059.3(BRCA2):c.1408dup (p.Glu470fs) rs80359284
NM_000059.3(BRCA2):c.1411G>T (p.Glu471Ter) rs80358428
NM_000059.3(BRCA2):c.1414C>T (p.Gln472Ter) rs80358429
NM_000059.3(BRCA2):c.1447dup (p.Ala483fs) rs587782611
NM_000059.3(BRCA2):c.1448_1451dup (p.Lys485fs) rs886040366
NM_000059.3(BRCA2):c.144del (p.Glu49fs) rs864622434
NM_000059.3(BRCA2):c.1456C>T (p.Gln486Ter) rs80358434
NM_000059.3(BRCA2):c.145G>T (p.Glu49Ter) rs80358435
NM_000059.3(BRCA2):c.1490C>G (p.Ser497Ter) rs1064794018
NM_000059.3(BRCA2):c.1499del (p.Gly500fs) rs397507591
NM_000059.3(BRCA2):c.1511_1512del (p.Ser504fs) rs80359286
NM_000059.3(BRCA2):c.1511del (p.Ser504fs) rs1566223748
NM_000059.3(BRCA2):c.1539del (p.Glu514fs)
NM_000059.3(BRCA2):c.1550del (p.Asn517fs)
NM_000059.3(BRCA2):c.1560_1561del (p.Ser521fs) rs886040374
NM_000059.3(BRCA2):c.1568_1569AT[1] (p.Met524fs) rs863224824
NM_000059.3(BRCA2):c.1572_1573insCC (p.Thr525fs) rs1555281956
NM_000059.3(BRCA2):c.1585_1586insA (p.Phe529fs) rs1135401893
NM_000059.3(BRCA2):c.161dup (p.Asn54fs) rs878853297
NM_000059.3(BRCA2):c.1642C>T (p.Gln548Ter) rs398122729
NM_000059.3(BRCA2):c.1654del (p.Ser552fs) rs80359297
NM_000059.3(BRCA2):c.1658T>G (p.Leu553Ter) rs876659627
NM_000059.3(BRCA2):c.1668_1671delinsATT (p.Asn556fs) rs483353110
NM_000059.3(BRCA2):c.1670T>G (p.Leu557Ter) rs80358452
NM_000059.3(BRCA2):c.1673_1677del (p.Ile558fs) rs1555282011
NM_000059.3(BRCA2):c.1689G>A (p.Trp563Ter) rs80358456
NM_000059.3(BRCA2):c.170dupA (p.Tyr57Terfs) rs80359299
NM_000059.3(BRCA2):c.1711_1715del (p.Val572fs) rs397507602
NM_000059.3(BRCA2):c.1736T>G (p.Leu579Ter) rs1131692274
NM_000059.3(BRCA2):c.1748T>A (p.Leu583Ter) rs397507604
NM_000059.3(BRCA2):c.1754del (p.Lys585fs) rs80359301
NM_000059.3(BRCA2):c.1754dup (p.Lys586fs) rs80359301
NM_000059.3(BRCA2):c.1755_1759del (p.Lys585fs) rs80359302
NM_000059.3(BRCA2):c.1756A>T (p.Lys586Ter) rs397507275
NM_000059.3(BRCA2):c.1762_1766del (p.Asn588fs) rs80359303
NM_000059.3(BRCA2):c.1763_1766del (p.Asn588fs) rs80359303
NM_000059.3(BRCA2):c.1769_1772TTAT[1] (p.Ile591fs) rs80359304
NM_000059.3(BRCA2):c.1774del (p.Tyr592fs) rs1566224293
NM_000059.3(BRCA2):c.1785_1803del (p.His595fs) rs1555282073
NM_000059.3(BRCA2):c.1786_1795del (p.Asp596fs)
NM_000059.3(BRCA2):c.1792dup (p.Thr598fs) rs886040389
NM_000059.3(BRCA2):c.1796_1800del (p.Thr598_Ser599insTer) rs276174813
NM_000059.3(BRCA2):c.1797_1801del (p.Tyr600fs) rs397507607
NM_000059.3(BRCA2):c.1798_1799TA[1] (p.Tyr600_Lys601delinsTer) rs1135401894
NM_000059.3(BRCA2):c.1800T>A (p.Tyr600Ter) rs80358464
NM_000059.3(BRCA2):c.1800T>G (p.Tyr600Ter) rs80358464
NM_000059.3(BRCA2):c.1813del (p.Ile605fs) rs80359306
NM_000059.3(BRCA2):c.1813dupA (p.Ile605Asnfs) rs80359306
NM_000059.3(BRCA2):c.1815dupA (p.Pro606Thrfs) rs80359310
NM_000059.3(BRCA2):c.1817_1819delinsTTT (p.Pro606_Lys607delinsLeuTer) rs587779358
NM_000059.3(BRCA2):c.1819A>T (p.Lys607Ter) rs80358471
NM_000059.3(BRCA2):c.1832C>A (p.Ser611Ter) rs80358474
NM_000059.3(BRCA2):c.1832C>G (p.Ser611Ter) rs80358474
NM_000059.3(BRCA2):c.1842dupT (p.Asn615Terfs) rs80359312
NM_000059.3(BRCA2):c.1845_1846del (p.Asn615fs) rs886040393
NM_000059.3(BRCA2):c.1854delinsAA (p.Gln619fs) rs276174815
NM_000059.3(BRCA2):c.1855C>T (p.Gln619Ter) rs80358476
NM_000059.3(BRCA2):c.1887_1893del (p.Thr630fs) rs1555282146
NM_000059.3(BRCA2):c.1888_1889insAA (p.Thr630fs) rs80359314
NM_000059.3(BRCA2):c.1888dupA (p.Thr630Asnfs) rs80359314
NM_000059.3(BRCA2):c.1889_1890delinsGGG (p.Thr630fs) rs1555282150
NM_000059.3(BRCA2):c.1889_1890dup (p.Phe631fs) rs1555282148
NM_000059.3(BRCA2):c.1889del (p.Thr630fs) rs80359315
NM_000059.3(BRCA2):c.18_19AG[1] (p.Glu7fs) rs397507623
NM_000059.3(BRCA2):c.18_19AG[2] (p.Arg8fs) rs397507623
NM_000059.3(BRCA2):c.1907C>G (p.Ser636Ter) rs431825288
NM_000059.3(BRCA2):c.1909+1G>A rs587781629
NM_000059.3(BRCA2):c.1925del (p.Ser642fs) rs1566225794
NM_000059.3(BRCA2):c.1929del (p.Arg645fs) rs80359316
NM_000059.3(BRCA2):c.1940_1943delinsTTTA (p.Cys647_Ser648delinsPheTer) rs1555282370
NM_000059.3(BRCA2):c.1943del (p.Ser648fs) rs876658660
NM_000059.3(BRCA2):c.1945C>T (p.Gln649Ter) rs398122735
NM_000059.3(BRCA2):c.194del (p.Pro65fs)
NM_000059.3(BRCA2):c.1958_1964delinsTG (p.Glu653fs)
NM_000059.3(BRCA2):c.1970T>A (p.Leu657Ter) rs397507279
NM_000059.3(BRCA2):c.1982del (p.Ser661fs) rs1060502455
NM_000059.3(BRCA2):c.1A>G (p.Met1Val) rs863224464
NM_000059.3(BRCA2):c.1del (p.Met1fs) rs761283611
NM_000059.3(BRCA2):c.203_218del (p.Lys68fs) rs1064792960
NM_000059.3(BRCA2):c.2045_2046TC[1] (p.Ser683fs) rs80359319
NM_000059.3(BRCA2):c.2059_2063del (p.Leu686_Asp687insTer) rs587782780
NM_000059.3(BRCA2):c.2092del (p.Leu698fs) rs80359322
NM_000059.3(BRCA2):c.2095C>T (p.Gln699Ter) rs878853559
NM_000059.3(BRCA2):c.2095_2096del (p.Gln699fs) rs886040403
NM_000059.3(BRCA2):c.2098_2117delinsGCA (p.Leu700fs) rs1555282448
NM_000059.3(BRCA2):c.2099_2102TATT[1] (p.Phe701fs) rs80359324
NM_000059.3(BRCA2):c.2133C>A (p.Cys711Ter) rs535547513
NM_000059.3(BRCA2):c.2147del (p.Gln716fs) rs1555282477
NM_000059.3(BRCA2):c.2149_2150TG[1] (p.Cys717_Glu718delinsTer) rs878853560
NM_000059.3(BRCA2):c.2175dup (p.Val726fs) rs276174819
NM_000059.3(BRCA2):c.2205del (p.Ala736fs)
NM_000059.3(BRCA2):c.2214T>A (p.Cys738Ter) rs398122742
NM_000059.3(BRCA2):c.2224C>T (p.Gln742Ter) rs80358494
NM_000059.3(BRCA2):c.2235del (p.Val746fs) rs1060502484
NM_000059.3(BRCA2):c.2239G>T (p.Glu747Ter) rs878853561
NM_000059.3(BRCA2):c.2251dup (p.Thr751fs) rs886040416
NM_000059.3(BRCA2):c.2254_2257del (p.Asp752fs) rs80359326
NM_000059.3(BRCA2):c.2271_2272del (p.Leu759fs) rs886040420
NM_000059.3(BRCA2):c.2280_2281AT[1] (p.Leu760_Tyr761insTer) rs1555282597
NM_000059.3(BRCA2):c.2287del (p.His763fs) rs80359327
NM_000059.3(BRCA2):c.2312T>G (p.Leu771Ter) rs587782095
NM_000059.3(BRCA2):c.2330dup (p.Asp777fs) rs80359328
NM_000059.3(BRCA2):c.2339C>G (p.Ser780Ter) rs587781471
NM_000059.3(BRCA2):c.2368G>T (p.Glu790Ter) rs398122746
NM_000059.3(BRCA2):c.2376C>A (p.Tyr792Ter) rs80358503
NM_000059.3(BRCA2):c.2376C>G (p.Tyr792Ter) rs80358503
NM_000059.3(BRCA2):c.2380dup (p.Met794fs) rs730881602
NM_000059.3(BRCA2):c.2400_2401del (p.Asn801fs) rs1566226658
NM_000059.3(BRCA2):c.2409T>G (p.Tyr803Ter) rs80358504
NM_000059.3(BRCA2):c.2426T>G (p.Leu809Ter) rs397507285
NM_000059.3(BRCA2):c.2442del (p.Met815fs) rs397507627
NM_000059.3(BRCA2):c.244A>T (p.Lys82Ter) rs397507628
NM_000059.3(BRCA2):c.246del (p.Glu83fs) rs397507630
NM_000059.3(BRCA2):c.2471T>G (p.Leu824Ter) rs397507631
NM_000059.3(BRCA2):c.2471del (p.Ala823_Leu824insTer) rs886040427
NM_000059.3(BRCA2):c.2474del (p.Asn825fs) rs1060502437
NM_000059.3(BRCA2):c.2480dup (p.Asn827fs) rs397507286
NM_000059.3(BRCA2):c.2490_2491insT (p.Val831fs) rs886040430
NM_000059.3(BRCA2):c.250C>T (p.Gln84Ter) rs80358515
NM_000059.3(BRCA2):c.2512A>T (p.Lys838Ter)
NM_000059.3(BRCA2):c.2562_2563CA[1] (p.Thr855fs) rs80359334
NM_000059.3(BRCA2):c.2570dup (p.Arg858fs) rs587782361
NM_000059.3(BRCA2):c.2586_2592del (p.Asn863fs) rs80359336
NM_000059.3(BRCA2):c.2588dupA (p.Asn863Lysfs) rs80359335
NM_000059.3(BRCA2):c.2590C>T (p.Gln864Ter) rs1060502414
NM_000059.3(BRCA2):c.2595del (p.Glu866fs) rs483353111
NM_000059.3(BRCA2):c.2606C>G (p.Ser869Ter) rs80358523
NM_000059.3(BRCA2):c.260_261CT[1] (p.Leu88fs) rs276174825
NM_000059.3(BRCA2):c.2612C>A (p.Ser871Ter) rs397507634
NM_000059.3(BRCA2):c.2618dup (p.Thr874fs) rs398122749
NM_000059.3(BRCA2):c.2621_2622insG (p.Val875fs) rs1555282757
NM_000059.3(BRCA2):c.2623_2624del (p.Val875fs) rs876658928
NM_000059.3(BRCA2):c.2644del (p.Leu882fs) rs1555282764
NM_000059.3(BRCA2):c.2653_2656del (p.Asp885fs) rs80359340
NM_000059.3(BRCA2):c.2657del (p.Asn886fs) rs886040439
NM_000059.3(BRCA2):c.2677C>T (p.Gln893Ter) rs1555282790
NM_000059.3(BRCA2):c.2677del (p.Gln893fs) rs879254111
NM_000059.3(BRCA2):c.2692_2696del (p.Glu897_Arg898insTer) rs398122752
NM_000059.3(BRCA2):c.26del (p.Pro9fs) rs80359343
NM_000059.3(BRCA2):c.2701del (p.Ala902fs) rs397507637
NM_000059.3(BRCA2):c.2716dup (p.Thr906fs) rs876659767
NM_000059.3(BRCA2):c.2731del (p.Glu911fs) rs80359344
NM_000059.3(BRCA2):c.2738_2742ACTTG[1] (p.Thr915fs) rs786204752
NM_000059.3(BRCA2):c.274C>T (p.Gln92Ter) rs80358529
