ClinVar Miner

List of variants in gene BRCA2 reported as pathogenic for Hereditary cancer-predisposing syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1006
Download table as spreadsheet
NM_000059.3(BRCA2):c.100G>T (p.Glu34Ter) rs80358391
NM_000059.3(BRCA2):c.1029delA (p.Lys343Asnfs) rs80359260
NM_000059.3(BRCA2):c.1054dupT (p.Tyr352Leufs) rs80359261
NM_000059.3(BRCA2):c.106_109delTCTT (p.Ser36Glnfs) rs1555280340
NM_000059.3(BRCA2):c.1103C>A (p.Ser368Ter) rs80358407
NM_000059.3(BRCA2):c.1134delT (p.Ser378Argfs) rs876658589
NM_000059.3(BRCA2):c.1138delA (p.Ser380Valfs) rs80359264
NM_000059.3(BRCA2):c.1147delA (p.Ile383Serfs) rs80359265
NM_000059.3(BRCA2):c.1153A>T (p.Lys385Ter) rs80358411
NM_000059.3(BRCA2):c.1163_1166dupTACC (p.Ser390Thrfs) rs786202789
NM_000059.3(BRCA2):c.1164_1168delACCGT (p.Pro389Phefs) rs886038061
NM_000059.3(BRCA2):c.1179T>A (p.Cys393Ter) rs786201237
NM_000059.3(BRCA2):c.1189_1190insTTAG (p.Gln397Leufs) rs397515635
NM_000059.3(BRCA2):c.1205delG (p.Gly402Valfs) rs397507265
NM_000059.3(BRCA2):c.1219C>T (p.Gln407Ter) rs781079248
NM_000059.3(BRCA2):c.1219delC (p.Gln407Argfs) rs80359267
NM_000059.3(BRCA2):c.1237delC (p.Leu413Tyrfs) rs886040351
NM_000059.3(BRCA2):c.1238delT (p.Leu413Hisfs) rs80359271
NM_000059.3(BRCA2):c.1257delT (p.Cys419Trpfs) rs80359272
NM_000059.3(BRCA2):c.1261C>T (p.Gln421Ter) rs80358419
NM_000059.3(BRCA2):c.1265delA (p.Asn422Ilefs) rs80359273
NM_000059.3(BRCA2):c.1278delA (p.Asp427Thrfs) rs80359274
NM_000059.3(BRCA2):c.1286T>G (p.Leu429Ter) rs886040356
NM_000059.3(BRCA2):c.1296_1297delGA (p.Asn433Glnfs) rs80359276
NM_000059.3(BRCA2):c.1308_1309delGA (p.Lys437Argfs) rs786201950
NM_000059.3(BRCA2):c.1310_1313delAAGA (p.Lys437Ilefs) rs80359277
NM_000059.3(BRCA2):c.1325C>G (p.Ser442Ter) rs80358421
NM_000059.3(BRCA2):c.1329delG (p.Asn444Ilefs) rs869320781
NM_000059.3(BRCA2):c.1389_1390delAG (p.Val464Glyfs) rs80359283
NM_000059.3(BRCA2):c.1393delG (p.Val465Terfs) rs1555281890
NM_000059.3(BRCA2):c.1399A>T (p.Lys467Ter) rs80358427
NM_000059.3(BRCA2):c.1405_1406delGA (p.Asp469Terfs) rs397507586
NM_000059.3(BRCA2):c.1408dupG (p.Glu470Glyfs) rs80359284
NM_000059.3(BRCA2):c.1411G>T (p.Glu471Ter) rs80358428
NM_000059.3(BRCA2):c.1414C>T (p.Gln472Ter) rs80358429
NM_000059.3(BRCA2):c.1428_1431delTCAT (p.His477Glnfs) rs587781804
NM_000059.3(BRCA2):c.1447dupG (p.Ala483Glyfs) rs587782611
NM_000059.3(BRCA2):c.144delA (p.Glu49Asnfs) rs864622434
NM_000059.3(BRCA2):c.1456C>T (p.Gln486Ter) rs80358434
NM_000059.3(BRCA2):c.145G>T (p.Glu49Ter) rs80358435
NM_000059.3(BRCA2):c.1490C>G (p.Ser497Ter) rs1064794018
NM_000059.3(BRCA2):c.1496_1497delAG (p.Gln499Argfs) rs80359285
NM_000059.3(BRCA2):c.1499delG (p.Gly500Valfs) rs397507591
NM_000059.3(BRCA2):c.1511_1512delCT (p.Ser504Tyrfs) rs80359286
NM_000059.3(BRCA2):c.1514delT (p.Ile505Asnfs) rs397507592
NM_000059.3(BRCA2):c.1532C>A (p.Ser511Ter) rs1555281935
NM_000059.3(BRCA2):c.1536_1537dup (p.Lys513Ilefs) rs1555281937
NM_000059.3(BRCA2):c.1552delG (p.Ala518Glnfs) rs786201986
NM_000059.3(BRCA2):c.1560_1561delTT (p.Ser521Argfs) rs886040374
NM_000059.3(BRCA2):c.1570_1571delAT (p.Met524Aspfs) rs863224824
NM_000059.3(BRCA2):c.1588A>T (p.Lys530Ter) rs879255325
NM_000059.3(BRCA2):c.1593dupA (p.Glu532Argfs) rs397507272
NM_000059.3(BRCA2):c.161delA (p.Asn54Thrfs) rs878853297
NM_000059.3(BRCA2):c.1631_1632delCT (p.Thr544Serfs) rs80359295
NM_000059.3(BRCA2):c.1642C>T (p.Gln548Ter) rs398122729
NM_000059.3(BRCA2):c.1654delT (p.Ser552Profs) rs80359297
NM_000059.3(BRCA2):c.1668_1671delTTTAinsATT (p.Asn556Lysfs) rs483353110
NM_000059.3(BRCA2):c.1670T>G (p.Leu557Ter) rs80358452
NM_000059.3(BRCA2):c.1673_1677delTTGAT (p.Ile558Lysfs) rs1555282011
NM_000059.3(BRCA2):c.1689G>A (p.Trp563Ter) rs80358456
NM_000059.3(BRCA2):c.1689delG (p.Trp563Cysfs) rs876659278
NM_000059.3(BRCA2):c.1696delA (p.Thr566Profs) rs1555282016
NM_000059.3(BRCA2):c.1707_1708delGA (p.Asn570Phefs) rs886040384
NM_000059.3(BRCA2):c.171C>A (p.Tyr57Ter) rs201523522
NM_000059.3(BRCA2):c.171C>G (p.Tyr57Ter) rs201523522
NM_000059.3(BRCA2):c.1733delG (p.Gly578Valfs) rs879255326
NM_000059.3(BRCA2):c.1736T>G (p.Leu579Ter) rs1131692274
NM_000059.3(BRCA2):c.1748T>A (p.Leu583Ter) rs397507604
NM_000059.3(BRCA2):c.1755_1759delGAAAA (p.Lys585Asnfs) rs80359302
NM_000059.3(BRCA2):c.1756A>T (p.Lys586Ter) rs397507275
NM_000059.3(BRCA2):c.1763_1766delATAA (p.Asn588Serfs) rs80359303
NM_000059.3(BRCA2):c.176delC (p.Pro59Glnfs) rs876660504
NM_000059.3(BRCA2):c.1773_1776delTTAT (p.Ile591Metfs) rs80359304
NM_000059.3(BRCA2):c.1792delA (p.Thr598Hisfs) rs886040389
NM_000059.3(BRCA2):c.1796_1800delCTTAT (p.Ser599Terfs) rs276174813
NM_000059.3(BRCA2):c.1798_1802delTATAA (p.Tyr600Argfs) rs886040390
NM_000059.3(BRCA2):c.1800T>A (p.Tyr600Ter) rs80358464
NM_000059.3(BRCA2):c.1800T>G (p.Tyr600Ter) rs80358464
NM_000059.3(BRCA2):c.1813delA (p.Ile605Tyrfs) rs80359306
NM_000059.3(BRCA2):c.1813dupA (p.Ile605Asnfs) rs397507277
NM_000059.3(BRCA2):c.1817_1819delCGAinsTTT (p.Pro606_Lys607delinsLeuTer) rs587779358
NM_000059.3(BRCA2):c.1831delT (p.Ser611Glnfs) rs80359311
NM_000059.3(BRCA2):c.1832C>A (p.Ser611Ter) rs80358474
NM_000059.3(BRCA2):c.1842dupT (p.Asn615Terfs) rs80359312
NM_000059.3(BRCA2):c.1844delA (p.Asn615Thrfs) rs1555282120
NM_000059.3(BRCA2):c.1850C>A (p.Ser617Ter) rs397507278
NM_000059.3(BRCA2):c.1850C>G (p.Ser617Ter) rs397507278
NM_000059.3(BRCA2):c.1854delCinsAA (p.Gln619Thrfs) rs276174815
NM_000059.3(BRCA2):c.1855C>T (p.Gln619Ter) rs80358476
NM_000059.3(BRCA2):c.1855delC (p.Gln619Serfs) rs397507611
NM_000059.3(BRCA2):c.1888dupA (p.Thr630Asnfs) rs80359314
NM_000059.3(BRCA2):c.1889delC (p.Thr630Asnfs) rs80359315
NM_000059.3(BRCA2):c.1929delG (p.Arg645Glufs) rs80359316
NM_000059.3(BRCA2):c.1943delC (p.Ser648Tyrfs) rs876658660
NM_000059.3(BRCA2):c.1945C>T (p.Gln649Ter) rs398122735
NM_000059.3(BRCA2):c.1960G>T (p.Glu654Ter) rs786203845
NM_000059.3(BRCA2):c.196C>T (p.Gln66Ter) rs397507617
NM_000059.3(BRCA2):c.1970T>A (p.Leu657Ter) rs397507279
NM_000059.3(BRCA2):c.1992delG (p.Thr665Glnfs) rs1555282390
NM_000059.3(BRCA2):c.2025_2026del (p.Cys676Phefs) rs886040402
NM_000059.3(BRCA2):c.2036delA (p.Asn679Ilefs) rs80359318
NM_000059.3(BRCA2):c.2059_2063delGATTA (p.Asp687Terfs) rs587782780
NM_000059.3(BRCA2):c.2092delC (p.Leu698Tyrfs) rs80359322
NM_000059.3(BRCA2):c.2095C>T (p.Gln699Ter) rs878853559
NM_000059.3(BRCA2):c.2103_2106delTATT (p.Phe701Leufs) rs80359324
NM_000059.3(BRCA2):c.2105_2106delTT (p.Ile702Asnfs) rs1555282454
NM_000059.3(BRCA2):c.2151T>A (p.Cys717Ter) rs876660512
NM_000059.3(BRCA2):c.217delC (p.Gln73Serfs) rs1555280383
NM_000059.3(BRCA2):c.2212dupT (p.Cys738Leufs) rs80359325
NM_000059.3(BRCA2):c.2214T>A (p.Cys738Ter) rs398122742
NM_000059.3(BRCA2):c.2224C>T (p.Gln742Ter) rs80358494
NM_000059.3(BRCA2):c.2231C>A (p.Ser744Ter) rs397507282
NM_000059.3(BRCA2):c.2231C>G (p.Ser744Ter) rs397507282
NM_000059.3(BRCA2):c.2235delA (p.Val746Trpfs) rs1060502484
NM_000059.3(BRCA2):c.2244C>G (p.Tyr748Ter) rs1555282563
NM_000059.3(BRCA2):c.2251dupA (p.Thr751Asnfs) rs886040416
NM_000059.3(BRCA2):c.2256delC (p.Gln754Asnfs) rs876659318
NM_000059.3(BRCA2):c.2261_2264delAATC (p.Gln754Profs) rs1555282584
NM_000059.3(BRCA2):c.2266C>T (p.Gln756Ter) rs1057518637
NM_000059.3(BRCA2):c.2269A>T (p.Lys757Ter) rs886040419
NM_000059.3(BRCA2):c.2272delA (p.Ser758Valfs) rs886040420
NM_000059.3(BRCA2):c.2279T>G (p.Leu760Ter) rs757410810
NM_000059.3(BRCA2):c.2287delC (p.His763Metfs) rs80359327
NM_000059.3(BRCA2):c.2312T>G (p.Leu771Ter) rs587782095
NM_000059.3(BRCA2):c.2330dupA (p.Asp777Glufs) rs80359328
NM_000059.3(BRCA2):c.2339C>G (p.Ser780Ter) rs587781471
NM_000059.3(BRCA2):c.2376C>A (p.Tyr792Ter) rs80358503
NM_000059.3(BRCA2):c.2376C>G (p.Tyr792Ter) rs80358503
NM_000059.3(BRCA2):c.2380dupA (p.Met794Asnfs) rs730881602
NM_000059.3(BRCA2):c.2409T>G (p.Tyr803Ter) rs80358504
NM_000059.3(BRCA2):c.2426T>G (p.Leu809Ter) rs397507285
NM_000059.3(BRCA2):c.2435delA (p.Asn812Ilefs) rs80359329
NM_000059.3(BRCA2):c.2435dupA (p.Asn812Lysfs) rs80359329
NM_000059.3(BRCA2):c.2442delC (p.Met815Trpfs) rs397507627
NM_000059.3(BRCA2):c.2454_2457delTCAA (p.Asn818Lysfs) rs1555282680
NM_000059.3(BRCA2):c.247G>T (p.Glu83Ter) rs886040428
NM_000059.3(BRCA2):c.2480dupA (p.Asn827Lysfs) rs397507286
NM_000059.3(BRCA2):c.2490_2491insT (p.Val831Cysfs) rs886040430
NM_000059.3(BRCA2):c.2494G>T (p.Glu832Ter) rs786202875
NM_000059.3(BRCA2):c.2501delT (p.Leu834Cysfs) rs876659862
NM_000059.3(BRCA2):c.250C>T (p.Gln84Ter) rs80358515
NM_000059.3(BRCA2):c.2517C>A (p.Tyr839Ter) rs80358516
NM_000059.3(BRCA2):c.2564_2565delCA (p.Thr855Lysfs) rs80359334
NM_000059.3(BRCA2):c.2570dupT (p.Arg858Lysfs) rs587782361
NM_000059.3(BRCA2):c.2581C>T (p.Gln861Ter) rs773356478
NM_000059.3(BRCA2):c.2588dupA (p.Asn863Lysfs) rs80359335
NM_000059.3(BRCA2):c.2596G>T (p.Glu866Ter) rs864622476
NM_000059.3(BRCA2):c.2603delC (p.Thr868Ilefs) rs276174824
NM_000059.3(BRCA2):c.2606C>G (p.Ser869Ter) rs80358523
NM_000059.3(BRCA2):c.2611dupT (p.Ser871Phefs) rs876658929
NM_000059.3(BRCA2):c.2612C>A (p.Ser871Ter) rs397507634
NM_000059.3(BRCA2):c.2612C>G (p.Ser871Ter) rs397507634
NM_000059.3(BRCA2):c.2623_2624delGT (p.Val875Glnfs) rs876658928
NM_000059.3(BRCA2):c.262_263delCT (p.Leu88Alafs) rs276174825
NM_000059.3(BRCA2):c.2641G>T (p.Glu881Ter) rs876658648
NM_000059.3(BRCA2):c.2651C>G (p.Ser884Ter) rs777421358
NM_000059.3(BRCA2):c.2653_2656delGACA (p.Asp885Metfs) rs80359340
NM_000059.3(BRCA2):c.2670delT (p.Phe890Leufs) rs1555282786
NM_000059.3(BRCA2):c.26delC (p.Pro9Glnfs) rs80359343
NM_000059.3(BRCA2):c.270_273dup (p.Gln92Valfs) rs1555280423
NM_000059.3(BRCA2):c.2716dupA (p.Thr906Asnfs) rs876659767
NM_000059.3(BRCA2):c.271_272delTA (p.Tyr91Profs) rs886040441
NM_000059.3(BRCA2):c.2731delG (p.Glu911Lysfs) rs80359344
NM_000059.3(BRCA2):c.274C>T (p.Gln92Ter) rs80358529
NM_000059.3(BRCA2):c.2786dupT (p.Leu929Phefs) rs80359347
NM_000059.3(BRCA2):c.2808_2811del (p.Ala938Profs) rs80359351
NM_000059.3(BRCA2):c.2808delA (p.Lys936Asnfs) rs398122753
NM_000059.3(BRCA2):c.2818C>T (p.Gln940Ter) rs80358532
NM_000059.3(BRCA2):c.2830A>T (p.Lys944Ter) rs80358533
NM_000059.3(BRCA2):c.2833_2834insTT (p.Lys945Ilefs) rs80359355
NM_000059.3(BRCA2):c.2835dupA (p.Asp946Argfs) rs80359356
NM_000059.3(BRCA2):c.2836_2837delGA (p.Asp946Phefs) rs80359357
NM_000059.3(BRCA2):c.2836delG (p.Asp946Ilefs) rs80359358
NM_000059.3(BRCA2):c.2847T>A (p.Tyr949Ter) rs886040449
NM_000059.3(BRCA2):c.2899_2900delCT (p.Leu967Argfs) rs80359361
NM_000059.3(BRCA2):c.289G>T (p.Glu97Ter) rs397507646
NM_000059.3(BRCA2):c.2918C>A (p.Ser973Ter) rs397507296
NM_000059.3(BRCA2):c.2957_2958insG (p.Asn986Lysfs) rs1555282969
NM_000059.3(BRCA2):c.2957delA (p.Asn986Ilefs) rs80359365