NM_000059.3(BRCA2):c.274del (p.Gln92fs) rs1555280425
NM_000059.3(BRCA2):c.2786del (p.Leu929fs) rs80359347
NM_000059.3(BRCA2):c.2786dupT (p.Leu929Phefs) rs80359347
NM_000059.3(BRCA2):c.2808_2811del (p.Ala938Profs) rs80359351
NM_000059.3(BRCA2):c.2808del (p.Lys936fs) rs398122753
NM_000059.3(BRCA2):c.2812_2815del (p.Ala938fs) rs80359354
NM_000059.3(BRCA2):c.2818C>T (p.Gln940Ter) rs80358532
NM_000059.3(BRCA2):c.2830A>T (p.Lys944Ter) rs80358533
NM_000059.3(BRCA2):c.2833_2834insTT (p.Lys945fs) rs80359355
NM_000059.3(BRCA2):c.2834_2835del (p.Lys945fs) rs80359356
NM_000059.3(BRCA2):c.2836_2837del (p.Asp946fs) rs80359357
NM_000059.3(BRCA2):c.2836del (p.Asp946fs) rs80359358
NM_000059.3(BRCA2):c.2847T>A (p.Tyr949Ter) rs886040449
NM_000059.3(BRCA2):c.2870del (p.Asn957fs) rs397507645
NM_000059.3(BRCA2):c.2883del (p.Gln961fs)
NM_000059.3(BRCA2):c.2884_2908del (p.His962fs) rs1555282923
NM_000059.3(BRCA2):c.2897_2898CT[1] (p.Leu967fs) rs80359361
NM_000059.3(BRCA2):c.289G>T (p.Glu97Ter) rs397507646
NM_000059.3(BRCA2):c.2905C>T (p.Gln969Ter) rs886038080
NM_000059.3(BRCA2):c.2918C>A (p.Ser973Ter) rs397507296
NM_000059.3(BRCA2):c.2924_2925TC[1] (p.Ser976fs)
NM_000059.3(BRCA2):c.2957_2958insG (p.Asn986fs) rs1555282969
NM_000059.3(BRCA2):c.2957dupA (p.Asn986Lysfs) rs80359365
NM_000059.3(BRCA2):c.2971_2983del (p.Asn991fs) rs886040456
NM_000059.3(BRCA2):c.2976del (p.Lys992fs) rs1060502391
NM_000059.3(BRCA2):c.2978G>A (p.Trp993Ter) rs80358543
NM_000059.3(BRCA2):c.2979G>A (p.Trp993Ter) rs80358544
NM_000059.3(BRCA2):c.298A>T (p.Lys100Ter) rs80358546
NM_000059.3(BRCA2):c.2T>A (p.Met1Lys) rs80358547
NM_000059.3(BRCA2):c.2T>G (p.Met1Arg) rs80358547
NM_000059.3(BRCA2):c.3001dup (p.Ser1001fs) rs886037801
NM_000059.3(BRCA2):c.3002C>G (p.Ser1001Ter) rs1555283001
NM_000059.3(BRCA2):c.3007_3008CA[1] (p.His1003fs) rs397507300
NM_000059.3(BRCA2):c.3051del (p.Lys1018fs) rs80359367
NM_000059.3(BRCA2):c.3062_3066AACAT[1] (p.His1022_Asn1023insTer) rs80359369
NM_000059.3(BRCA2):c.3068dupA (p.Asn1023Lysfs) rs80359368
NM_000059.3(BRCA2):c.3075_3076delinsTT (p.Lys1025_Lys1026delinsAsnTer) rs587779362
NM_000059.3(BRCA2):c.3076A>T (p.Lys1026Ter) rs80358552
NM_000059.3(BRCA2):c.3077del (p.Lys1026fs) rs1060502475
NM_000059.3(BRCA2):c.308dup (p.Leu103fs) rs1057517572
NM_000059.3(BRCA2):c.3094A>T (p.Lys1032Ter)
NM_000059.3(BRCA2):c.3096del (p.Asp1033fs) rs1135401898
NM_000059.3(BRCA2):c.3098_3099AT[1] (p.Asp1033_Ile1034insTer) rs1555283051
NM_000059.3(BRCA2):c.3100dup (p.Ile1034fs) rs886040460
NM_000059.3(BRCA2):c.3103G>T (p.Glu1035Ter) rs80358556
NM_000059.3(BRCA2):c.3106G>T (p.Glu1036Ter) rs1060502449
NM_000059.3(BRCA2):c.3109C>T (p.Gln1037Ter) rs80358557
NM_000059.3(BRCA2):c.314T>A (p.Leu105Ter)
NM_000059.3(BRCA2):c.314T>G (p.Leu105Ter) rs80358561
NM_000059.3(BRCA2):c.314del (p.Asp104_Leu105insTer)
NM_000059.3(BRCA2):c.3158T>G (p.Leu1053Ter) rs41293477
NM_000059.3(BRCA2):c.316+5G>A rs81002840
NM_000059.3(BRCA2):c.316+5G>C rs81002840
NM_000059.3(BRCA2):c.3160_3163del (p.Asp1054fs) rs80359371
NM_000059.3(BRCA2):c.3165_3168del (p.Asn1055fs) rs1566227892
NM_000059.3(BRCA2):c.3166C>T (p.Gln1056Ter) rs79728106
NM_000059.3(BRCA2):c.3167_3170del (p.Gln1056fs) rs80359372
NM_000059.3(BRCA2):c.3170_3174del (p.Lys1057fs) rs80359373
NM_000059.3(BRCA2):c.3172A>T (p.Lys1058Ter) rs730881521
NM_000059.3(BRCA2):c.3174dup (p.Leu1059fs) rs1555283079
NM_000059.3(BRCA2):c.3187C>T (p.Gln1063Ter) rs876657678
NM_000059.3(BRCA2):c.3187_3188insG (p.Gln1063fs) rs1555283086
NM_000059.3(BRCA2):c.3189_3192del (p.Ser1064fs) rs80359374
NM_000059.3(BRCA2):c.3191C>A (p.Ser1064Ter) rs864622609
NM_000059.3(BRCA2):c.3191C>G (p.Ser1064Ter) rs864622609
NM_000059.3(BRCA2):c.3195_3198del (p.Asn1066fs) rs80359375
NM_000059.3(BRCA2):c.3199del (p.Thr1067fs) rs80359377
NM_000059.3(BRCA2):c.3201del (p.Val1068fs) rs864622672
NM_000059.3(BRCA2):c.3202del (p.Val1068fs) rs397507658
NM_000059.3(BRCA2):c.3217C>T (p.Gln1073Ter) rs886040464
NM_000059.3(BRCA2):c.3221_3225GTAGT[1] (p.Val1076fs) rs397507659
NM_000059.3(BRCA2):c.3222_3225del (p.Ser1074fs) rs1135401899
NM_000059.3(BRCA2):c.3241del (p.Cys1081fs)
NM_000059.3(BRCA2):c.3255_3256TA[1] (p.Ile1086fs) rs876658618
NM_000059.3(BRCA2):c.3259dup (p.Thr1087fs)
NM_000059.3(BRCA2):c.3264dupT (p.Gln1089Serfs) rs80359380
NM_000059.3(BRCA2):c.3295del (p.Ser1099fs) rs80359383
NM_000059.3(BRCA2):c.3296C>G (p.Ser1099Ter) rs397507663
NM_000059.3(BRCA2):c.3308T>G (p.Leu1103Ter) rs397507305
NM_000059.3(BRCA2):c.3308del (p.Asn1102_Leu1103insTer) rs1555283160
NM_000059.3(BRCA2):c.3323del (p.Lys1108fs) rs869320782
NM_000059.3(BRCA2):c.3326del (p.Ala1109fs) rs398122762
NM_000059.3(BRCA2):c.3335del (p.Thr1112fs) rs886040470
NM_000059.3(BRCA2):c.3344del (p.Ser1115fs) rs1135401900
NM_000059.3(BRCA2):c.3349_3350AT[3] (p.Leu1118fs) rs730882134
NM_000059.3(BRCA2):c.3349del (p.Ile1117fs) rs878853567
NM_000059.3(BRCA2):c.3353_3355del (p.Leu1118_Glu1119delinsTer) rs786203329
NM_000059.3(BRCA2):c.3362C>G (p.Ser1121Ter) rs80358579
NM_000059.3(BRCA2):c.3365del (p.Gly1122fs) rs786202160
NM_000059.3(BRCA2):c.3396del (p.Lys1132fs) rs876658427
NM_000059.3(BRCA2):c.3405C>A (p.Tyr1135Ter) rs876659258
NM_000059.3(BRCA2):c.342_343del (p.His114fs) rs878853568
NM_000059.3(BRCA2):c.3450dup (p.Ile1151fs) rs397507668
NM_000059.3(BRCA2):c.3451_3452del (p.Ile1151fs) rs886040475
NM_000059.3(BRCA2):c.3454_3455del (p.Leu1152fs) rs1555283251
NM_000059.3(BRCA2):c.3454_3455dup (p.Leu1152fs) rs80359385
NM_000059.3(BRCA2):c.3455T>A (p.Leu1152Ter) rs80358593
NM_000059.3(BRCA2):c.3458del (p.Lys1153fs) rs80359386
NM_000059.3(BRCA2):c.3462del (p.Thr1155fs) rs1555283256
NM_000059.3(BRCA2):c.3478_3481delinsTGAGGA (p.Arg1160_Asp1161delinsTer) rs1064792961
NM_000059.3(BRCA2):c.3479_3480GA[3] (p.Asp1161fs) rs878853569
NM_000059.3(BRCA2):c.3481_3491del (p.Asp1161fs) rs1555283262
NM_000059.3(BRCA2):c.3515C>A (p.Ser1172Ter) rs80358600
NM_000059.3(BRCA2):c.3536_3539GCAA[1] (p.Lys1180fs)
NM_000059.3(BRCA2):c.3545_3546del (p.Gln1181_Phe1182insTer) rs80359388
NM_000059.3(BRCA2):c.3554_3555del (p.Thr1185fs) rs80359389
NM_000059.3(BRCA2):c.3554_3563del (p.Thr1185fs) rs397507675
NM_000059.3(BRCA2):c.3570del (p.Lys1191fs) rs80359390
NM_000059.3(BRCA2):c.3593dup (p.Asn1198fs) rs397507677
NM_000059.3(BRCA2):c.3596_3599del (p.Asp1199fs) rs886040484
NM_000059.3(BRCA2):c.3599_3600del (p.Asp1199_Cys1200insTer) rs80359391
NM_000059.3(BRCA2):c.3600T>A (p.Cys1200Ter)
NM_000059.3(BRCA2):c.3635dup (p.Asn1212fs) rs1555283322
NM_000059.3(BRCA2):c.3637G>T (p.Glu1213Ter) rs1566228876
NM_000059.3(BRCA2):c.3649del (p.Arg1217fs) rs864622134
NM_000059.3(BRCA2):c.3680_3681del (p.Leu1227fs) rs80359395
NM_000059.3(BRCA2):c.3683delinsGG (p.Asn1228fs) rs1555283361
NM_000059.3(BRCA2):c.3688del (p.Ser1230fs) rs878853573
NM_000059.3(BRCA2):c.3689_3690del (p.Ser1230fs) rs869312759
NM_000059.3(BRCA2):c.3689del (p.Ser1230fs) rs80359398
NM_000059.3(BRCA2):c.3696del (p.Ala1233fs)
NM_000059.3(BRCA2):c.36dupT (p.Glu13Terfs) rs80359393
NM_000059.3(BRCA2):c.3708dup (p.Ala1237fs) rs34575057
NM_000059.3(BRCA2):c.3710del (p.Ala1237fs) rs1555283371
NM_000059.3(BRCA2):c.3717del (p.Lys1239fs) rs80359401
NM_000059.3(BRCA2):c.3744_3747del (p.Ser1248fs) rs80359403
NM_000059.3(BRCA2):c.3751dup (p.Thr1251fs) rs397507683
NM_000059.3(BRCA2):c.3778_3779del (p.Leu1260fs) rs397507686
NM_000059.3(BRCA2):c.3779T>A (p.Leu1260Ter) rs1555283397
NM_000059.3(BRCA2):c.3779T>G (p.Leu1260Ter) rs1555283397
NM_000059.3(BRCA2):c.3779del (p.Leu1260fs) rs397507686
NM_000059.3(BRCA2):c.3785C>G (p.Ser1262Ter) rs80358620
NM_000059.3(BRCA2):c.37_38insT (p.Glu13fs) rs80359400
NM_000059.3(BRCA2):c.3824_3825del (p.Ile1275fs) rs1555283411
NM_000059.3(BRCA2):c.3836del (p.Asn1279fs) rs397507690
NM_000059.3(BRCA2):c.3847_3848del (p.Val1283fs) rs80359405
NM_000059.3(BRCA2):c.3859_3860del (p.Lys1286_Asn1287insTer) rs80359406
NM_000059.3(BRCA2):c.3860_3863del (p.Asn1287fs) rs80359410
NM_000059.3(BRCA2):c.3860del (p.Asn1287fs) rs80359406
NM_000059.3(BRCA2):c.3860dupA (p.Asn1287Lysfs) rs80359406
NM_000059.3(BRCA2):c.3861_3865del (p.Asn1287fs) rs1555283431
NM_000059.3(BRCA2):c.3864_3865del (p.Asn1288fs) rs886038098