NM_000059.3(BRCA2):c.2957dupA (p.Asn986Lysfs) rs80359365
NM_000059.3(BRCA2):c.2960dupA (p.Asn987Lysfs) rs886040455
NM_000059.3(BRCA2):c.2971_2983delAACAAATGGGCAG (p.Asn991Aspfs) rs886040456
NM_000059.3(BRCA2):c.2979G>A (p.Trp993Ter) rs80358544
NM_000059.3(BRCA2):c.2T>C (p.Met1Thr) rs80358547
NM_000059.3(BRCA2):c.2T>G (p.Met1Arg) rs80358547
NM_000059.3(BRCA2):c.3009_3010delCA (p.His1003Glnfs) rs397507300
NM_000059.3(BRCA2):c.3018delA (p.Gly1007Valfs) rs397507651
NM_000059.3(BRCA2):c.3059_3060delCT (p.Ser1020Terfs) rs876661270
NM_000059.3(BRCA2):c.3067_3071delAACAT (p.Asn1023Terfs) rs80359369
NM_000059.3(BRCA2):c.3068delA (p.Asn1023Thrfs) rs80359368
NM_000059.3(BRCA2):c.3069delC (p.Asn1023Lysfs) rs876658555
NM_000059.3(BRCA2):c.3075_3076delGAinsTT (p.Lys1025_Lys1026delinsAsnTer) rs587779362
NM_000059.3(BRCA2):c.3100_3101delAT (p.Ile1034Terfs) rs1555283051
NM_000059.3(BRCA2):c.3103G>T (p.Glu1035Ter) rs80358556
NM_000059.3(BRCA2):c.3106G>T (p.Glu1036Ter) rs1060502449
NM_000059.3(BRCA2):c.3109C>T (p.Gln1037Ter) rs80358557
NM_000059.3(BRCA2):c.314T>G (p.Leu105Ter) rs80358561
NM_000059.3(BRCA2):c.3158T>G (p.Leu1053Ter) rs41293477
NM_000059.3(BRCA2):c.316+2T>C rs81002805
NM_000059.3(BRCA2):c.316+5G>A rs81002840
NM_000059.3(BRCA2):c.3160_3163delGATA (p.Asp1054Ilefs) rs80359371
NM_000059.3(BRCA2):c.3165_3167delTCAinsCC (p.Lys1057Argfs) rs1555283072
NM_000059.3(BRCA2):c.3166C>T (p.Gln1056Ter) rs79728106
NM_000059.3(BRCA2):c.3167_3170delAAAA (p.Gln1056Argfs) rs80359372
NM_000059.3(BRCA2):c.3170_3174delAGAAA (p.Lys1057Thrfs) rs80359373
NM_000059.3(BRCA2):c.3174dup (p.Leu1059Thrfs) rs1555283079
NM_000059.3(BRCA2):c.3176_3177delTG (p.Leu1059Glnfs) rs587782022
NM_000059.3(BRCA2):c.3187_3188insG (p.Gln1063Argfs) rs1555283086
NM_000059.3(BRCA2):c.3189_3192delGTCA (p.Ser1064Leufs) rs80359374
NM_000059.3(BRCA2):c.3191C>A (p.Ser1064Ter) rs864622609
NM_000059.3(BRCA2):c.3195_3198delTAAT (p.Asn1066Leufs) rs80359375
NM_000059.3(BRCA2):c.3195delT (p.Asn1066Ilefs) rs397507657
NM_000059.3(BRCA2):c.3199delA (p.Thr1067Leufs) rs80359377
NM_000059.3(BRCA2):c.3201delT (p.Val1068Tyrfs) rs864622672
NM_000059.3(BRCA2):c.3217C>T (p.Gln1073Ter) rs886040464
NM_000059.3(BRCA2):c.3226_3230delGTAGT (p.Val1076Cysfs) rs397507659
NM_000059.3(BRCA2):c.3244A>T (p.Lys1082Ter) rs886040465
NM_000059.3(BRCA2):c.3257_3258delTA (p.Ile1086Asnfs) rs876658618
NM_000059.3(BRCA2):c.3264dupT (p.Gln1089Serfs) rs80359380
NM_000059.3(BRCA2):c.3265C>T (p.Gln1089Ter) rs80358573
NM_000059.3(BRCA2):c.3270delG (p.Met1090Ilefs) rs1555283134
NM_000059.3(BRCA2):c.3296C>A (p.Ser1099Ter) rs397507663
NM_000059.3(BRCA2):c.32_33delTTinsA (p.Phe11Tyrfs) rs1555280102
NM_000059.3(BRCA2):c.3319C>T (p.Gln1107Ter) rs80358578
NM_000059.3(BRCA2):c.3323delA (p.Lys1108Argfs) rs869320782
NM_000059.3(BRCA2):c.3335delC (p.Thr1112Lysfs) rs886040470
NM_000059.3(BRCA2):c.3351delA (p.Leu1118Terfs) rs587781436
NM_000059.3(BRCA2):c.3353_3355delTAG (p.Leu1118_Lys1453delinsTer) rs786203329
NM_000059.3(BRCA2):c.3358delG (p.Glu1120Asnfs) rs587782672
NM_000059.3(BRCA2):c.3362C>A (p.Ser1121Ter) rs80358579
NM_000059.3(BRCA2):c.3362C>G (p.Ser1121Ter) rs80358579
NM_000059.3(BRCA2):c.3365delG (p.Gly1122Glufs) rs786202160
NM_000059.3(BRCA2):c.3385C>T (p.Gln1129Ter) rs1555283209
NM_000059.3(BRCA2):c.3386dupA (p.Phe1130Valfs) rs431825305
NM_000059.3(BRCA2):c.3396delA (p.Lys1132Asnfs) rs876658427
NM_000059.3(BRCA2):c.3405C>A (p.Tyr1135Ter) rs876659258
NM_000059.3(BRCA2):c.3411dupG (p.Gln1138Alafs) rs587781850
NM_000059.3(BRCA2):c.3412C>T (p.Gln1138Ter) rs587782613
NM_000059.3(BRCA2):c.342dup (p.Lys115Terfs) rs1555280845
NM_000059.3(BRCA2):c.3436G>T (p.Glu1146Ter) rs1237049560
NM_000059.3(BRCA2):c.3450dupT (p.Ile1151Tyrfs) rs397507668
NM_000059.3(BRCA2):c.3452_3455delTCTT (p.Ile1151Lysfs) rs1555283249
NM_000059.3(BRCA2):c.3454_3455dup (p.Leu1152Phefs) rs80359385
NM_000059.3(BRCA2):c.3455T>A (p.Leu1152Ter) rs80358593
NM_000059.3(BRCA2):c.3455T>G (p.Leu1152Ter) rs80358593
NM_000059.3(BRCA2):c.3458delA (p.Lys1153Argfs) rs80359386
NM_000059.3(BRCA2):c.3481_3482dupGA (p.Asp1161Glufs) rs878853569
NM_000059.3(BRCA2):c.3500_3501delTA (p.Ile1167Asnfs) rs80359387
NM_000059.3(BRCA2):c.3545_3546delTT (p.Phe1182Terfs) rs80359388
NM_000059.3(BRCA2):c.3554_3555delCA (p.Thr1185Serfs) rs80359389
NM_000059.3(BRCA2):c.3599_3600delGT (p.Cys1200Terfs) rs80359391
NM_000059.3(BRCA2):c.3620_3621dup (p.Leu1208Ilefs) rs1555283311
NM_000059.3(BRCA2):c.3628_3629delGA (p.Asp1210Terfs) rs1555283318
NM_000059.3(BRCA2):c.3636_3639delTGAA (p.Asn1212Lysfs) rs876659656
NM_000059.3(BRCA2):c.3678dup (p.Leu1227Thrfs) rs1555283351
NM_000059.3(BRCA2):c.3679_3683delCTGAA (p.Leu1227Cysfs) rs1555283355
NM_000059.3(BRCA2):c.367_370delAAAA (p.Lys123Trpfs) rs1555280854
NM_000059.3(BRCA2):c.3680_3681delTG (p.Leu1227Glnfs) rs80359395
NM_000059.3(BRCA2):c.3682_3685delAATG (p.Asn1228Phefs) rs80359396
NM_000059.3(BRCA2):c.3689delC (p.Ser1230Leufs) rs3
NM_000059.3(BRCA2):c.369_371delAATinsTA (p.Lys123Asnfs) rs1555280855
NM_000059.3(BRCA2):c.3710delC (p.Ala1237Valfs) rs1555283371
NM_000059.3(BRCA2):c.3717delA (p.Lys1239Asnfs) rs80359401
NM_000059.3(BRCA2):c.3720_3721delGT (p.Phe1241Terfs) rs1555283373
NM_000059.3(BRCA2):c.3723delT (p.Phe1241Leufs) rs886040491
NM_000059.3(BRCA2):c.3724dupA (p.Ser1242Lysfs) rs886040492