NM_000059.3(BRCA2):c.3865_3868del (p.Lys1289fs) rs80359412
NM_000059.3(BRCA2):c.3866_3868dup (p.Cys1290Ter) rs1555283442
NM_000059.3(BRCA2):c.3873del (p.Gln1291fs) rs398122772
NM_000059.3(BRCA2):c.3881T>G (p.Leu1294Ter) rs80358632
NM_000059.3(BRCA2):c.3881del (p.Leu1294fs) rs1064794921
NM_000059.3(BRCA2):c.3883C>T (p.Gln1295Ter) rs879255309
NM_000059.3(BRCA2):c.3906del (p.Gly1303fs) rs1555283468
NM_000059.3(BRCA2):c.3915del (p.Phe1305fs) rs397507698
NM_000059.3(BRCA2):c.3919del (p.Glu1307fs) rs80359416
NM_000059.3(BRCA2):c.391del (p.Ser131fs) rs397507318
NM_000059.3(BRCA2):c.3922G>T (p.Glu1308Ter) rs80358638
NM_000059.3(BRCA2):c.3933_3943del (p.Asn1312fs) rs1555283478
NM_000059.3(BRCA2):c.3971del (p.Tyr1324fs)
NM_000059.3(BRCA2):c.3975_3978dup (p.Ala1327fs) rs397515636
NM_000059.3(BRCA2):c.3G>A (p.Met1Ile) rs80358650
NM_000059.3(BRCA2):c.3G>T (p.Met1Ile) rs80358650
NM_000059.3(BRCA2):c.4000_4001del (p.Leu1334fs) rs398122775
NM_000059.3(BRCA2):c.4003G>T (p.Glu1335Ter) rs747070579
NM_000059.3(BRCA2):c.4005dup (p.Phe1336fs) rs397507701
NM_000059.3(BRCA2):c.4007_4008insCATC (p.Asp1337fs) rs878853577
NM_000059.3(BRCA2):c.4008_4009insCATC (p.Asp1337fs) rs80359420
NM_000059.3(BRCA2):c.4022C>A (p.Ser1341Ter) rs1135401901
NM_000059.3(BRCA2):c.4030_4034del (p.Asn1344fs)
NM_000059.3(BRCA2):c.4037del (p.Thr1346fs) rs1162394508
NM_000059.3(BRCA2):c.4058_4062del (p.Glu1353fs) rs397507322
NM_000059.3(BRCA2):c.4070dup (p.Phe1358fs)
NM_000059.3(BRCA2):c.4076del (p.Thr1359fs) rs80359424
NM_000059.3(BRCA2):c.407del (p.Asn136fs) rs80359425
NM_000059.3(BRCA2):c.4090_4091AT[1] (p.Ile1364fs) rs80359426
NM_000059.3(BRCA2):c.4092_4093insAA (p.Cys1365fs) rs876658329
NM_000059.3(BRCA2):c.4100_4104del (p.Lys1367fs)
NM_000059.3(BRCA2):c.4103del (p.Leu1368fs) rs1555283552
NM_000059.3(BRCA2):c.4111C>T (p.Gln1371Ter) rs80358659
NM_000059.3(BRCA2):c.4112dup (p.Phe1372fs) rs730881606
NM_000059.3(BRCA2):c.4117dup (p.Met1373fs) rs1555283571
NM_000059.3(BRCA2):c.4124del (p.Glu1375fs) rs886040512
NM_000059.3(BRCA2):c.4127_4130del (p.Gly1376fs) rs397507323
NM_000059.3(BRCA2):c.4131_4132insTGAGGA (p.Thr1378Ter) rs80359429
NM_000059.3(BRCA2):c.4133_4136del (p.Thr1378fs) rs80359430
NM_000059.3(BRCA2):c.4135del (p.Gln1379fs) rs1555283588
NM_000059.3(BRCA2):c.413_417del (p.Ser137_Cys138insTer) rs876658850
NM_000059.3(BRCA2):c.414T>A (p.Cys138Ter) rs1555280869
NM_000059.3(BRCA2):c.4154C>G (p.Ser1385Ter) rs886038101
NM_000059.3(BRCA2):c.4163_4164delinsA (p.Thr1388fs) rs276174843
NM_000059.3(BRCA2):c.4168_4169del (p.Leu1390fs) rs80359433
NM_000059.3(BRCA2):c.4170_4171del (p.Glu1391fs) rs878853579
NM_000059.3(BRCA2):c.4176del (p.Ala1393fs) rs863224825
NM_000059.3(BRCA2):c.4211C>A (p.Ser1404Ter) rs41293489
NM_000059.3(BRCA2):c.4211C>G (p.Ser1404Ter) rs41293489
NM_000059.3(BRCA2):c.4211_4215del (p.Thr1403_Ser1404insTer) rs786203340
NM_000059.3(BRCA2):c.4211del (p.Thr1403_Ser1404insTer) rs398122777
NM_000059.3(BRCA2):c.4218_4221del (p.Lys1406fs) rs80359435
NM_000059.3(BRCA2):c.4221del (p.Glu1407fs) rs886040515
NM_000059.3(BRCA2):c.4222C>T (p.Gln1408Ter) rs80358663
NM_000059.3(BRCA2):c.4228_4229insA (p.Thr1410Asnfs) rs879255450
NM_000059.3(BRCA2):c.4245del (p.Glu1415fs) rs767234936
NM_000059.3(BRCA2):c.4258del (p.Asp1420fs) rs80359436
NM_000059.3(BRCA2):c.426-2A>G rs398122779
NM_000059.3(BRCA2):c.4264_4265GA[1] (p.Glu1422fs) rs1555283667
NM_000059.3(BRCA2):c.4273del (p.Asp1425fs) rs1060502426
NM_000059.3(BRCA2):c.4276dupA (p.Thr1426Asnfs) rs80359438
NM_000059.3(BRCA2):c.4284dup (p.Gln1429fs) rs80359439
NM_000059.3(BRCA2):c.4285C>T (p.Gln1429Ter) rs80358665
NM_000059.3(BRCA2):c.4310_4311GT[3] (p.Ala1439fs) rs1064794168
NM_000059.3(BRCA2):c.4325C>A (p.Ser1442Ter) rs80358670
NM_000059.3(BRCA2):c.4354C>T (p.Gln1452Ter) rs431825319
NM_000059.3(BRCA2):c.4366G>T (p.Glu1456Ter) rs876659847
NM_000059.3(BRCA2):c.4380_4381del (p.Ser1461fs) rs397507715
NM_000059.3(BRCA2):c.4383_4384del (p.Leu1462fs) rs876660510
NM_000059.3(BRCA2):c.4397T>A (p.Leu1466Ter) rs886040526
NM_000059.3(BRCA2):c.4398_4402del (p.Leu1466fs) rs80359444
NM_000059.3(BRCA2):c.4398dup (p.His1467fs) rs1566230215
NM_000059.3(BRCA2):c.4405_4409del (p.Asp1469fs) rs397507331
NM_000059.3(BRCA2):c.4409_4410del (p.Ile1470fs) rs80359446
NM_000059.3(BRCA2):c.4409_4413del (p.Ile1470fs) rs397507718
NM_000059.3(BRCA2):c.4411_4414AGAA[1] (p.Lys1472fs) rs397507333
NM_000059.3(BRCA2):c.4417_4418del (p.Asn1473fs)
NM_000059.3(BRCA2):c.4419del (p.Asn1473fs) rs1064794337
NM_000059.3(BRCA2):c.4423del (p.Met1475fs) rs80359447
NM_000059.3(BRCA2):c.4448_4449del (p.Thr1483fs) rs1566230322
NM_000059.3(BRCA2):c.4449del (p.Asp1484fs) rs80359448
NM_000059.3(BRCA2):c.4456_4459del (p.Val1486fs) rs80359449
NM_000059.3(BRCA2):c.4458del (p.Lys1487fs) rs886040532
NM_000059.3(BRCA2):c.4460_4461del (p.Lys1487fs) rs876660026
NM_000059.3(BRCA2):c.4461dup (p.His1488fs) rs876660026
NM_000059.3(BRCA2):c.4470dup (p.Leu1491fs) rs397507334
NM_000059.3(BRCA2):c.4471_4474del (p.Leu1491fs) rs80359451
NM_000059.3(BRCA2):c.4472_4475del (p.Leu1491fs) rs80359452
NM_000059.3(BRCA2):c.4474_4477AAAG[1] (p.Glu1493fs) rs80359454
NM_000059.3(BRCA2):c.4477_4478del (p.Glu1493fs) rs786203492
NM_000059.3(BRCA2):c.4506_4507insT (p.Leu1503fs) rs1135401902
NM_000059.3(BRCA2):c.4515_4525del (p.Phe1506fs) rs863224827
NM_000059.3(BRCA2):c.4519del (p.Gln1507fs) rs431825321
NM_000059.3(BRCA2):c.4544dup (p.Ile1516fs) rs397507725
NM_000059.3(BRCA2):c.4551_4554del (p.Lys1517fs) rs80359457
NM_000059.3(BRCA2):c.4551_4593del (p.Glu1518fs) rs1555283841
NM_000059.3(BRCA2):c.4552del (p.Glu1518fs) rs398122783
NM_000059.3(BRCA2):c.4554del (p.Glu1518fs) rs80359458
NM_000059.3(BRCA2):c.4563_4564del (p.Leu1522fs) rs483353115
NM_000059.3(BRCA2):c.4587dup (p.Lys1530fs) rs745456776
NM_000059.3(BRCA2):c.4588A>T (p.Lys1530Ter) rs80358692
NM_000059.3(BRCA2):c.4591A>T (p.Lys1531Ter) rs1555283865
NM_000059.3(BRCA2):c.4594_4598del (p.Val1532fs) rs879254138
NM_000059.3(BRCA2):c.4619_4623del (p.Asp1540fs) rs869320793
NM_000059.3(BRCA2):c.462_463del (p.Arg155_Asp156insTer) rs80359459
NM_000059.3(BRCA2):c.4631del (p.Asn1544fs) rs80359460
NM_000059.3(BRCA2):c.4631dupA (p.Asn1544Lysfs) rs80359460
NM_000059.3(BRCA2):c.4638del (p.Phe1546fs) rs80359462
NM_000059.3(BRCA2):c.4638dup (p.Asp1547Ter) rs80359462
NM_000059.3(BRCA2):c.4647_4650del (p.Lys1549fs) rs397507734
NM_000059.3(BRCA2):c.4648G>T (p.Glu1550Ter) rs80358695
NM_000059.3(BRCA2):c.464_465GA[1] (p.Arg155_Asp156insTer) rs886040542
NM_000059.3(BRCA2):c.4651C>T (p.Gln1551Ter) rs876661062
NM_000059.3(BRCA2):c.4654_4657del (p.Gly1552fs) rs1555283889
NM_000059.3(BRCA2):c.4677del (p.Phe1559fs) rs1064794708
NM_000059.3(BRCA2):c.4689G>A (p.Trp1563Ter) rs886038108
NM_000059.3(BRCA2):c.4691dup (p.Thr1566fs) rs786204209
NM_000059.3(BRCA2):c.4694del (p.Lys1565fs)
NM_000059.3(BRCA2):c.469_470del (p.Lys157fs) rs397507739
NM_000059.3(BRCA2):c.4707C>A (p.Tyr1569Ter) rs878853585
NM_000059.3(BRCA2):c.4708_4709AG[2] (p.Glu1571fs) rs80359464
NM_000059.3(BRCA2):c.470_474del (p.Lys157fs) rs80359463
NM_000059.3(BRCA2):c.471del (p.Lys157fs) rs1060502395
NM_000059.3(BRCA2):c.4723del (p.Asp1575fs) rs1566231025
NM_000059.3(BRCA2):c.4731_4736delinsG (p.Leu1578fs) rs276174846
NM_000059.3(BRCA2):c.4731del (p.Glu1577fs) rs397507740
NM_000059.3(BRCA2):c.4731dup (p.Leu1578fs) rs397507740
NM_000059.3(BRCA2):c.4738_4739TG[3] (p.Glu1581fs) rs864622401
NM_000059.3(BRCA2):c.4739dup (p.Cys1580fs) rs1555283924
NM_000059.3(BRCA2):c.475+1G>A rs81002797
NM_000059.3(BRCA2):c.475+1G>T rs81002797
NM_000059.3(BRCA2):c.4774A>T (p.Lys1592Ter) rs886040548
NM_000059.3(BRCA2):c.4787del (p.Asn1596fs)
NM_000059.3(BRCA2):c.4808dupA (p.Asn1603Lysfs) rs80359466
NM_000059.3(BRCA2):c.4810dup (p.Leu1604fs) rs1555283942
NM_000059.3(BRCA2):c.4821_4823delinsC (p.Glu1608fs) rs587782854
NM_000059.3(BRCA2):c.4827_4828TG[1] (p.Val1610fs) rs80359468
NM_000059.3(BRCA2):c.4848_4851del (p.Ser1617fs) rs1135401903
NM_000059.3(BRCA2):c.4859T>G (p.Leu1620Ter) rs80358710
NM_000059.3(BRCA2):c.486del (p.Ser163fs) rs587780653
NM_000059.3(BRCA2):c.4876_4877del (p.Asn1626fs) rs80359470
NM_000059.3(BRCA2):c.4877dup (p.Asn1626fs) rs80359470
NM_000059.3(BRCA2):c.4884_4885del (p.Lys1628fs) rs1555283971
NM_000059.3(BRCA2):c.4889C>G (p.Ser1630Ter) rs80358711
NM_000059.3(BRCA2):c.4899_4900del (p.Leu1635fs)
NM_000059.3(BRCA2):c.489_490insG (p.Leu164fs) rs120074205
NM_000059.3(BRCA2):c.4912A>T (p.Lys1638Ter) rs886040553
NM_000059.3(BRCA2):c.4921G>T (p.Glu1641Ter) rs1566231364
NM_000059.3(BRCA2):c.4930_4937del (p.Glu1644fs) rs886040554
NM_000059.3(BRCA2):c.4935del (p.Glu1646fs) rs80359472
NM_000059.3(BRCA2):c.4936_4937del (p.Glu1646fs) rs431825323
NM_000059.3(BRCA2):c.4936_4939del (p.Glu1646fs) rs80359473
NM_000059.3(BRCA2):c.4940_4941del (p.Thr1647fs) rs397507751
NM_000059.3(BRCA2):c.4947_4948del (p.Pro1651fs) rs80359474
NM_000059.3(BRCA2):c.4949del (p.Ser1650fs)
NM_000059.3(BRCA2):c.495del (p.His166fs) rs1135401890
NM_000059.3(BRCA2):c.4963del (p.Tyr1655fs) rs886040557
NM_000059.3(BRCA2):c.4964dup (p.Tyr1655Ter) rs398122789
NM_000059.3(BRCA2):c.4965C>A (p.Tyr1655Ter) rs80358721
NM_000059.3(BRCA2):c.4965C>G (p.Tyr1655Ter) rs80358721
NM_000059.3(BRCA2):c.4965del (p.Cys1654_Tyr1655insTer) rs80359475
NM_000059.3(BRCA2):c.4976_4977insG (p.Tyr1661fs) rs431825325
NM_000059.3(BRCA2):c.4980_4981dup (p.Tyr1661fs)
NM_000059.3(BRCA2):c.49_50AC[1] (p.Arg18fs) rs80359483
NM_000059.3(BRCA2):c.5014dup (p.Tyr1672fs) rs397507755
NM_000059.3(BRCA2):c.5016C>G (p.Tyr1672Ter) rs864622073
NM_000059.3(BRCA2):c.5034_5035del (p.Lys1678fs) rs80359477
NM_000059.3(BRCA2):c.5035del (p.Thr1679fs) rs80359477
NM_000059.3(BRCA2):c.5040_5041TG[1] (p.Val1681fs) rs80359478
NM_000059.3(BRCA2):c.5047C>T (p.Gln1683Ter) rs1555284044
NM_000059.3(BRCA2):c.5054C>A (p.Ser1685Ter) rs398122791
NM_000059.3(BRCA2):c.5054C>G (p.Ser1685Ter) rs398122791
NM_000059.3(BRCA2):c.5065_5066delinsAAA (p.Ala1689fs) rs276174852
NM_000059.3(BRCA2):c.5073dupA (p.Trp1692Metfs) rs80359479
NM_000059.3(BRCA2):c.5074_5075insA (p.Trp1692Ter) rs80359482
NM_000059.3(BRCA2):c.5075G>A (p.Trp1692Ter) rs1555284058
NM_000059.3(BRCA2):c.5087G>T (p.Gly1696Val) rs1135401904
NM_000059.3(BRCA2):c.5101C>T (p.Gln1701Ter) rs397507758
NM_000059.3(BRCA2):c.5106_5109AGAA[1] (p.Glu1703_Arg1704insTer) rs879254123
NM_000059.3(BRCA2):c.5107G>T (p.Glu1703Ter) rs80358735
NM_000059.3(BRCA2):c.5112_5115AATA[1] (p.Asn1706fs) rs276174853
NM_000059.3(BRCA2):c.5115_5119delinsG (p.Ile1705fs) rs886040565
NM_000059.3(BRCA2):c.5120del (p.Thr1707fs) rs886039318
NM_000059.3(BRCA2):c.5130_5133del (p.Asp1709_Tyr1710insTer) rs80359484
NM_000059.3(BRCA2):c.5134G>T (p.Gly1712Ter) rs876661056
NM_000059.3(BRCA2):c.5146_5149del (p.Tyr1716fs) rs276174854
NM_000059.3(BRCA2):c.5149del (p.Glu1717fs) rs886040569
NM_000059.3(BRCA2):c.5157_5161del (p.Asn1719fs) rs80359488
NM_000059.3(BRCA2):c.5158dupT (p.Ser1720Phefs) rs80359489
NM_000059.3(BRCA2):c.5159C>A (p.Ser1720Ter) rs80358740
NM_000059.3(BRCA2):c.516+1G>A rs397507762
NM_000059.3(BRCA2):c.516+2T>C rs397507764
NM_000059.3(BRCA2):c.5161_5164del (p.Asn1721fs) rs1057519559
NM_000059.3(BRCA2):c.5164_5165del (p.Ser1722fs) rs80359490
NM_000059.3(BRCA2):c.517-1G>A rs81002849
NM_000059.3(BRCA2):c.517-2A>G rs81002858
NM_000059.3(BRCA2):c.517-?_631+?del
NM_000059.3(BRCA2):c.518delG rs80359492
NM_000059.3(BRCA2):c.5191del (p.His1731fs) rs1566231890
NM_000059.3(BRCA2):c.5192_5193del (p.His1731fs) rs1555284096
NM_000059.3(BRCA2):c.5193_5194TC[2] (p.Ser1733fs) rs876660228
NM_000059.3(BRCA2):c.5200dup (p.Glu1734fs) rs1555284103
NM_000059.3(BRCA2):c.5205_5208del (p.Gln1736fs) rs886040575
NM_000059.3(BRCA2):c.5206C>T (p.Gln1736Ter) rs886037802
NM_000059.3(BRCA2):c.5209_5273dup (p.Asn1758delinsLysIleLeuIleTer)
NM_000059.3(BRCA2):c.5213_5216del (p.Thr1738fs) rs80359493
NM_000059.3(BRCA2):c.5216dup (p.Tyr1739Ter) rs886040578
NM_000059.3(BRCA2):c.5217_5220del (p.Thr1738_Tyr1739insTer) rs80359494
NM_000059.3(BRCA2):c.5217_5223del (p.Thr1738_Tyr1739insTer) rs80359496
NM_000059.3(BRCA2):c.5217_5224del (p.Tyr1739_Asn1742delinsTer) rs80359497
NM_000059.3(BRCA2):c.5218_5224del (p.Leu1740fs) rs886040580
NM_000059.3(BRCA2):c.5219_5220insTA (p.Leu1740fs) rs886040583
NM_000059.3(BRCA2):c.5219del (p.Tyr1739_Leu1740insTer) rs886040582
NM_000059.3(BRCA2):c.522del (p.Gln175fs) rs1060502465
NM_000059.3(BRCA2):c.5238dupT (p.Asn1747Terfs) rs80359499
NM_000059.3(BRCA2):c.5239_5240insT (p.Asn1747fs) rs80359500
NM_000059.3(BRCA2):c.523C>T (p.Gln175Ter) rs750385844
NM_000059.3(BRCA2):c.5241_5242insTA (p.Ser1748Ter) rs749980674
NM_000059.3(BRCA2):c.5254del (p.His1752fs) rs397507777
NM_000059.3(BRCA2):c.5266_5269del (p.Val1756fs) rs80359501
NM_000059.3(BRCA2):c.5270_5286del (p.Tyr1757fs) rs80359502
NM_000059.3(BRCA2):c.5271T>A (p.Tyr1757Ter) rs1555284139
NM_000059.3(BRCA2):c.5278dup (p.Ser1760fs)
NM_000059.3(BRCA2):c.5279C>G (p.Ser1760Ter) rs80358751
NM_000059.3(BRCA2):c.5281G>T (p.Gly1761Ter) rs886038122
NM_000059.3(BRCA2):c.5286T>A (p.Tyr1762Ter) rs80358754
NM_000059.3(BRCA2):c.5286_5287TC[2] (p.Ser1764fs) rs80359503
NM_000059.3(BRCA2):c.5297dup (p.Asn1766fs) rs1555284157
NM_000059.3(BRCA2):c.5298_5301del (p.Lys1767fs) rs1064795500
NM_000059.3(BRCA2):c.52_61del (p.Arg18fs) rs886040574
NM_000059.3(BRCA2):c.5303_5304del (p.Leu1768fs) rs80359505
NM_000059.3(BRCA2):c.5328_5329insT (p.Lys1777Ter) rs1135401905
NM_000059.3(BRCA2):c.5334_5340del (p.Asn1778fs) rs876658888
NM_000059.3(BRCA2):c.533_539delinsGAC (p.Lys178fs) rs1555281044
NM_000059.3(BRCA2):c.5344C>T (p.Gln1782Ter) rs80358757
NM_000059.3(BRCA2):c.5350_5351del (p.Asn1784fs) rs80359507
NM_000059.3(BRCA2):c.5351del (p.Asn1784fs) rs80359507
NM_000059.3(BRCA2):c.5351dupA (p.Asn1784Lysfs) rs80359507
NM_000059.3(BRCA2):c.5352dup (p.Thr1785fs) rs1555284188
NM_000059.3(BRCA2):c.5362_5363delinsA (p.Ser1788fs) rs1566232310
NM_000059.3(BRCA2):c.5362dup (p.Ser1788fs) rs587781849
NM_000059.3(BRCA2):c.5364dup (p.Lys1789fs) rs587779364
NM_000059.3(BRCA2):c.536_537AT[3] (p.Ser181fs) rs80359510
NM_000059.3(BRCA2):c.5371_5372AT[1] (p.Ser1792fs)
NM_000059.3(BRCA2):c.5388dup (p.Ala1797fs) rs1566232365
NM_000059.3(BRCA2):c.5410_5411del (p.Val1804fs) rs80359512
NM_000059.3(BRCA2):c.5416_5417insT (p.Glu1806fs) rs1135401906
NM_000059.3(BRCA2):c.5427C>A (p.Cys1809Ter)
NM_000059.3(BRCA2):c.5436del (p.Glu1812fs) rs397507351
NM_000059.3(BRCA2):c.5439del (p.Leu1813_Val1814insTer) rs397507785
NM_000059.3(BRCA2):c.5454del (p.Cys1820fs) rs80359513
NM_000059.3(BRCA2):c.5465del (p.Asn1822fs) rs1555284237
NM_000059.3(BRCA2):c.5471dup (p.Asn1824fs) rs80359515
NM_000059.3(BRCA2):c.5472_5473insA (p.Ala1825fs) rs886040593
NM_000059.3(BRCA2):c.5472dup (p.Ala1825fs) rs1555284244
NM_000059.3(BRCA2):c.5482_5486del (p.Lys1828fs) rs80359516
NM_000059.3(BRCA2):c.5525del (p.Pro1842fs) rs1566232608
NM_000059.3(BRCA2):c.5542del (p.Ser1848fs) rs80359519
NM_000059.3(BRCA2):c.5547_5548del (p.Lys1850fs)
NM_000059.3(BRCA2):c.5557del (p.Cys1853fs) rs587782011
NM_000059.3(BRCA2):c.5569G>T (p.Glu1857Ter) rs80358778
NM_000059.3(BRCA2):c.5569_5573del (p.Glu1857fs) rs397507788
NM_000059.3(BRCA2):c.5576_5579del (p.Ile1859fs) rs80359520
NM_000059.3(BRCA2):c.5577del (p.Lys1861_Val1862insTer) rs397507355
NM_000059.3(BRCA2):c.5578A>T (p.Lys1860Ter) rs431825332
NM_000059.3(BRCA2):c.5583dup (p.Val1862fs) rs397507790
NM_000059.3(BRCA2):c.5585_5588del (p.Val1862fs) rs80359523
NM_000059.3(BRCA2):c.5593_5594AT[1] (p.Phe1866fs) rs80359524
NM_000059.3(BRCA2):c.5595_5596delinsC (p.Phe1866fs) rs797044987
NM_000059.3(BRCA2):c.5599_5602ACAG[1] (p.Asp1868fs) rs397507356
NM_000059.3(BRCA2):c.5604_5605del (p.Asp1868fs) rs773229361
NM_000059.3(BRCA2):c.5607_5608insC (p.Phe1870fs) rs1135401907
NM_000059.3(BRCA2):c.5609_5610delinsAG (p.Phe1870Ter) rs276174859
NM_000059.3(BRCA2):c.5611_5615AGTAA[1] (p.Lys1872fs) rs80359525
NM_000059.3(BRCA2):c.5614A>T (p.Lys1872Ter) rs80358783
NM_000059.3(BRCA2):c.5617_5621del (p.Lys1872_Val1873insTer)
NM_000059.3(BRCA2):c.5621_5624del (p.Ile1874fs) rs80359526
NM_000059.3(BRCA2):c.5622_5628del (p.Lys1875fs)
NM_000059.3(BRCA2):c.5635G>T (p.Glu1879Ter) rs55996097
NM_000059.3(BRCA2):c.5644_5647del (p.Ser1882fs) rs1555284326
NM_000059.3(BRCA2):c.5645C>A (p.Ser1882Ter) rs80358785
NM_000059.3(BRCA2):c.5645C>G (p.Ser1882Ter) rs80358785
NM_000059.3(BRCA2):c.5651_5652insA (p.Cys1885fs) rs886040601