NM_000059.3(BRCA2):c.3744_3747delTGAG (p.Ser1248Argfs) rs80359403
NM_000059.3(BRCA2):c.3751dupA (p.Thr1251Asnfs) rs397507683
NM_000059.3(BRCA2):c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA (p.Glu1254Valfs) rs1555283391
NM_000059.3(BRCA2):c.3785C>G (p.Ser1262Ter) rs80358620
NM_000059.3(BRCA2):c.3811delT (p.Ser1271Glnfs) rs1555283405
NM_000059.3(BRCA2):c.3820_3823delAAGA (p.Lys1274Terfs) rs730881620
NM_000059.3(BRCA2):c.3836dupA (p.Asn1279Lysfs) rs397507690
NM_000059.3(BRCA2):c.3847_3848delGT (p.Val1283Lysfs) rs80359405
NM_000059.3(BRCA2):c.3859_3860delAA (p.Asn1287Terfs) rs80359406
NM_000059.3(BRCA2):c.3860_3863delATAA (p.Asn1287Ilefs) rs80359410
NM_000059.3(BRCA2):c.3860delA (p.Asn1287Ilefs) rs80359406
NM_000059.3(BRCA2):c.3860dupA (p.Asn1287Lysfs) rs80359406
NM_000059.3(BRCA2):c.3865_3868delAAAT (p.Lys1289Alafs) rs80359412
NM_000059.3(BRCA2):c.3866_3868dup (p.Cys1290_Thr1624delinsTer) rs1555283442
NM_000059.3(BRCA2):c.3870C>A (p.Cys1290Ter) rs1555283445
NM_000059.3(BRCA2):c.3881T>G (p.Leu1294Ter) rs80358632
NM_000059.3(BRCA2):c.3915delT (p.Phe1305Leufs) rs397507698
NM_000059.3(BRCA2):c.3922G>T (p.Glu1308Ter) rs80358638
NM_000059.3(BRCA2):c.3939C>G (p.Tyr1313Ter) rs80358641
NM_000059.3(BRCA2):c.3940_3941delAA (p.Lys1314Glufs) rs1555283479
NM_000059.3(BRCA2):c.3958G>T (p.Glu1320Ter) rs80358644
NM_000059.3(BRCA2):c.3967A>T (p.Lys1323Ter) rs80358648
NM_000059.3(BRCA2):c.3975_3978dupTGCT (p.Ala1327Cysfs) rs397515636
NM_000059.3(BRCA2):c.3G>A (p.Met1Ile) rs80358650
NM_000059.3(BRCA2):c.3delG (p.Met1Ilefs) rs80359418
NM_000059.3(BRCA2):c.4003G>T (p.Glu1335Ter) rs747070579
NM_000059.3(BRCA2):c.4007_4008insCATC (p.Asp1337Ilefs) rs878853577
NM_000059.3(BRCA2):c.4013_4014delGC (p.Gly1338Glufs) rs1555283504
NM_000059.3(BRCA2):c.4030_4035delAATGATinsC (p.Asn1344Hisfs) rs886040509
NM_000059.3(BRCA2):c.4037_4038delCT (p.Thr1346Serfs) rs80359421
NM_000059.3(BRCA2):c.403_410dup (p.Cys138Terfs)
NM_000059.3(BRCA2):c.4048_4051delCATA (p.His1350Lysfs) rs80359423
NM_000059.3(BRCA2):c.4058_4062delAAACG (p.Glu1353Glyfs) rs397507322
NM_000059.3(BRCA2):c.407delA (p.Asn136Ilefs) rs80359425
NM_000059.3(BRCA2):c.4092_4093delAT (p.Ile1364Metfs) rs80359426
NM_000059.3(BRCA2):c.4092_4093insAA (p.Cys1365Asnfs) rs876658329
NM_000059.3(BRCA2):c.4095T>A (p.Cys1365Ter) rs80358658
NM_000059.3(BRCA2):c.4111C>T (p.Gln1371Ter) rs80358659
NM_000059.3(BRCA2):c.4112dupA (p.Phe1372Valfs) rs730881606
NM_000059.3(BRCA2):c.4127_4130delGAAA (p.Gly1376Alafs) rs397507323
NM_000059.3(BRCA2):c.4131_4132insTGAGGA (p.Thr1378_Gly1712delinsTer) rs80359429
NM_000059.3(BRCA2):c.4133_4136delCTCA (p.Thr1378Argfs) rs80359430
NM_000059.3(BRCA2):c.4135delC (p.Gln1379Argfs) rs1555283588
NM_000059.3(BRCA2):c.4139_4140dupTT (p.Lys1381Leufs) rs276174842
NM_000059.3(BRCA2):c.413_417delGTCTT (p.Cys138Terfs) rs876658850
NM_000059.3(BRCA2):c.4163_4164delCTinsA (p.Thr1388Asnfs) rs276174843
NM_000059.3(BRCA2):c.4169dupT (p.Leu1390Phefs) rs80359433
NM_000059.3(BRCA2):c.4177dupG (p.Ala1393Glyfs) rs876659977
NM_000059.3(BRCA2):c.4188delA (p.Glu1397Lysfs) rs80359434
NM_000059.3(BRCA2):c.4211C>G (p.Ser1404Ter) rs41293489
NM_000059.3(BRCA2):c.4211_4215delCAAAT (p.Ser1404Terfs) rs786203340
NM_000059.3(BRCA2):c.4211delC (p.Ser1404Terfs) rs398122777
NM_000059.3(BRCA2):c.4222C>T (p.Gln1408Ter) rs80358663
NM_000059.3(BRCA2):c.4243G>T (p.Glu1415Ter) rs397507327
NM_000059.3(BRCA2):c.4245delG (p.Glu1415Aspfs) rs767234936
NM_000059.3(BRCA2):c.4246C>T (p.Gln1416Ter) rs786202421
NM_000059.3(BRCA2):c.4258delG (p.Asp1420Ilefs) rs80359436
NM_000059.3(BRCA2):c.4263dupT (p.Glu1422Terfs) rs1555283664
NM_000059.3(BRCA2):c.4276dupA (p.Thr1426Asnfs) rs80359438
NM_000059.3(BRCA2):c.4284dupT (p.Gln1429Serfs) rs80359439
NM_000059.3(BRCA2):c.4285C>T (p.Gln1429Ter) rs80358665
NM_000059.3(BRCA2):c.428delC (p.Pro143Leufs) rs886040519
NM_000059.3(BRCA2):c.429delT (p.Val144Leufs) rs587781945
NM_000059.3(BRCA2):c.4325C>A (p.Ser1442Ter) rs80358670
NM_000059.3(BRCA2):c.4325C>G (p.Ser1442Ter) rs80358670
NM_000059.3(BRCA2):c.4339delG (p.Val1447Terfs) rs80359443
NM_000059.3(BRCA2):c.4363G>T (p.Glu1455Ter)
NM_000059.3(BRCA2):c.4366G>T (p.Glu1456Ter) rs876659847
NM_000059.3(BRCA2):c.4383_4384delCT (p.Leu1462Lysfs) rs876660510
NM_000059.3(BRCA2):c.4398_4402delACATT (p.Leu1466Phefs) rs80359444
NM_000059.3(BRCA2):c.4405_4409delGACAT (p.Asp1469Lysfs) rs397507331
NM_000059.3(BRCA2):c.4409_4410delTA (p.Ile1470Lysfs) rs80359446
NM_000059.3(BRCA2):c.4409_4413delTAAGA (p.Ile1470Lysfs) rs397507718
NM_000059.3(BRCA2):c.4411A>T (p.Arg1471Ter) rs1555283772
NM_000059.3(BRCA2):c.4415_4418delAGAA (p.Lys1472Thrfs) rs397507333
NM_000059.3(BRCA2):c.4419delC (p.Asn1473Lysfs) rs1064794337
NM_000059.3(BRCA2):c.4441G>T (p.Glu1481Ter) rs1555283785
NM_000059.3(BRCA2):c.4447delA (p.Thr1483Glnfs) rs876660755
NM_000059.3(BRCA2):c.4449delA (p.Asp1484Thrfs) rs80359448
NM_000059.3(BRCA2):c.4456_4459delGTTA (p.Val1486Asnfs) rs80359449
NM_000059.3(BRCA2):c.4458del (p.Lys1487Asnfs) rs886040532
NM_000059.3(BRCA2):c.4460_4461delAA (p.Lys1487Thrfs) rs876660026
NM_000059.3(BRCA2):c.4470dupA (p.Leu1491Thrfs) rs397507334
NM_000059.3(BRCA2):c.4471_4474delCTGA (p.Leu1491Lysfs) rs80359451
NM_000059.3(BRCA2):c.4472_4475delTGAA (p.Leu1491Glnfs) rs80359452
NM_000059.3(BRCA2):c.4477_4478delGA (p.Glu1493Lysfs) rs786203492
NM_000059.3(BRCA2):c.4478_4481delAAAG (p.Glu1493Valfs) rs80359454