NM_000059.3(BRCA2):c.5653del (p.Cys1885fs) rs886040602
NM_000059.3(BRCA2):c.5655C>A (p.Cys1885Ter) rs80358789
NM_000059.3(BRCA2):c.5656C>T (p.Gln1886Ter) rs80358790
NM_000059.3(BRCA2):c.5681dupA (p.Tyr1894Terfs) rs80359527
NM_000059.3(BRCA2):c.5682C>A (p.Tyr1894Ter) rs41293497
NM_000059.3(BRCA2):c.5682C>G (p.Tyr1894Ter) rs41293497
NM_000059.3(BRCA2):c.5692del (p.Asp1898fs) rs398122539
NM_000059.3(BRCA2):c.5700_5701AG[1] (p.Glu1901fs) rs80359528
NM_000059.3(BRCA2):c.5715dup (p.Asn1906Ter) rs587782901
NM_000059.3(BRCA2):c.5718_5719CT[1] (p.Asn1906_Ser1907insTer) rs80359530
NM_000059.3(BRCA2):c.5718_5719CT[2] (p.Leu1908fs) rs80359530
NM_000059.3(BRCA2):c.5718del (p.Ser1907fs) rs1135401910
NM_000059.3(BRCA2):c.5723_5727del (p.Leu1908fs) rs794727014
NM_000059.3(BRCA2):c.572_573AT[1] (p.Met192fs) rs80359533
NM_000059.3(BRCA2):c.5750C>G (p.Ser1917Ter) rs886040609
NM_000059.3(BRCA2):c.5763del (p.Phe1921fs) rs80359534
NM_000059.3(BRCA2):c.5763dupT (p.Ala1922Cysfs) rs80359534
NM_000059.3(BRCA2):c.5773C>T (p.Gln1925Ter) rs80358806
NM_000059.3(BRCA2):c.5778_5779del (p.Ser1926fs) rs80359536
NM_000059.3(BRCA2):c.5782G>T (p.Glu1928Ter) rs56253082
NM_000059.3(BRCA2):c.5794_5800delinsT (p.His1932_Gln1934delinsTer) rs1555284398
NM_000059.3(BRCA2):c.5795_5799del (p.His1932fs) rs1555284397
NM_000059.3(BRCA2):c.5796_5797del (p.His1932fs) rs80359537
NM_000059.3(BRCA2):c.5799_5802del (p.Asn1933fs) rs80359538
NM_000059.3(BRCA2):c.5807del (p.Met1936fs) rs1555284404
NM_000059.3(BRCA2):c.5811_5812del (p.Gly1938fs) rs886040612
NM_000059.3(BRCA2):c.581G>A (p.Trp194Ter) rs80358809
NM_000059.3(BRCA2):c.5820_5833del (p.Glu1940fs) rs80359539
NM_000059.3(BRCA2):c.5826_5827del (p.Val1942_Ser1943insTer) rs1555284412
NM_000059.3(BRCA2):c.5828del (p.Ser1943fs) rs80359541
NM_000059.3(BRCA2):c.5835dup (p.Ser1946fs) rs886040614
NM_000059.3(BRCA2):c.5842del (p.Cys1948fs) rs398122541
NM_000059.3(BRCA2):c.5846del (p.Asp1949fs) rs1555284423
NM_000059.3(BRCA2):c.584C>G (p.Ser195Ter) rs886038053
NM_000059.3(BRCA2):c.5851_5854del (p.Ser1951fs) rs80359543
NM_000059.3(BRCA2):c.5855T>A (p.Leu1952Ter) rs375064902
NM_000059.3(BRCA2):c.5857G>T (p.Glu1953Ter) rs80358814
NM_000059.3(BRCA2):c.5862_5863del (p.Ser1955fs) rs786202700
NM_000059.3(BRCA2):c.5863del (p.Ser1955fs) rs80359546
NM_000059.3(BRCA2):c.5864C>A (p.Ser1955Ter) rs80358815
NM_000059.3(BRCA2):c.5875_5876delinsTTT (p.Lys1959fs)
NM_000059.3(BRCA2):c.5900_5903AGTC[1] (p.Val1969fs) rs80359547
NM_000059.3(BRCA2):c.5909C>A (p.Ser1970Ter) rs80358824
NM_000059.3(BRCA2):c.5925del (p.Cys1975fs) rs1555284465
NM_000059.3(BRCA2):c.5934dup (p.Ser1979Ter) rs80359548
NM_000059.3(BRCA2):c.593_596delinsAGG (p.Leu198_Ala199delinsTer) rs786202156
NM_000059.3(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.3(BRCA2):c.5954_5955del (p.Ser1985fs) rs80359551
NM_000059.3(BRCA2):c.5959C>T (p.Gln1987Ter) rs80358828
NM_000059.3(BRCA2):c.5962del (p.Val1988fs) rs876661236
NM_000059.3(BRCA2):c.5966dup (p.Asp1990fs) rs886040623
NM_000059.3(BRCA2):c.5978T>G (p.Leu1993Ter) rs768242833
NM_000059.3(BRCA2):c.5980C>T (p.Gln1994Ter) rs80358831
NM_000059.3(BRCA2):c.5984dup (p.Asn1995fs) rs397507818
NM_000059.3(BRCA2):c.5996dup (p.Phe2000fs) rs1555284495
NM_000059.3(BRCA2):c.5998delinsCG (p.Phe2000fs) rs1566233714
NM_000059.3(BRCA2):c.6011_6017del (p.Glu2004fs) rs397507362
NM_000059.3(BRCA2):c.6022A>T (p.Lys2008Ter) rs863224467
NM_000059.3(BRCA2):c.6024dupG (p.Gln2009Alafs) rs80359554
NM_000059.3(BRCA2):c.6025C>T (p.Gln2009Ter) rs80358838
NM_000059.3(BRCA2):c.6037A>T (p.Lys2013Ter) rs80358840
NM_000059.3(BRCA2):c.6052_6053del (p.Lys2017_Ser2018insTer) rs886040631
NM_000059.3(BRCA2):c.6059_6062del (p.Glu2020fs) rs398122546
NM_000059.3(BRCA2):c.6065C>G (p.Ser2022Ter) rs80358843
NM_000059.3(BRCA2):c.6074_6075del (p.Leu2025fs) rs1060502444
NM_000059.3(BRCA2):c.6078_6079del (p.Glu2028fs) rs80359557
NM_000059.3(BRCA2):c.6079dupA (p.Arg2027Lysfs) rs397507826
NM_000059.3(BRCA2):c.6080_6081GA[1] (p.Glu2028fs) rs886040634
NM_000059.3(BRCA2):c.6081dup (p.Glu2028fs) rs886040633
NM_000059.3(BRCA2):c.6082_6086del (p.Glu2028fs) rs80359558
NM_000059.3(BRCA2):c.6085_6089del (p.Glu2029fs) rs886040635
NM_000059.3(BRCA2):c.6091dup (p.Thr2031fs) rs587782717
NM_000059.3(BRCA2):c.610del (p.Ser205fs) rs80359560
NM_000059.3(BRCA2):c.610dup (p.Leu204fs) rs80359560
NM_000059.3(BRCA2):c.6124C>T (p.Gln2042Ter) rs80358851
NM_000059.3(BRCA2):c.6141T>G (p.Tyr2047Ter) rs1466688245
NM_000059.3(BRCA2):c.6145_6146insA (p.Val2049fs) rs1135401912
NM_000059.3(BRCA2):c.6154del (p.Ser2052fs) rs80359562
NM_000059.3(BRCA2):c.6155dup (p.Ser2053fs) rs1566234047
NM_000059.3(BRCA2):c.6164del (p.Phe2055fs) rs397507831
NM_000059.3(BRCA2):c.6164dup (p.Ser2056fs) rs397507831
NM_000059.3(BRCA2):c.6178del (p.Thr2060fs) rs80359563
NM_000059.3(BRCA2):c.6203_6204insA (p.Leu2069fs) rs80359566
NM_000059.3(BRCA2):c.6206T>G (p.Leu2069Ter) rs80358859
NM_000059.3(BRCA2):c.6216del (p.Leu2073fs) rs80359567
NM_000059.3(BRCA2):c.6220del (p.His2074fs) rs1060502400
NM_000059.3(BRCA2):c.6232G>T (p.Gly2078Ter)
NM_000059.3(BRCA2):c.6233dup (p.Val2079fs) rs878853595
NM_000059.3(BRCA2):c.6244G>T (p.Glu2082Ter) rs886040642
NM_000059.3(BRCA2):c.6254T>G (p.Leu2085Ter) rs864622082
NM_000059.3(BRCA2):c.6263del (p.Thr2088fs) rs1064794647
NM_000059.3(BRCA2):c.6267_6269delinsC (p.Glu2089fs) rs276174868
NM_000059.3(BRCA2):c.6275_6276del (p.Leu2092fs) rs11571658
NM_000059.3(BRCA2):c.6282T>A (p.Tyr2094Ter) rs1566234249
NM_000059.3(BRCA2):c.6292_6301delinsAGG (p.Ser2098fs) rs1566234273
NM_000059.3(BRCA2):c.631+1G>A rs81002897
NM_000059.3(BRCA2):c.631+2T>G rs81002899
NM_000059.3(BRCA2):c.631G>A (p.Val211Ile) rs80358871
NM_000059.3(BRCA2):c.632-1G>A rs81002820
NM_000059.3(BRCA2):c.632-2A>C rs397507842
NM_000059.3(BRCA2):c.6320del (p.Pro2107fs) rs886040650
NM_000059.3(BRCA2):c.6331_6332del (p.Lys2111fs) rs587781470
NM_000059.3(BRCA2):c.6333_6334GA[1] (p.Arg2112fs) rs80359574
NM_000059.3(BRCA2):c.6333_6337del (p.Arg2112fs) rs397507369
NM_000059.3(BRCA2):c.6350_6351GT[1] (p.Val2118fs) rs80359576
NM_000059.3(BRCA2):c.6361_6362del (p.Glu2121fs) rs886038144
NM_000059.3(BRCA2):c.6373_6374delinsG (p.Thr2125fs) rs1555284655
NM_000059.3(BRCA2):c.6373dup (p.Thr2125fs) rs80359577
NM_000059.3(BRCA2):c.6374_6375insA (p.Cys2126fs) rs80359579
NM_000059.3(BRCA2):c.6391_6392insT (p.Lys2131fs) rs80359580
NM_000059.3(BRCA2):c.6393del (p.Lys2131fs) rs886038145
NM_000059.3(BRCA2):c.6396dup (p.Ser2133fs) rs886040654
NM_000059.3(BRCA2):c.6397dup (p.Ser2133fs) rs431825342
NM_000059.3(BRCA2):c.6405_6409del (p.Asn2135fs) rs80359584
NM_000059.3(BRCA2):c.6415G>T (p.Glu2139Ter) rs763639231
NM_000059.3(BRCA2):c.6428C>A (p.Ser2143Ter) rs149330893
NM_000059.3(BRCA2):c.6444del (p.Ile2149fs) rs398122557
NM_000059.3(BRCA2):c.6444dupT (p.Ile2149Tyrfs) rs80359590
NM_000059.3(BRCA2):c.6445del (p.Ile2149fs) rs397507856
NM_000059.3(BRCA2):c.6446_6450del (p.Ile2149fs) rs80359593
NM_000059.3(BRCA2):c.6449_6450del (p.Lys2150fs) rs80359594
NM_000059.3(BRCA2):c.6450dup (p.Val2151fs) rs80359594
NM_000059.3(BRCA2):c.6462_6463TC[2] (p.Ser2156fs) rs80359596
NM_000059.3(BRCA2):c.6462_6463TC[3] (p.Gln2157fs) rs80359596
NM_000059.3(BRCA2):c.6462_6463TC[5] (p.Gln2157fs) rs80359596
NM_000059.3(BRCA2):c.6474dup (p.Gln2159fs) rs1555284710
NM_000059.3(BRCA2):c.6478C>T (p.Gln2160Ter) rs886040658
NM_000059.3(BRCA2):c.6481_6484del (p.Asp2161fs) rs886039319
NM_000059.3(BRCA2):c.6482_6485ACAA[1] (p.Lys2162fs) rs80359598
NM_000059.3(BRCA2):c.6490C>T (p.Gln2164Ter) rs397507860
NM_000059.3(BRCA2):c.6491_6494del (p.Gln2164fs) rs397507862
NM_000059.3(BRCA2):c.6491del (p.Gln2164fs) rs1135401914
NM_000059.3(BRCA2):c.6502G>T (p.Gly2168Ter) rs886040660
NM_000059.3(BRCA2):c.6509_6510del (p.Lys2170fs) rs80359600
NM_000059.3(BRCA2):c.6511_6512GT[1] (p.Ser2172fs) rs1555284730
NM_000059.3(BRCA2):c.6528_6535dup (p.Val2179fs) rs1555284738
NM_000059.3(BRCA2):c.652G>T (p.Glu218Ter) rs80358884
NM_000059.3(BRCA2):c.6531_6534del (p.Ile2177fs) rs397507865
NM_000059.3(BRCA2):c.6531dup (p.His2178fs) rs886040664
NM_000059.3(BRCA2):c.6535_6536insA (p.Val2179fs) rs80359601
NM_000059.3(BRCA2):c.6566dup (p.Asn2189fs) rs397507373
NM_000059.3(BRCA2):c.6574del (p.Met2192fs) rs1060502392
NM_000059.3(BRCA2):c.6588_6589del (p.Lys2196fs) rs397507868
NM_000059.3(BRCA2):c.6589dup (p.Thr2197fs)
NM_000059.3(BRCA2):c.658_659del (p.Val220fs) rs80359604
NM_000059.3(BRCA2):c.6591_6592del (p.Glu2198fs) rs80359605
NM_000059.3(BRCA2):c.6600_6601del (p.Phe2200_Ser2201insTer) rs80359607
NM_000059.3(BRCA2):c.6611dup (p.Val2205fs) rs1135401915
NM_000059.3(BRCA2):c.6627_6634del (p.Ile2209fs) rs397507870
NM_000059.3(BRCA2):c.662_663del (p.Phe221fs) rs80359609
NM_000059.3(BRCA2):c.6641dupC (p.Tyr2215Leufs) rs80359613
NM_000059.3(BRCA2):c.6642_6643insC (p.Tyr2215fs) rs886038151
NM_000059.3(BRCA2):c.6643del (p.Tyr2215fs) rs80359614
NM_000059.3(BRCA2):c.6644_6647del (p.Tyr2215fs) rs80359616
NM_000059.3(BRCA2):c.6644dupA (p.Tyr2215Terfs) rs80359615
NM_000059.3(BRCA2):c.6645C>G (p.Tyr2215Ter) rs80358892
NM_000059.3(BRCA2):c.6656C>G (p.Ser2219Ter) rs80358893
NM_000059.3(BRCA2):c.6662del (p.Asn2221fs) rs1064794812
NM_000059.3(BRCA2):c.6663_6664insAAAG (p.Tyr2222fs) rs786202157
NM_000059.3(BRCA2):c.6682dupG (p.Val2228Glyfs) rs80359621
NM_000059.3(BRCA2):c.6690dup (p.Ala2231fs) rs1555284792
NM_000059.3(BRCA2):c.6692del (p.Ala2231fs) rs886038153
NM_000059.3(BRCA2):c.6696del (p.Ala2233fs) rs878853301
NM_000059.3(BRCA2):c.67+1G>A rs81002796
NM_000059.3(BRCA2):c.67+1G>T rs81002796
NM_000059.3(BRCA2):c.67+2T>C rs81002885
NM_000059.3(BRCA2):c.67+2T>G rs81002885
NM_000059.3(BRCA2):c.6724_6725del (p.Asp2242fs) rs397507375
NM_000059.3(BRCA2):c.6725dup (p.Asp2242fs) rs1135401916
NM_000059.3(BRCA2):c.672_681+23del rs1555281357
NM_000059.3(BRCA2):c.6751del (p.His2251fs) rs1566235342
NM_000059.3(BRCA2):c.6755_6756CT[1] (p.Leu2253fs) rs80359623
NM_000059.3(BRCA2):c.6761_6762del (p.Phe2254fs) rs80359624
NM_000059.3(BRCA2):c.6777_6778insA (p.Glu2260fs) rs1566235386
NM_000059.3(BRCA2):c.68-1G>T rs1060502376
NM_000059.3(BRCA2):c.681+1G>A rs398122565
NM_000059.3(BRCA2):c.6814del (p.Arg2272fs) rs397507885
NM_000059.3(BRCA2):c.6816_6820del (p.Gly2274fs) rs587781803
NM_000059.3(BRCA2):c.682-1G>C rs81002831
NM_000059.3(BRCA2):c.6822_6823AG[3] (p.Pro2276fs)
NM_000059.3(BRCA2):c.6824_6827dup (p.Leu2277fs) rs1555284862
NM_000059.3(BRCA2):c.6832_6833insAA (p.Ile2278fs)
NM_000059.3(BRCA2):c.6833_6837del (p.Ile2278fs) rs80359626
NM_000059.3(BRCA2):c.6842-?_7007+?del
NM_000059.3(BRCA2):c.6859A>T (p.Arg2287Ter)
NM_000059.3(BRCA2):c.6859_6863del (p.Arg2287fs) rs398122568
NM_000059.3(BRCA2):c.6879del (p.Phe2293fs) rs886040932
NM_000059.3(BRCA2):c.688A>T (p.Lys230Ter) rs80358913
NM_000059.3(BRCA2):c.6944_6947del (p.Ile2315fs) rs80359629
NM_000059.3(BRCA2):c.6952C>T (p.Arg2318Ter) rs80358920
NM_000059.3(BRCA2):c.6959T>A (p.Leu2320Ter) rs80358923
NM_000059.3(BRCA2):c.6971_6972del (p.His2324fs) rs1555285347
NM_000059.3(BRCA2):c.6980del (p.Ser2326_Leu2327insTer) rs879255306
NM_000059.3(BRCA2):c.6987_6989delinsTGTG (p.Ile2330fs) rs1555285358
NM_000059.3(BRCA2):c.6990_6994del (p.Ile2330fs) rs80359631
NM_000059.3(BRCA2):c.6993_7007+7delCTGTGTACCCTTTCGGTAAGAC rs1566237849
NM_000059.3(BRCA2):c.6998dup (p.Pro2334fs) rs754611265
NM_000059.3(BRCA2):c.7002del (p.Arg2336fs) rs869040376
NM_000059.3(BRCA2):c.7003_7007del (p.Phe2335fs) rs80359632
NM_000059.3(BRCA2):c.7004_7007+2delTTCGGT rs397507890
NM_000059.3(BRCA2):c.7007+1G>A rs397507891
NM_000059.3(BRCA2):c.7007+2T>G
NM_000059.3(BRCA2):c.7007G>A (p.Arg2336His) rs28897743
NM_000059.3(BRCA2):c.7007G>C (p.Arg2336Pro) rs28897743
NM_000059.3(BRCA2):c.7007G>T (p.Arg2336Leu) rs28897743
NM_000059.3(BRCA2):c.7008-2A>G rs81002823
NM_000059.3(BRCA2):c.7008-2A>T rs81002823
NM_000059.3(BRCA2):c.700del (p.Ser234fs) rs80359630
NM_000059.3(BRCA2):c.7024C>T (p.Gln2342Ter) rs80358928
NM_000059.3(BRCA2):c.7025_7026del (p.Gln2342fs) rs80359634
NM_000059.3(BRCA2):c.705del (p.His236fs) rs1555281452
NM_000059.3(BRCA2):c.7060C>T (p.Gln2354Ter) rs80358936
NM_000059.3(BRCA2):c.7063G>T (p.Glu2355Ter) rs200078639
NM_000059.3(BRCA2):c.7069_7070del (p.Leu2357fs) rs80359636
NM_000059.3(BRCA2):c.7097dup (p.Thr2367fs) rs786202600
NM_000059.3(BRCA2):c.7115_7120delinsGC (p.Ser2372fs) rs1064792962
NM_000059.3(BRCA2):c.712dup (p.Glu238fs)
NM_000059.3(BRCA2):c.7133C>G (p.Ser2378Ter) rs276174889
NM_000059.3(BRCA2):c.7147dup (p.Tyr2383fs) rs878853599
NM_000059.3(BRCA2):c.7152del (p.Val2385fs) rs886040688
NM_000059.3(BRCA2):c.715del (p.Ser239fs) rs431825350
NM_000059.3(BRCA2):c.7180A>T (p.Arg2394Ter) rs80358946
NM_000059.3(BRCA2):c.7183del (p.His2395fs) rs397507900
NM_000059.3(BRCA2):c.718_719del (p.Leu240fs) rs1555281459
NM_000059.3(BRCA2):c.7191dup (p.Thr2398fs) rs886040690
NM_000059.3(BRCA2):c.71del (p.Asp23_Leu24insTer) rs397507903
NM_000059.3(BRCA2):c.7204_7207CCAA[1] (p.Thr2403fs) rs80359641
NM_000059.3(BRCA2):c.7209_7212delinsGG (p.Lys2404fs) rs876659770
NM_000059.3(BRCA2):c.7215_7218del (p.Val2407fs) rs1555286048
NM_000059.3(BRCA2):c.7217_7218del (p.Phe2406fs) rs876659345
NM_000059.3(BRCA2):c.7234del (p.Thr2412fs) rs1135401917
NM_000059.3(BRCA2):c.7237_7240del (p.Lys2413fs) rs1566241033
NM_000059.3(BRCA2):c.7249_7250CA[1] (p.His2417fs) rs397507907
NM_000059.3(BRCA2):c.7252del (p.Arg2418fs) rs1555286059
NM_000059.3(BRCA2):c.7258G>T (p.Glu2420Ter) rs397507385
NM_000059.3(BRCA2):c.729_732del (p.Asn243fs) rs80359645
NM_000059.3(BRCA2):c.72del (p.Gly25fs) rs1566215661
NM_000059.3(BRCA2):c.7301del (p.Lys2434fs) rs786202441
NM_000059.3(BRCA2):c.7331del (p.Asp2444fs) rs1135401918
NM_000059.3(BRCA2):c.7360del (p.Ile2454fs) rs80359646
NM_000059.3(BRCA2):c.7366C>T (p.Gln2456Ter) rs397507912
NM_000059.3(BRCA2):c.7379_7380insG (p.Asn2460fs) rs80359647
NM_000059.3(BRCA2):c.7379_7382del (p.Asn2460fs) rs80359648
NM_000059.3(BRCA2):c.7379del (p.Asn2460fs) rs397507914
NM_000059.3(BRCA2):c.7389_7392del (p.Asn2463fs) rs886040704
NM_000059.3(BRCA2):c.738del (p.Phe246fs) rs1566221413
NM_000059.3(BRCA2):c.7412_7421del (p.Thr2471fs) rs80359649
NM_000059.3(BRCA2):c.7414_7415del (p.Lys2472fs) rs80359650
NM_000059.3(BRCA2):c.7417_7418TG[1] (p.Cys2473_Glu2474delinsTer) rs80359651
NM_000059.3(BRCA2):c.7425del (p.Glu2476fs) rs886040706
NM_000059.3(BRCA2):c.7436-2A>T rs397507917
NM_000059.3(BRCA2):c.7436-?_7805+?del
NM_000059.3(BRCA2):c.7447del (p.Ser2483fs) rs1060502482
NM_000059.3(BRCA2):c.745_757del (p.Ser249fs) rs1555281467
NM_000059.3(BRCA2):c.7467dup (p.Ile2490fs) rs397507918
NM_000059.3(BRCA2):c.7471C>T (p.Gln2491Ter) rs80358971
NM_000059.3(BRCA2):c.7471del (p.Gln2491fs) rs886038170
NM_000059.3(BRCA2):c.7480C>T (p.Arg2494Ter) rs80358972
NM_000059.3(BRCA2):c.7485dup (p.Lys2496Ter) rs886038171
NM_000059.3(BRCA2):c.7487dup (p.Lys2497fs) rs886040710
NM_000059.3(BRCA2):c.7501C>T (p.Gln2501Ter) rs886040711
NM_000059.3(BRCA2):c.7510_7513dup (p.Pro2505fs) rs1566241990
NM_000059.3(BRCA2):c.7516C>T (p.Gln2506Ter) rs876658631
NM_000059.3(BRCA2):c.7517dup (p.Pro2507fs) rs886040713
NM_000059.3(BRCA2):c.751_754ACAG[1] (p.Asp252fs) rs80359659
NM_000059.3(BRCA2):c.7525dup (p.Ser2509fs) rs80359656
NM_000059.3(BRCA2):c.7556dup (p.Arg2520fs) rs80359660
NM_000059.3(BRCA2):c.7558C>T (p.Arg2520Ter) rs80358981
NM_000059.3(BRCA2):c.755del (p.Asp252fs) rs80359661
NM_000059.3(BRCA2):c.7563_7564CT[2] (p.Leu2523fs) rs80359664
NM_000059.3(BRCA2):c.756_757del (p.Asp252fs) rs80359662
NM_000059.3(BRCA2):c.7572dup (p.Ala2525fs)
NM_000059.3(BRCA2):c.7575del (p.Ala2526fs) rs869320797
NM_000059.3(BRCA2):c.7580_7583dup (p.Gly2529fs) rs1555286296
NM_000059.3(BRCA2):c.7580dup (p.Gly2528fs) rs1555286298
NM_000059.3(BRCA2):c.7595_7596insTT (p.Ala2534fs) rs80359666
NM_000059.3(BRCA2):c.7598_7617+263del283 rs1555286303
NM_000059.3(BRCA2):c.7615C>T (p.Gln2539Ter) rs886040720
NM_000059.3(BRCA2):c.7617+1G>A rs397507922
NM_000059.3(BRCA2):c.7617+1delG
NM_000059.3(BRCA2):c.7617+2T>G rs81002843
NM_000059.3(BRCA2):c.7618-1G>A rs397507389
NM_000059.3(BRCA2):c.7655_7658del (p.Ile2552fs) rs80359669
NM_000059.3(BRCA2):c.765_766CA[1] (p.Thr256fs) rs80359670
NM_000059.3(BRCA2):c.7671_7672AG[1] (p.Glu2558fs) rs80359672
NM_000059.3(BRCA2):c.7673del (p.Glu2558fs) rs878853605
NM_000059.3(BRCA2):c.7676_7677del (p.Ser2559fs)
NM_000059.3(BRCA2):c.7681C>T (p.Gln2561Ter) rs80358994
NM_000059.3(BRCA2):c.7719dup (p.Trp2574fs) rs80359676