NM_000059.3(BRCA2):c.4515_4525delCTTCCAGGGAC (p.Phe1506Thrfs) rs863224827
NM_000059.3(BRCA2):c.451_452dupGT (p.Thr152Terfs) rs876659317
NM_000059.3(BRCA2):c.4544dup (p.Ile1516Aspfs) rs397507725
NM_000059.3(BRCA2):c.4551_4554delAGAA (p.Lys1517Asnfs) rs80359457
NM_000059.3(BRCA2):c.4552delG (p.Glu1518Asnfs) rs398122783
NM_000059.3(BRCA2):c.4554delA (p.Glu1518Aspfs) rs80359458
NM_000059.3(BRCA2):c.4563_4564delAT (p.Leu1522Glyfs) rs483353115
NM_000059.3(BRCA2):c.4576dupA (p.Thr1526Asnfs) rs886040539
NM_000059.3(BRCA2):c.4588A>T (p.Lys1530Ter) rs80358692
NM_000059.3(BRCA2):c.4615_4616delTT (p.Leu1539Glyfs) rs869320783
NM_000059.3(BRCA2):c.462_463delAA (p.Asp156Terfs) rs80359459
NM_000059.3(BRCA2):c.4631delA (p.Asn1544Thrfs) rs80359460
NM_000059.3(BRCA2):c.4631dupA (p.Asn1544Lysfs) rs80359460
NM_000059.3(BRCA2):c.4633delC (p.Leu1545Phefs) rs876658654
NM_000059.3(BRCA2):c.4638delT (p.Phe1546Leufs) rs80359462
NM_000059.3(BRCA2):c.4647_4650delAGAG (p.Lys1549Asnfs) rs397507734
NM_000059.3(BRCA2):c.4648G>T (p.Glu1550Ter) rs80358695
NM_000059.3(BRCA2):c.4677delT (p.Phe1559Leufs) rs1064794708
NM_000059.3(BRCA2):c.468dup (p.Lys157Terfs) rs1555280955
NM_000059.3(BRCA2):c.4691dupC (p.Thr1566Aspfs) rs786204209
NM_000059.3(BRCA2):c.469_470delAA (p.Lys157Valfs) rs397507739
NM_000059.3(BRCA2):c.4707_4708delCA (p.Tyr1569Terfs) rs1555283911
NM_000059.3(BRCA2):c.470_474delAGTCA (p.Lys157Serfs) rs80359463
NM_000059.3(BRCA2):c.4712_4713delAG (p.Glu1571Glyfs) rs80359464
NM_000059.3(BRCA2):c.4731_4736delATTAGCinsG (p.Leu1578Metfs) rs276174846
NM_000059.3(BRCA2):c.4731delA (p.Glu1577Aspfs) rs397507740
NM_000059.3(BRCA2):c.473C>G (p.Ser158Ter) rs80358701
NM_000059.3(BRCA2):c.475+1G>T rs81002797
NM_000059.3(BRCA2):c.476-2A>G rs81002853
NM_000059.3(BRCA2):c.4780delA (p.Met1594Cysfs) rs397507742
NM_000059.3(BRCA2):c.4821_4823delTGAinsC (p.Glu1608Aspfs) rs587782854
NM_000059.3(BRCA2):c.4829_4830delTG (p.Val1610Glyfs) rs80359468
NM_000059.3(BRCA2):c.4859_4878del (p.Leu1620Serfs)
NM_000059.3(BRCA2):c.486delG (p.Ser163Valfs) rs587780653
NM_000059.3(BRCA2):c.4876_4877delAA (p.Asn1626Serfs) rs80359470
NM_000059.3(BRCA2):c.4884_4885delAA (p.Lys1628Asnfs) rs1555283971
NM_000059.3(BRCA2):c.4889C>G (p.Ser1630Ter) rs80358711
NM_000059.3(BRCA2):c.4894delA (p.Ser1632Valfs) rs1555283980
NM_000059.3(BRCA2):c.489_490insG (p.Leu164Valfs) rs120074205
NM_000059.3(BRCA2):c.4914dupA (p.Val1639Serfs) rs786203494
NM_000059.3(BRCA2):c.4930_4937delGAAAAAGA (p.Glu1644Asnfs) rs886040554
NM_000059.3(BRCA2):c.4935delA (p.Glu1646Lysfs) rs80359472
NM_000059.3(BRCA2):c.4936_4937delGA (p.Glu1646Asnfs) rs431825323
NM_000059.3(BRCA2):c.4936_4939delGAAA (p.Glu1646Glnfs) rs80359473
NM_000059.3(BRCA2):c.4940_4941delCA (p.Thr1647Serfs) rs397507751
NM_000059.3(BRCA2):c.4947_4948delAA (p.Pro1651Cysfs) rs80359474
NM_000059.3(BRCA2):c.4963delT (p.Tyr1655Thrfs) rs886040557
NM_000059.3(BRCA2):c.4964dupA (p.Tyr1655Terfs) rs398122789
NM_000059.3(BRCA2):c.4965C>G (p.Tyr1655Ter) rs80358721
NM_000059.3(BRCA2):c.4976_4977insG (p.Tyr1661Leufs) rs431825325
NM_000059.3(BRCA2):c.5000C>G (p.Ser1667Ter) rs397507346
NM_000059.3(BRCA2):c.5016C>G (p.Tyr1672Ter) rs864622073
NM_000059.3(BRCA2):c.5025T>A (p.Cys1675Ter) rs370591460
NM_000059.3(BRCA2):c.5035delA (p.Thr1679Leufs) rs80359477
NM_000059.3(BRCA2):c.5042_5043delTG (p.Val1681Glufs) rs80359478
NM_000059.3(BRCA2):c.5047C>T (p.Gln1683Ter) rs1555284044
NM_000059.3(BRCA2):c.5054C>G (p.Ser1685Ter) rs398122791
NM_000059.3(BRCA2):c.5065_5066delGCinsAAA (p.Ala1689Lysfs) rs276174852
NM_000059.3(BRCA2):c.5073dupA (p.Trp1692Metfs) rs80359479
NM_000059.3(BRCA2):c.5076delG (p.Trp1692Cysfs) rs876660524
NM_000059.3(BRCA2):c.5110_5113delAGAA (p.Arg1704Terfs) rs879254123
NM_000059.3(BRCA2):c.5116_5119delAATA (p.Asn1706Leufs) rs276174853
NM_000059.3(BRCA2):c.5120delC (p.Thr1707Metfs) rs886039318
NM_000059.3(BRCA2):c.512dupT (p.Lys172Glufs) rs398122793
NM_000059.3(BRCA2):c.5130_5133delTGTA (p.Tyr1710Terfs) rs80359484
NM_000059.3(BRCA2):c.5134G>T (p.Gly1712Ter) rs876661056
NM_000059.3(BRCA2):c.5141_5144delATTT (p.Tyr1714Cysfs) rs80359487
NM_000059.3(BRCA2):c.5146_5149delTATG (p.Tyr1716Lysfs) rs276174854
NM_000059.3(BRCA2):c.5158dupT (p.Ser1720Phefs) rs80359489
NM_000059.3(BRCA2):c.5159C>A (p.Ser1720Ter) rs80358740
NM_000059.3(BRCA2):c.516+1G>A rs397507762
NM_000059.3(BRCA2):c.516+1G>C rs397507762
NM_000059.3(BRCA2):c.5164_5165delAG (p.Ser1722Tyrfs) rs80359490
NM_000059.3(BRCA2):c.517-1G>A rs81002849
NM_000059.3(BRCA2):c.517-2A>G rs81002858
NM_000059.3(BRCA2):c.5171_5172dupTA (p.Ala1725Terfs) rs587782075
NM_000059.3(BRCA2):c.5184_5185delCA (p.Asp1728Glufs) rs1555284094
NM_000059.3(BRCA2):c.518delG (p.Gly173Valfs) rs80359492
NM_000059.3(BRCA2):c.5195delT (p.Leu1732Profs) rs587779363
NM_000059.3(BRCA2):c.5197_5198delTC (p.Ser1733Argfs) rs876660228
NM_000059.3(BRCA2):c.51_52delAC (p.Arg18Leufs) rs80359483
NM_000059.3(BRCA2):c.5205_5208delACAA (p.Gln1736Ilefs) rs886040575
NM_000059.3(BRCA2):c.5205dup (p.Gln1736Thrfs) rs483353082
NM_000059.3(BRCA2):c.5207_5208delAA (p.Gln1736Argfs) rs397507773
NM_000059.3(BRCA2):c.5212dup (p.Thr1738Asnfs)
NM_000059.3(BRCA2):c.5213_5216delCTTA (p.Thr1738Ilefs) rs753870552
NM_000059.3(BRCA2):c.5216dup (p.Tyr1739Terfs) rs886040578
NM_000059.3(BRCA2):c.5217_5220delTTTA (p.Tyr1739Terfs) rs80359494
NM_000059.3(BRCA2):c.5217_5223delTTTAAGT (p.Tyr1739Terfs) rs80359496
NM_000059.3(BRCA2):c.5221_5225delAGTAAinsC (p.Ser1741Profs) rs786202798
NM_000059.3(BRCA2):c.5238dupT (p.Asn1747Terfs) rs80359499
NM_000059.3(BRCA2):c.5241_5242insTA (p.Ser1748Terfs) rs749980674
NM_000059.3(BRCA2):c.5247T>G (p.Tyr1749Ter)
NM_000059.3(BRCA2):c.5254delC (p.His1752Ilefs) rs397507777
NM_000059.3(BRCA2):c.5270_5286del17 (p.Tyr1757Serfs) rs80359502
NM_000059.3(BRCA2):c.5279C>G (p.Ser1760Ter) rs80358751
NM_000059.3(BRCA2):c.5281G>T (p.Gly1761Ter) rs886038122
NM_000059.3(BRCA2):c.5290_5291delTC (p.Ser1764Lysfs) rs80359503
NM_000059.3(BRCA2):c.5303_5304delTT (p.Leu1768Argfs) rs80359505
NM_000059.3(BRCA2):c.5308delT (p.Ser1770Leufs) rs876659236
NM_000059.3(BRCA2):c.5334_5340delTGTTGAA (p.Asn1778Lysfs) rs876658888
NM_000059.3(BRCA2):c.5350_5351delAA (p.Asn1784Hisfs) rs80359507
NM_000059.3(BRCA2):c.5351delA (p.Asn1784Thrfs) rs80359507
NM_000059.3(BRCA2):c.5351dupA (p.Asn1784Lysfs) rs80359507
NM_000059.3(BRCA2):c.5353delA (p.Thr1785Leufs) rs786202385
NM_000059.3(BRCA2):c.5355_5356delTA (p.Ser1786Phefs) rs1555284191
NM_000059.3(BRCA2):c.5357delG (p.Ser1786Ilefs) rs876659482
NM_000059.3(BRCA2):c.5362dupT (p.Ser1788Phefs) rs587781849
NM_000059.3(BRCA2):c.5364dupC (p.Lys1789Glnfs) rs587779364
NM_000059.3(BRCA2):c.537dup (p.Ile180Tyrfs)
NM_000059.3(BRCA2):c.5386_5387delGA (p.Asp1796Cysfs) rs587782598
NM_000059.3(BRCA2):c.538_539delAT (p.Ile180Phefs) rs80359510
NM_000059.3(BRCA2):c.538_539dupAT (p.Ser181Phefs) rs80359510
NM_000059.3(BRCA2):c.5410_5411delGT (p.Val1804Lysfs) rs80359512
NM_000059.3(BRCA2):c.5422_5423delAT (p.Ile1808Leufs) rs587781585
NM_000059.3(BRCA2):c.5434G>T (p.Glu1812Ter) rs80358767
NM_000059.3(BRCA2):c.544G>T (p.Glu182Ter)
NM_000059.3(BRCA2):c.5454delA (p.Cys1820Alafs) rs80359513
NM_000059.3(BRCA2):c.5470_5471delAA (p.Asn1824Cysfs) rs80359515
NM_000059.3(BRCA2):c.5471dupA (p.Asn1824Lysfs) rs80359515
NM_000059.3(BRCA2):c.5482_5486delAAATT (p.Lys1828Valfs) rs80359516
NM_000059.3(BRCA2):c.5496dupT (p.Asn1833Terfs) rs786203853
NM_000059.3(BRCA2):c.5542delA (p.Ser1848Valfs) rs80359519
NM_000059.3(BRCA2):c.5551delA (p.Ile1851Serfs) rs886040594
NM_000059.3(BRCA2):c.5557delT (p.Cys1853Valfs) rs587782011
NM_000059.3(BRCA2):c.5560_5561delGT (p.Val1854Phefs) rs397507787
NM_000059.3(BRCA2):c.5569_5573delGAAAC (p.Glu1857Asnfs) rs397507788
NM_000059.3(BRCA2):c.5576_5579delTTAA (p.Ile1859Lysfs) rs80359520
NM_000059.3(BRCA2):c.5577delT (p.Val1862Terfs) rs397507355
NM_000059.3(BRCA2):c.5578A>T (p.Lys1860Ter) rs431825332
NM_000059.3(BRCA2):c.5583delA (p.Val1862Terfs) rs397507790
NM_000059.3(BRCA2):c.5583dupA (p.Val1862Serfs) rs397507790
NM_000059.3(BRCA2):c.5585_5588delTGAA (p.Val1862Glufs) rs80359523
NM_000059.3(BRCA2):c.5595_5596delAT (p.Phe1866Tyrfs) rs80359524
NM_000059.3(BRCA2):c.5609_5610delTCinsAG (p.Phe1870Ter) rs276174859
NM_000059.3(BRCA2):c.5614A>T (p.Lys1872Ter) rs80358783
NM_000059.3(BRCA2):c.5616_5620delAGTAA (p.Lys1872Asnfs) rs80359525
NM_000059.3(BRCA2):c.5621_5624delTTAA (p.Ile1874Argfs) rs80359526
NM_000059.3(BRCA2):c.5626G>T (p.Glu1876Ter) rs397507793
NM_000059.3(BRCA2):c.5630delA (p.Asn1877Thrfs) rs876660636
NM_000059.3(BRCA2):c.5631delC (p.Asn1877Lysfs) rs397507357
NM_000059.3(BRCA2):c.5635G>T (p.Glu1879Ter) rs55996097
NM_000059.3(BRCA2):c.5641_5644delAAAT (p.Lys1881Glnfs) rs276174860
NM_000059.3(BRCA2):c.5645C>A (p.Ser1882Ter) rs80358785
NM_000059.3(BRCA2):c.5645C>G (p.Ser1882Ter) rs80358785
NM_000059.3(BRCA2):c.5655C>A (p.Cys1885Ter) rs80358789
NM_000059.3(BRCA2):c.5656C>T (p.Gln1886Ter) rs80358790
NM_000059.3(BRCA2):c.5669_5673delTGGCA (p.Met1890Argfs) rs876660311
NM_000059.3(BRCA2):c.5681dupA (p.Tyr1894Terfs) rs80359527
NM_000059.3(BRCA2):c.5682C>A (p.Tyr1894Ter) rs41293497
NM_000059.3(BRCA2):c.5682C>G (p.Tyr1894Ter) rs41293497
NM_000059.3(BRCA2):c.5699C>G (p.Ser1900Ter) rs397507797
NM_000059.3(BRCA2):c.5702_5703delAG (p.Glu1901Glyfs) rs80359528
NM_000059.3(BRCA2):c.5715dupT (p.Asn1906Terfs) rs587782901
NM_000059.3(BRCA2):c.5720_5723delCTCT (p.Ser1907Terfs) rs80359530
NM_000059.3(BRCA2):c.5722_5723delCT (p.Leu1908Argfs) rs80359530
NM_000059.3(BRCA2):c.5723_5724delTA (p.Leu1908Argfs) rs886040608
NM_000059.3(BRCA2):c.574_575delAT (p.Met192Valfs) rs80359533
NM_000059.3(BRCA2):c.5754_5755delTA (p.His1918Glnfs) rs397507803
NM_000059.3(BRCA2):c.5763delT (p.Phe1921Leufs) rs80359534
NM_000059.3(BRCA2):c.5763dupT (p.Ala1922Cysfs) rs80359534
NM_000059.3(BRCA2):c.5771_5774delTTCA (p.Ile1924Argfs) rs80359535
NM_000059.3(BRCA2):c.5773C>T (p.Gln1925Ter) rs80358806
NM_000059.3(BRCA2):c.5782G>T (p.Glu1928Ter) rs56253082
NM_000059.3(BRCA2):c.5789T>G (p.Leu1930Ter) rs397507805
NM_000059.3(BRCA2):c.5791C>T (p.Gln1931Ter) rs80358807
NM_000059.3(BRCA2):c.5796_5797delTA (p.His1932Glnfs) rs80359537
NM_000059.3(BRCA2):c.5799_5802delCCAA (p.Asn1933Lysfs) rs80359538
NM_000059.3(BRCA2):c.5807_5816delTGTCTGGATTinsGTC (p.Met1936Serfs) rs1555284407
NM_000059.3(BRCA2):c.5823delA (p.Val1942Phefs) rs80359540
NM_000059.3(BRCA2):c.5828delC (p.Ser1943Leufs) rs80359541
NM_000059.3(BRCA2):c.582G>A (p.Trp194Ter) rs80358810
NM_000059.3(BRCA2):c.5846delA (p.Asp1949Valfs) rs1555284423
NM_000059.3(BRCA2):c.5851_5854delAGTT (p.Ser1951Trpfs) rs80359543
NM_000059.3(BRCA2):c.5851_5854dupAGTT (p.Leu1952Terfs) rs80359543
NM_000059.3(BRCA2):c.5855T>A (p.Leu1952Ter) rs375064902