NM_000059.3(BRCA2):c.771_775del (p.Asn257fs) rs80359671
NM_000059.3(BRCA2):c.7721G>A (p.Trp2574Ter) rs80358997
NM_000059.3(BRCA2):c.7722G>A (p.Trp2574Ter) rs1060502433
NM_000059.3(BRCA2):c.772C>T (p.Gln258Ter) rs80358998
NM_000059.3(BRCA2):c.7738C>T (p.Gln2580Ter) rs80358999
NM_000059.3(BRCA2):c.7745_7751del (p.Ala2582fs)
NM_000059.3(BRCA2):c.774_775del (p.Glu260fs) rs75096777
NM_000059.3(BRCA2):c.7757G>A (p.Trp2586Ter) rs80359003
NM_000059.3(BRCA2):c.7758G>A (p.Trp2586Ter) rs80359004
NM_000059.3(BRCA2):c.7762_7764delinsTT (p.Ile2588fs) rs483353072
NM_000059.3(BRCA2):c.7762del (p.Ile2588fs) rs80359679
NM_000059.3(BRCA2):c.776_777GA[1] (p.Glu260fs) rs80359677
NM_000059.3(BRCA2):c.7777G>T (p.Gly2593Ter) rs587782028
NM_000059.3(BRCA2):c.7791del (p.Glu2598fs) rs80359681
NM_000059.3(BRCA2):c.7792G>T (p.Glu2598Ter) rs1135401919
NM_000059.3(BRCA2):c.7795G>T (p.Glu2599Ter) rs41293509
NM_000059.3(BRCA2):c.7805+1G>A rs81002809
NM_000059.3(BRCA2):c.7806-1G>T rs81002860
NM_000059.3(BRCA2):c.7806-2A>G rs81002836
NM_000059.3(BRCA2):c.7806-?_8331+?del
NM_000059.3(BRCA2):c.7811_7812TG[2] (p.Cys2605_Asp2606delinsTer) rs886040730
NM_000059.3(BRCA2):c.7816_7819dup (p.Thr2607fs) rs80359684
NM_000059.3(BRCA2):c.7816dup (p.Asp2606fs)
NM_000059.3(BRCA2):c.7819del (p.Thr2607fs) rs1060502478
NM_000059.3(BRCA2):c.7823dup (p.Gly2609fs) rs1555286824
NM_000059.3(BRCA2):c.7846del (p.Ser2616fs) rs397507940
NM_000059.3(BRCA2):c.7856G>A (p.Trp2619Ter) rs397507941
NM_000059.3(BRCA2):c.7857G>A (p.Trp2619Ter) rs80359011
NM_000059.3(BRCA2):c.7865dup (p.Asn2622fs) rs886040732
NM_000059.3(BRCA2):c.7872T>G (p.Tyr2624Ter) rs863224468
NM_000059.3(BRCA2):c.7877G>A (p.Trp2626Ter) rs587781506
NM_000059.3(BRCA2):c.7878G>A (p.Trp2626Ter) rs80359013
NM_000059.3(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013
NM_000059.3(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.3(BRCA2):c.7884dup (p.Trp2629fs) rs397507943
NM_000059.3(BRCA2):c.7908T>A (p.Cys2636Ter) rs80359016
NM_000059.3(BRCA2):c.7913_7917del (p.Ala2637_Phe2638insTer) rs80359686
NM_000059.3(BRCA2):c.793+1G>A rs81002846
NM_000059.3(BRCA2):c.7934del (p.Arg2645fs) rs80359688
NM_000059.3(BRCA2):c.7946del (p.Pro2649fs) rs863224828
NM_000059.3(BRCA2):c.7958_7959dup (p.Leu2654fs) rs1566244965
NM_000059.3(BRCA2):c.7974C>A (p.Tyr2658Ter) rs80359025
NM_000059.3(BRCA2):c.7976+5G>T rs786201180
NM_000059.3(BRCA2):c.7976G>A (p.Arg2659Lys) rs80359027
NM_000059.3(BRCA2):c.7977-1G>C rs81002874
NM_000059.3(BRCA2):c.7977-1G>T rs81002874
NM_000059.3(BRCA2):c.7977-3_7977-2delinsAG rs1135401921
NM_000059.3(BRCA2):c.7979_7991del (p.Tyr2660fs) rs730881614
NM_000059.3(BRCA2):c.7980T>A (p.Tyr2660Ter) rs397507949
NM_000059.3(BRCA2):c.7988A>T (p.Glu2663Val) rs80359031
NM_000059.3(BRCA2):c.8002A>T (p.Arg2668Ter) rs276174900
NM_000059.3(BRCA2):c.8002_8003delinsTA (p.Arg2668Ter) rs1135401922
NM_000059.3(BRCA2):c.8009C>A (p.Ser2670Ter) rs80359035
NM_000059.3(BRCA2):c.8023A>G (p.Ile2675Val) rs397507954
NM_000059.3(BRCA2):c.8053del (p.Thr2685fs) rs397507958
NM_000059.3(BRCA2):c.8053dup (p.Thr2685fs) rs397507958
NM_000059.3(BRCA2):c.8063T>C (p.Leu2688Pro) rs80359045
NM_000059.3(BRCA2):c.8067T>A (p.Cys2689Ter) rs80359046
NM_000059.3(BRCA2):c.8067del (p.Cys2689fs) rs80359693
NM_000059.3(BRCA2):c.8070_8071dup (p.Ser2691fs) rs397507962
NM_000059.3(BRCA2):c.8143A>T (p.Lys2715Ter) rs863224469
NM_000059.3(BRCA2):c.8145del (p.Val2716fs) rs1135401923
NM_000059.3(BRCA2):c.8147del (p.Val2716fs) rs1566245525
NM_000059.3(BRCA2):c.8167G>C (p.Asp2723His) rs41293511
NM_000059.3(BRCA2):c.8168A>G (p.Asp2723Gly) rs41293513
NM_000059.3(BRCA2):c.8174G>A (p.Trp2725Ter) rs730881581
NM_000059.3(BRCA2):c.8178T>A (p.Tyr2726Ter) rs761595544
NM_000059.3(BRCA2):c.8191del (p.Gln2731fs) rs1555287033
NM_000059.3(BRCA2):c.8201del (p.Pro2734fs) rs886040750
NM_000059.3(BRCA2):c.8205_8206del (p.Leu2737fs) rs397507396
NM_000059.3(BRCA2):c.8208_8209insAG (p.Leu2737fs) rs483353122
NM_000059.3(BRCA2):c.8209_8210insAG (p.Leu2737Ter) rs1135401924
NM_000059.3(BRCA2):c.8210T>A (p.Leu2737Ter) rs1566245715
NM_000059.3(BRCA2):c.8223del (p.Asn2742fs) rs878853608
NM_000059.3(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.3(BRCA2):c.8245C>T (p.Gln2749Ter) rs1135401925
NM_000059.3(BRCA2):c.8247_8248del (p.Lys2750fs) rs80359701
NM_000059.3(BRCA2):c.826_830del (p.Lys275_Val276insTer) rs397507400
NM_000059.3(BRCA2):c.8271del (p.Glu2757fs) rs1555287071
NM_000059.3(BRCA2):c.8276_8279del (p.Val2759fs) rs886040753
NM_000059.3(BRCA2):c.8297del (p.Thr2766fs) rs80359705
NM_000059.3(BRCA2):c.8308del (p.Ala2770fs) rs398122601
NM_000059.3(BRCA2):c.831del (p.Asn277fs) rs1555281604
NM_000059.3(BRCA2):c.8323dup (p.Met2775fs) rs276174904
NM_000059.3(BRCA2):c.8330del (p.Lys2777fs) rs886040762
NM_000059.3(BRCA2):c.8331+1G>T rs81002837
NM_000059.3(BRCA2):c.8331+2T>C rs398122602
NM_000059.3(BRCA2):c.8332-13T>G
NM_000059.3(BRCA2):c.8332-2A>G rs587782774
NM_000059.3(BRCA2):c.8340_8343del (p.Asn2781fs) rs80359707
NM_000059.3(BRCA2):c.8364G>A (p.Trp2788Ter) rs397507981
NM_000059.3(BRCA2):c.8377G>A (p.Gly2793Arg) rs80359082
NM_000059.3(BRCA2):c.8394_8396delinsAA (p.Arg2799fs) rs276174907
NM_000059.3(BRCA2):c.8403del (p.Pro2802fs)
NM_000059.3(BRCA2):c.8414_8416delinsC (p.Leu2805fs) rs397507402
NM_000059.3(BRCA2):c.8416del (p.Ser2806fs) rs1566248843
NM_000059.3(BRCA2):c.8417C>G (p.Ser2806Ter)
NM_000059.3(BRCA2):c.8420C>A (p.Ser2807Ter) rs55763607
NM_000059.3(BRCA2):c.8426del (p.Phe2809fs) rs1555287643
NM_000059.3(BRCA2):c.8426dup (p.Ser2810fs) rs1555287643
NM_000059.3(BRCA2):c.842_843del (p.Asp281fs) rs886040773
NM_000059.3(BRCA2):c.8434_8435insC (p.Gly2812fs) rs886040774
NM_000059.3(BRCA2):c.844_845CA[1] (p.Ile283fs) rs886040776
NM_000059.3(BRCA2):c.8463del (p.Ile2822fs) rs397507988
NM_000059.3(BRCA2):c.8463dup (p.Ile2822fs) rs397507988
NM_000059.3(BRCA2):c.8470A>T (p.Arg2824Ter) rs886040778
NM_000059.3(BRCA2):c.8470_8471AG[1] (p.Arg2824fs) rs1566248936
NM_000059.3(BRCA2):c.8478C>A (p.Tyr2826Ter) rs776353983
NM_000059.3(BRCA2):c.8479_8487+8del rs1566248961
NM_000059.3(BRCA2):c.8487+1G>A rs81002798
NM_000059.3(BRCA2):c.8487+1G>T rs81002798
NM_000059.3(BRCA2):c.8488-1G>A rs397507404
NM_000059.3(BRCA2):c.8488-2A>C
NM_000059.3(BRCA2):c.8489G>A (p.Trp2830Ter) rs80359101
NM_000059.3(BRCA2):c.8504C>A (p.Ser2835Ter) rs80359102
NM_000059.3(BRCA2):c.8513_8514TA[1] (p.Tyr2839fs) rs1566249217
NM_000059.3(BRCA2):c.8524C>T (p.Arg2842Cys) rs80359104
NM_000059.3(BRCA2):c.8533_8534AG[1] (p.Glu2846fs) rs80359714
NM_000059.3(BRCA2):c.8533_8534AG[2] (p.Glu2846fs) rs80359714
NM_000059.3(BRCA2):c.8548G>T (p.Glu2850Ter) rs80359110
NM_000059.3(BRCA2):c.8560del (p.Tyr2854fs) rs80359717
NM_000059.3(BRCA2):c.8562T>A (p.Tyr2854Ter) rs786201333
NM_000059.3(BRCA2):c.8562del (p.Lys2853_Tyr2854insTer) rs886040782
NM_000059.3(BRCA2):c.8572C>T (p.Gln2858Ter) rs80359112
NM_000059.3(BRCA2):c.8575C>T (p.Gln2859Ter) rs80359115
NM_000059.3(BRCA2):c.8575del (p.Gln2859fs) rs80359718
NM_000059.3(BRCA2):c.8578_8579del (p.Lys2860fs) rs80359719
NM_000059.3(BRCA2):c.8579del (p.Lys2860fs) rs80359719
NM_000059.3(BRCA2):c.8580_8581GA[1] (p.Arg2861fs)
NM_000059.3(BRCA2):c.8581A>T (p.Arg2861Ter) rs398122608
NM_000059.3(BRCA2):c.8585_8586del (p.Leu2862fs) rs878853611
NM_000059.3(BRCA2):c.8585dupT (p.Glu2863Argfs) rs80359720
NM_000059.3(BRCA2):c.8589dup (p.Ala2864fs) rs1566249353
NM_000059.3(BRCA2):c.8594dupT (p.Leu2865Phefs) rs80359721
NM_000059.3(BRCA2):c.8607del (p.Gln2870fs) rs1060502471
NM_000059.3(BRCA2):c.8633-?_9256+?del
NM_000059.3(BRCA2):c.8637_8638CA[1] (p.Thr2880fs) rs886038184
NM_000059.3(BRCA2):c.8655dup (p.Pro2886fs) rs1135401927
NM_000059.3(BRCA2):c.8663del (p.Arg2888fs) rs1555288145
NM_000059.3(BRCA2):c.8673_8674del (p.Arg2892fs) rs80359724
NM_000059.3(BRCA2):c.8677C>T (p.Gln2893Ter) rs397507409
NM_000059.3(BRCA2):c.8680C>T (p.Gln2894Ter) rs397508002
NM_000059.3(BRCA2):c.8680del (p.Gln2894fs) rs397507410
NM_000059.3(BRCA2):c.8695C>T (p.Gln2899Ter) rs397507411
NM_000059.3(BRCA2):c.86_87del (p.Leu29fs) rs80359722
NM_000059.3(BRCA2):c.8702del (p.Gly2901fs) rs1566251448
NM_000059.3(BRCA2):c.8729_8738del (p.Asn2910fs)