NM_000059.3(BRCA2):c.5857G>T (p.Glu1953Ter) rs80358814
NM_000059.3(BRCA2):c.5862_5863delTT (p.Ser1955Argfs) rs786202700
NM_000059.3(BRCA2):c.5864C>A (p.Ser1955Ter) rs80358815
NM_000059.3(BRCA2):c.5864C>G (p.Ser1955Ter) rs80358815
NM_000059.3(BRCA2):c.5909C>A (p.Ser1970Ter) rs80358824
NM_000059.3(BRCA2):c.5909C>G (p.Ser1970Ter) rs80358824
NM_000059.3(BRCA2):c.5911delT (p.Ser1971Leufs) rs1555284457
NM_000059.3(BRCA2):c.5912delC (p.Ser1971Leufs) rs1555284458
NM_000059.3(BRCA2):c.5925T>A (p.Cys1975Ter) rs80358825
NM_000059.3(BRCA2):c.5925delT (p.Cys1975Trpfs) rs1555284465
NM_000059.3(BRCA2):c.5934dupT (p.Ser1979Terfs) rs80359548
NM_000059.3(BRCA2):c.593_596delTAGCinsAGG (p.Leu198Terfs) rs786202156
NM_000059.3(BRCA2):c.5946delT (p.Ser1982Argfs) rs80359550
NM_000059.3(BRCA2):c.5959C>T (p.Gln1987Ter) rs80358828
NM_000059.3(BRCA2):c.5962dup (p.Val1988Glyfs) rs876661236
NM_000059.3(BRCA2):c.5969delA (p.Asp1990Valfs) rs886038135
NM_000059.3(BRCA2):c.5980C>T (p.Gln1994Ter) rs80358831
NM_000059.3(BRCA2):c.5984dupA (p.Asn1995Lysfs) rs397507818
NM_000059.3(BRCA2):c.6024dupG (p.Gln2009Alafs) rs80359554
NM_000059.3(BRCA2):c.6025C>T (p.Gln2009Ter) rs80358838
NM_000059.3(BRCA2):c.6033_6034delTT (p.Ser2012Glnfs) rs397507823
NM_000059.3(BRCA2):c.6036delC (p.Val2014Tyrfs) rs1555284508
NM_000059.3(BRCA2):c.6037A>T (p.Lys2013Ter) rs80358840
NM_000059.3(BRCA2):c.6039delA (p.Val2014Tyrfs) rs876660637
NM_000059.3(BRCA2):c.6044T>A (p.Leu2015Ter) rs587776468
NM_000059.3(BRCA2):c.6059_6062delAACA (p.Glu2020Valfs) rs398122546
NM_000059.3(BRCA2):c.6065C>G (p.Ser2022Ter) rs80358843
NM_000059.3(BRCA2):c.6068_6072delACCAG (p.Asp2023Alafs) rs80359555
NM_000059.3(BRCA2):c.6070C>T (p.Gln2024Ter) rs80358844
NM_000059.3(BRCA2):c.6078_6079delAA (p.Glu2028Argfs) rs80359557
NM_000059.3(BRCA2):c.6079dupA (p.Arg2027Lysfs) rs397507826
NM_000059.3(BRCA2):c.6082_6083delGA (p.Glu2028Argfs) rs886040634
NM_000059.3(BRCA2):c.6082_6086delGAAGA (p.Glu2028Lysfs) rs80359558
NM_000059.3(BRCA2):c.6085G>T (p.Glu2029Ter) rs397507828
NM_000059.3(BRCA2):c.6085delG (p.Glu2029Lysfs) rs1555284533
NM_000059.3(BRCA2):c.6091dupA (p.Thr2031Asnfs) rs587782717
NM_000059.3(BRCA2):c.6096dupT (p.Ile2033Tyrfs) rs397507829
NM_000059.3(BRCA2):c.610delC (p.Ser205Valfs) rs80359560
NM_000059.3(BRCA2):c.6124C>T (p.Gln2042Ter) rs80358851
NM_000059.3(BRCA2):c.6155C>A (p.Ser2052Ter) rs786202461
NM_000059.3(BRCA2):c.6187_6197del11 (p.Gly2063Phefs) rs1555284584
NM_000059.3(BRCA2):c.6201delC (p.Ile2068Phefs) rs80359565
NM_000059.3(BRCA2):c.6202dupA (p.Ile2068Asnfs) rs397507833
NM_000059.3(BRCA2):c.6206T>G (p.Leu2069Ter) rs80358859
NM_000059.3(BRCA2):c.6209_6212delAAAG (p.Glu2070Valfs) rs276174866
NM_000059.3(BRCA2):c.6216delC (p.Leu2073Tyrfs) rs80359567
NM_000059.3(BRCA2):c.6223A>T (p.Lys2075Ter) rs1555284602
NM_000059.3(BRCA2):c.6226_6229delGTTA (p.Val2076Argfs) rs587782799
NM_000059.3(BRCA2):c.6244G>T (p.Glu2082Ter) rs886040642
NM_000059.3(BRCA2):c.6263delC (p.Thr2088Metfs) rs1064794647
NM_000059.3(BRCA2):c.6267_6269delGCAinsC (p.Glu2089Aspfs) rs276174868
NM_000059.3(BRCA2):c.6267_6274delGCATAGTC (p.Glu2089Aspfs) rs876658425
NM_000059.3(BRCA2):c.6270_6271delTA (p.His2090Glnfs) rs80359571
NM_000059.3(BRCA2):c.6275_6276delTT (p.Leu2092Profs) rs11571658
NM_000059.3(BRCA2):c.6305dup (p.Ser2103Ilefs) rs1555284628
NM_000059.3(BRCA2):c.6308C>A (p.Ser2103Ter) rs80358870
NM_000059.3(BRCA2):c.6308C>G (p.Ser2103Ter) rs80358870
NM_000059.3(BRCA2):c.631+1G>A rs81002897
NM_000059.3(BRCA2):c.631+2T>G rs81002899
NM_000059.3(BRCA2):c.6313delA (p.Ile2105Tyrfs) rs886040649
NM_000059.3(BRCA2):c.631G>A (p.Val211Ile) rs80358871
NM_000059.3(BRCA2):c.6327dup (p.Asp2110Terfs) rs1555284637
NM_000059.3(BRCA2):c.6331_6332delAA (p.Lys2111Glufs) rs587781470
NM_000059.3(BRCA2):c.6332dupA (p.Arg2112Glufs) rs876659617
NM_000059.3(BRCA2):c.6335_6336delGA (p.Arg2112Lysfs) rs80359574
NM_000059.3(BRCA2):c.6336_6340delAAACCinsTTT (p.Arg2112Serfs) rs1555284643
NM_000059.3(BRCA2):c.6349dupT (p.Cys2117Leufs) rs587781566
NM_000059.3(BRCA2):c.6351T>A (p.Cys2117Ter) rs876659368
NM_000059.3(BRCA2):c.6352_6353delGT (p.Val2118Lysfs) rs80359576
NM_000059.3(BRCA2):c.6355_6357delAACinsT (p.Asn2119Phefs) rs1555284649
NM_000059.3(BRCA2):c.6359C>G (p.Ser2120Ter) rs397507845
NM_000059.3(BRCA2):c.635_636delGA (p.Arg212Lysfs) rs80359575
NM_000059.3(BRCA2):c.6361_6362delGA (p.Glu2121Asnfs) rs886038144
NM_000059.3(BRCA2):c.6367_6370dupGAAA (p.Lys2124Argfs) rs786203430
NM_000059.3(BRCA2):c.6373delA (p.Thr2125Profs) rs80359577
NM_000059.3(BRCA2):c.6373dupA (p.Thr2125Asnfs) rs80359577
NM_000059.3(BRCA2):c.6379delA (p.Ser2127Valfs) rs1064795216
NM_000059.3(BRCA2):c.6393_6396delATTA (p.Lys2131Asnfs) rs397507849
NM_000059.3(BRCA2):c.6395T>G (p.Leu2132Ter) rs1555284658
NM_000059.3(BRCA2):c.6397dupT (p.Ser2133Phefs) rs431825342
NM_000059.3(BRCA2):c.6405_6409delCTTAA (p.Asn2135Lysfs) rs80359584
NM_000059.3(BRCA2):c.6408_6411dup (p.Val2138Lysfs) rs1555284670
NM_000059.3(BRCA2):c.6408_6414delAAATGTT (p.Asn2137Lysfs) rs397507851
NM_000059.3(BRCA2):c.6428C>A (p.Ser2143Ter) rs149330893
NM_000059.3(BRCA2):c.6434_6441delATAATCAC (p.Asn2145Ilefs) rs397507371
NM_000059.3(BRCA2):c.6443_6444delCT (p.Ser2148Tyrfs) rs80359589
NM_000059.3(BRCA2):c.6444dupT (p.Ile2149Tyrfs) rs80359590
NM_000059.3(BRCA2):c.6446_6447delTT (p.Ile2149Lysfs) rs876660421