NM_000059.3(BRCA2):c.8745_8748dup (p.Glu2918fs) rs80359727
NM_000059.3(BRCA2):c.8754+1G>A rs397508006
NM_000059.3(BRCA2):c.8754+4A>G rs81002893
NM_000059.3(BRCA2):c.8754G>A (p.Glu2918=) rs80359803
NM_000059.3(BRCA2):c.8755-1G>A rs81002812
NM_000059.3(BRCA2):c.8770G>T (p.Glu2924Ter) rs80359133
NM_000059.3(BRCA2):c.8777T>A (p.Leu2926Ter) rs886040791
NM_000059.3(BRCA2):c.8805_8806dup (p.Leu2936fs)
NM_000059.3(BRCA2):c.8837T>A (p.Leu2946Ter) rs431825371
NM_000059.3(BRCA2):c.8839G>T (p.Glu2947Ter) rs398122715
NM_000059.3(BRCA2):c.8842del (p.Ile2948fs) rs397508014
NM_000059.3(BRCA2):c.8848delinsCT (p.Lys2950fs) rs276174912
NM_000059.3(BRCA2):c.8850_8851dup (p.Ala2951fs) rs886040796
NM_000059.3(BRCA2):c.8878C>T (p.Gln2960Ter) rs80359140
NM_000059.3(BRCA2):c.8886_8950del (p.Leu2962fs) rs1555288389
NM_000059.3(BRCA2):c.8900del (p.Thr2967fs) rs1566252738
NM_000059.3(BRCA2):c.8902_8913delinsTCCC (p.Thr2968fs) rs864622735
NM_000059.3(BRCA2):c.8904del (p.Val2969fs) rs80359730
NM_000059.3(BRCA2):c.8909G>A (p.Trp2970Ter) rs1555288397
NM_000059.3(BRCA2):c.8915del (p.Leu2972fs) rs397508019
NM_000059.3(BRCA2):c.891_899delinsGATACTTCAG (p.Thr298fs) rs276174914
NM_000059.3(BRCA2):c.8924del (p.Val2975fs) rs397508020
NM_000059.3(BRCA2):c.8930del (p.Tyr2977fs) rs869320799
NM_000059.3(BRCA2):c.8940del (p.Glu2981fs) rs80359732
NM_000059.3(BRCA2):c.8940dup (p.Glu2981fs) rs80359732
NM_000059.3(BRCA2):c.8941G>T (p.Glu2981Ter) rs139052578
NM_000059.3(BRCA2):c.8941_8944del (p.Glu2981fs)
NM_000059.3(BRCA2):c.8945_8946del (p.Lys2982fs) rs80359733
NM_000059.3(BRCA2):c.8951C>A (p.Ser2984Ter) rs80359146
NM_000059.3(BRCA2):c.8951C>G (p.Ser2984Ter) rs80359146
NM_000059.3(BRCA2):c.8953+1G>T rs81002882
NM_000059.3(BRCA2):c.8954-1_8955delGTTinsAA rs276174916
NM_000059.3(BRCA2):c.8954-2A>C rs1135401928
NM_000059.3(BRCA2):c.8954-2A>T
NM_000059.3(BRCA2):c.8954-2_8959del rs1566252995
NM_000059.3(BRCA2):c.8954-5A>G rs886040949
NM_000059.3(BRCA2):c.8954-8_9136del rs1555288431
NM_000059.3(BRCA2):c.8961_8964del (p.Ser2988fs) rs80359734
NM_000059.3(BRCA2):c.8967_8973del (p.Trp2990fs)
NM_000059.3(BRCA2):c.8969G>A (p.Trp2990Ter) rs80359148
NM_000059.3(BRCA2):c.8970G>A (p.Trp2990Ter) rs80359149
NM_000059.3(BRCA2):c.897dup (p.Val300fs) rs1566222289
NM_000059.3(BRCA2):c.8987T>A (p.Leu2996Ter) rs864622200
NM_000059.3(BRCA2):c.8988_8990delinsTT (p.Leu2996fs) rs397508027
NM_000059.3(BRCA2):c.898_900delinsTT (p.Val300fs) rs1060502385
NM_000059.3(BRCA2):c.9004G>A (p.Glu3002Lys) rs80359152
NM_000059.3(BRCA2):c.9014_9017dup (p.Tyr3006Ter) rs1555288462
NM_000059.3(BRCA2):c.9018C>A (p.Tyr3006Ter) rs80359154
NM_000059.3(BRCA2):c.9018_9022del (p.Arg3007fs) rs1135401929
NM_000059.3(BRCA2):c.9026_9030del (p.Tyr3009fs) rs80359741
NM_000059.3(BRCA2):c.9027T>G (p.Tyr3009Ter) rs864622568
NM_000059.3(BRCA2):c.9027del (p.His3010fs) rs80359742
NM_000059.3(BRCA2):c.9041C>G (p.Ser3014Ter) rs80359156
NM_000059.3(BRCA2):c.9069_9076del (p.Asn3024fs) rs80359746
NM_000059.3(BRCA2):c.9076C>T (p.Gln3026Ter) rs80359159
NM_000059.3(BRCA2):c.9093_9094delinsG (p.Thr3033fs) rs876660532
NM_000059.3(BRCA2):c.9097_9098insT (p.Thr3033fs) rs1555288494
NM_000059.3(BRCA2):c.9097del (p.Thr3033fs) rs397507419
NM_000059.3(BRCA2):c.9097dupA (p.Thr3033Asnfs) rs397507419
NM_000059.3(BRCA2):c.9100C>T (p.Gln3034Ter) rs80359163
NM_000059.3(BRCA2):c.9103dup (p.Tyr3035fs) rs1555288507
NM_000059.3(BRCA2):c.9106C>T (p.Gln3036Ter) rs202155613
NM_000059.3(BRCA2):c.9117+1_9117+2delinsTC rs1566253399
NM_000059.3(BRCA2):c.9117G>A (p.Pro3039=) rs28897756
NM_000059.3(BRCA2):c.9118-1G>C rs886040950
NM_000059.3(BRCA2):c.9118-2A>G rs81002862
NM_000059.3(BRCA2):c.9154C>T (p.Arg3052Trp) rs45580035
NM_000059.3(BRCA2):c.917_920del (p.Asp306fs) rs1555281630
NM_000059.3(BRCA2):c.9182T>A (p.Leu3061Ter) rs80359175
NM_000059.3(BRCA2):c.918_919del (p.Asp306fs) rs1555281631
NM_000059.3(BRCA2):c.9195_9196delinsAT (p.Phe3065_Gln3066delinsLeuTer) rs876659047
NM_000059.3(BRCA2):c.9196C>T (p.Gln3066Ter) rs80359180
NM_000059.3(BRCA2):c.919_922dup (p.Phe308Ter)
NM_000059.3(BRCA2):c.91del (p.Trp31fs) rs1566215685
NM_000059.3(BRCA2):c.9235del (p.Val3079fs) rs397507422
NM_000059.3(BRCA2):c.9246dup (p.Lys3083fs) rs886038189
NM_000059.3(BRCA2):c.9252_9255delinsTT (p.Lys3084fs) rs276174918
NM_000059.3(BRCA2):c.9253del (p.Thr3085fs) rs397508041
NM_000059.3(BRCA2):c.9253dupA (p.Thr3085Asnfs) rs80359752
NM_000059.3(BRCA2):c.9256_9256+1delGGinsTA rs587781422
NM_000059.3(BRCA2):c.9257-1G>C rs81002889
NM_000059.3(BRCA2):c.9257-2A>G rs886040954
NM_000059.3(BRCA2):c.9257delG rs1555289496
NM_000059.3(BRCA2):c.9270_9271insTATTT (p.Val3091fs) rs1555289501
NM_000059.3(BRCA2):c.9270del (p.Phe3090fs) rs878853619
NM_000059.3(BRCA2):c.9275_9278del (p.Tyr3092fs) rs80359754
NM_000059.3(BRCA2):c.9285C>A (p.Asp3095Glu) rs80359198
NM_000059.3(BRCA2):c.9285C>G (p.Asp3095Glu) rs80359198
NM_000059.3(BRCA2):c.9290_9293del (p.Cys3097fs) rs1555289508
NM_000059.3(BRCA2):c.9294C>A (p.Tyr3098Ter) rs80359200
NM_000059.3(BRCA2):c.9294C>G (p.Tyr3098Ter) rs80359200
NM_000059.3(BRCA2):c.92G>A (p.Trp31Ter) rs397508045
NM_000059.3(BRCA2):c.9302T>G (p.Leu3101Arg) rs28897758
NM_000059.3(BRCA2):c.9311_9312insTTAT (p.Lys3104fs) rs886040830
NM_000059.3(BRCA2):c.9317G>A (p.Trp3106Ter) rs80359205
NM_000059.3(BRCA2):c.9318G>A (p.Trp3106Ter) rs771203198
NM_000059.3(BRCA2):c.9329dup (p.Asn3110fs) rs1405341259
NM_000059.3(BRCA2):c.9331_9335delinsCCT (p.Glu3111fs) rs886040831
NM_000059.3(BRCA2):c.9350_9351AT[1] (p.Met3118fs) rs786203318
NM_000059.3(BRCA2):c.9351dup (p.Met3118fs) rs886040833
NM_000059.3(BRCA2):c.9371A>T (p.Asn3124Ile) rs28897759
NM_000059.3(BRCA2):c.9376C>T (p.Gln3126Ter) rs80359210
NM_000059.3(BRCA2):c.9380G>A (p.Trp3127Ter) rs80359211
NM_000059.3(BRCA2):c.9381G>A (p.Trp3127Ter) rs876661242
NM_000059.3(BRCA2):c.9382C>T (p.Arg3128Ter) rs80359212
NM_000059.3(BRCA2):c.9393del (p.Lys3132fs) rs397508049
NM_000059.3(BRCA2):c.93G>A (p.Trp31Ter) rs80359214
NM_000059.3(BRCA2):c.9401del (p.Gly3134fs) rs80359759
NM_000059.3(BRCA2):c.9403del (p.Leu3135fs) rs80359760
NM_000059.3(BRCA2):c.9409_9412del (p.Thr3137fs) rs876659211
NM_000059.3(BRCA2):c.9413dup (p.Leu3138fs) rs876659435
NM_000059.3(BRCA2):c.9431del (p.Ser3144fs) rs397508051
NM_000059.3(BRCA2):c.9433_9434GT[1] (p.Ser3147fs) rs80359763
NM_000059.3(BRCA2):c.9444del (p.Ser3149fs)
NM_000059.3(BRCA2):c.9453_9454AG[1] (p.Glu3152fs) rs80359764
NM_000059.3(BRCA2):c.9453_9454AG[3] (p.Gly3153fs) rs80359764
NM_000059.3(BRCA2):c.9481A>T (p.Lys3161Ter) rs80359222
NM_000059.3(BRCA2):c.9498del (p.Glu3167fs) rs397508055
NM_000059.3(BRCA2):c.9523G>T (p.Glu3175Ter) rs397507430
NM_000059.3(BRCA2):c.956dupA (p.Asn319Lysfs) rs80359770
NM_000059.3(BRCA2):c.9572G>A (p.Trp3191Ter) rs397508063
NM_000059.3(BRCA2):c.9599C>G (p.Ser3200Ter) rs80359230
NM_000059.3(BRCA2):c.959del (p.Leu320fs) rs1060502454
NM_000059.3(BRCA2):c.961C>T (p.Gln321Ter) rs80359234
NM_000059.3(BRCA2):c.9666del (p.Cys3222fs) rs80359772
NM_000059.3(BRCA2):c.9667G>T (p.Glu3223Ter)
NM_000059.3(BRCA2):c.9672del (p.Tyr3225fs)
NM_000059.3(BRCA2):c.9672dup (p.Tyr3225fs) rs80359773
NM_000059.3(BRCA2):c.9689del (p.Leu3230fs) rs755175776
NM_000059.3(BRCA2):c.9699_9702del (p.Cys3233fs) rs80359775
NM_000059.3(BRCA2):c.9706A>T (p.Lys3236Ter)
NM_000059.3(BRCA2):c.9748dup (p.Ser3250fs) rs886040850
NM_000059.3(BRCA2):c.9770_9773del (p.Lys3257fs) rs587781772
NM_000059.3(BRCA2):c.9772_9775del (p.Glu3258fs)
NM_000059.3(BRCA2):c.9777delT
NM_000059.3(BRCA2):c.9789_9790del (p.Asn3264fs) rs886040851
NM_000059.3(BRCA2):c.9808del (p.Ala3270fs) rs398122622
NM_000059.3(BRCA2):c.9810dup (p.Asp3272fs) rs1555289966
NM_000059.3(BRCA2):c.9883C>T (p.Gln3295Ter) rs80359247
NM_000059.3(BRCA2):c.9887del (p.Lys3296fs) rs1555289992
NM_000059.3(BRCA2):c.9891_9894dup (p.Gln3299fs) rs730881619
NM_000059.3(BRCA2):c.9895C>T (p.Gln3299Ter) rs1555289997
NM_000059.3(BRCA2):c.9924C>G (p.Tyr3308Ter) rs4987049
NM_000059.3(BRCA2):c.9925G>T (p.Glu3309Ter) rs80359251
NM_000059.3(BRCA2):c.994del (p.Ile332fs) rs80359777
NM_000059.3(BRCA2):c.998dup (p.His334fs) rs397507437
NM_000059.3:c.156_157insALU
NM_000059.3:c.9342_9343insALU
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.