NM_000059.3(BRCA2):c.6446_6450delTTAAA (p.Ile2149Serfs) rs80359593
NM_000059.3(BRCA2):c.6447_6448dupTA (p.Lys2150Ilefs) rs397507858
NM_000059.3(BRCA2):c.6450dupA (p.Val2151Serfs) rs80359594
NM_000059.3(BRCA2):c.6458delC (p.Pro2153Hisfs) rs786203660
NM_000059.3(BRCA2):c.6466_6469delTCTC (p.Ser2156Asnfs) rs80359596
NM_000059.3(BRCA2):c.6468_6469delTC (p.Gln2157Ilefs) rs80359596
NM_000059.3(BRCA2):c.6468_6469dup (p.Gln2157Leufs) rs80359596
NM_000059.3(BRCA2):c.6469C>T (p.Gln2157Ter) rs397507859
NM_000059.3(BRCA2):c.6474dup (p.Gln2159Serfs) rs1555284710
NM_000059.3(BRCA2):c.6475C>T (p.Gln2159Ter) rs398122558
NM_000059.3(BRCA2):c.6478C>T (p.Gln2160Ter) rs886040658
NM_000059.3(BRCA2):c.6480delA (p.Asp2161Thrfs) rs1064793471
NM_000059.3(BRCA2):c.6484A>T (p.Lys2162Ter) rs1555284717
NM_000059.3(BRCA2):c.6486_6489delACAA (p.Lys2162Asnfs) rs80359598
NM_000059.3(BRCA2):c.6487C>T (p.Gln2163Ter) rs398122559
NM_000059.3(BRCA2):c.6490C>T (p.Gln2164Ter) rs397507860
NM_000059.3(BRCA2):c.6491_6494delAGTT (p.Gln2164Argfs) rs397507862
NM_000059.3(BRCA2):c.6491delA (p.Gln2164Argfs) rs1135401914
NM_000059.3(BRCA2):c.6513_6514delGT (p.Ser2172Thrfs) rs1555284730
NM_000059.3(BRCA2):c.6531_6534delTCAT (p.Ile2177Metfs) rs397507865
NM_000059.3(BRCA2):c.6531dupT (p.His2178Serfs) rs886040664
NM_000059.3(BRCA2):c.6547G>T (p.Glu2183Ter) rs397507866
NM_000059.3(BRCA2):c.6566dupA (p.Asn2189Lysfs) rs397507373
NM_000059.3(BRCA2):c.6567_6573delCGTAAAA (p.Asn2189Lysfs) rs876660676
NM_000059.3(BRCA2):c.658_659delGT (p.Val220Ilefs) rs80359604
NM_000059.3(BRCA2):c.6591_6592delTG (p.Glu2198Asnfs) rs80359605
NM_000059.3(BRCA2):c.6596delC (p.Thr2199Ilefs) rs876658294
NM_000059.3(BRCA2):c.6600_6601delTT (p.Ser2201Terfs) rs80359607
NM_000059.3(BRCA2):c.6601delT (p.Ser2201Leufs) rs80359607
NM_000059.3(BRCA2):c.662_663delTT (p.Phe221Serfs) rs80359609
NM_000059.3(BRCA2):c.6634_6637delTGTT (p.Cys2212Leufs) rs397507871
NM_000059.3(BRCA2):c.6641dupC (p.Tyr2215Leufs) rs80359613
NM_000059.3(BRCA2):c.6643delT (p.Tyr2215Thrfs) rs80359614
NM_000059.3(BRCA2):c.6644_6647delACTC (p.Tyr2215Serfs) rs80359616
NM_000059.3(BRCA2):c.6656C>G (p.Ser2219Ter) rs80358893
NM_000059.3(BRCA2):c.6663_6664insAAAG (p.Tyr2222Lysfs) rs786202157
NM_000059.3(BRCA2):c.6676_6677delGA (p.Glu2226Serfs) rs80359619
NM_000059.3(BRCA2):c.6681dup (p.Val2228Serfs) rs1555284790
NM_000059.3(BRCA2):c.6682dupG (p.Val2228Glyfs) rs80359621
NM_000059.3(BRCA2):c.6685G>T (p.Glu2229Ter) rs730881548
NM_000059.3(BRCA2):c.668delA (p.His223Leufs) rs876659261
NM_000059.3(BRCA2):c.6699_6702dupTTTT (p.Met2235Phefs) rs587781516
NM_000059.3(BRCA2):c.67+1G>A rs81002796
NM_000059.3(BRCA2):c.67+1G>C rs81002796
NM_000059.3(BRCA2):c.67+1G>T rs81002796
NM_000059.3(BRCA2):c.6702delT (p.Phe2234Leufs) rs587781516
NM_000059.3(BRCA2):c.6703_6704delAT (p.Met2235Glyfs) rs587782667
NM_000059.3(BRCA2):c.6724_6725delGA (p.Asp2242Phefs) rs397507375
NM_000059.3(BRCA2):c.6730A>T (p.Lys2244Ter) rs886040675
NM_000059.3(BRCA2):c.674delC (p.Thr225Ilefs) rs886038054
NM_000059.3(BRCA2):c.6757_6758delCT (p.Leu2253Phefs) rs80359623
NM_000059.3(BRCA2):c.6761_6762delTT (p.Phe2254Tyrfs) rs80359624
NM_000059.3(BRCA2):c.6777_6778delTG (p.Asn2259Lysfs) rs786204279
NM_000059.3(BRCA2):c.6781G>T (p.Glu2261Ter) rs876660812
NM_000059.3(BRCA2):c.6816_6820delAAGAG (p.Gly2274Alafs) rs587781803
NM_000059.3(BRCA2):c.6833_6837delTCTTA (p.Ile2278Serfs) rs80359626
NM_000059.3(BRCA2):c.6836_6837delTAinsCTTTGTGGTAAGTTT (p.Leu2279Serfs) rs587781480
NM_000059.3(BRCA2):c.6866T>G (p.Leu2289Ter) rs1555285146
NM_000059.3(BRCA2):c.688A>T (p.Lys230Ter) rs80358913
NM_000059.3(BRCA2):c.6944_6947delTAAA (p.Ile2315Lysfs) rs80359629
NM_000059.3(BRCA2):c.6952C>T (p.Arg2318Ter) rs80358920
NM_000059.3(BRCA2):c.6959T>A (p.Leu2320Ter) rs80358923
NM_000059.3(BRCA2):c.6975_6976delTT (p.Ser2326Phefs) rs886040679
NM_000059.3(BRCA2):c.6981_7005del25 (p.Leu2327Phefs) rs1555285350
NM_000059.3(BRCA2):c.6990_6994delTACCT (p.Ile2330Metfs) rs80359631
NM_000059.3(BRCA2):c.6990dupT (p.Thr2331Tyrfs) rs876658789
NM_000059.3(BRCA2):c.6998dupT (p.Pro2334Thrfs) rs754611265
NM_000059.3(BRCA2):c.7007+1G>C rs397507891
NM_000059.3(BRCA2):c.7007G>A (p.Arg2336His) rs28897743
NM_000059.3(BRCA2):c.7007G>C (p.Arg2336Pro) rs28897743
NM_000059.3(BRCA2):c.7008-2A>G rs81002823
NM_000059.3(BRCA2):c.7008-2A>T rs81002823
NM_000059.3(BRCA2):c.700delT (p.Ser234Profs) rs80359630
NM_000059.3(BRCA2):c.7024C>T (p.Gln2342Ter) rs80358928
NM_000059.3(BRCA2):c.7025_7026delAA (p.Gln2342Argfs) rs80359634
NM_000059.3(BRCA2):c.7026delA (p.Glu2343Argfs) rs786203546
NM_000059.3(BRCA2):c.7033C>T (p.Gln2345Ter) rs886040685
NM_000059.3(BRCA2):c.7060C>T (p.Gln2354Ter) rs80358936
NM_000059.3(BRCA2):c.7069_7070delCT (p.Leu2357Valfs) rs80359636
NM_000059.3(BRCA2):c.7097dupT (p.Thr2367Aspfs) rs786202600
NM_000059.3(BRCA2):c.7110dupA (p.Ser2371Ilefs) rs80359638
NM_000059.3(BRCA2):c.7115C>A (p.Ser2372Ter) rs80358943
NM_000059.3(BRCA2):c.7133C>G (p.Ser2378Ter) rs276174889
NM_000059.3(BRCA2):c.7151_7152delAA (p.Gln2384Argfs) rs276174890
NM_000059.3(BRCA2):c.715delA (p.Ser239Valfs) rs431825350
NM_000059.3(BRCA2):c.7177dupA (p.Met2393Asnfs) rs397507899
NM_000059.3(BRCA2):c.7180A>T (p.Arg2394Ter) rs80358946
NM_000059.3(BRCA2):c.7186_7187delTT (p.Leu2396Aspfs) rs1555286031
NM_000059.3(BRCA2):c.71T>A (p.Leu24Ter) rs397507902
NM_000059.3(BRCA2):c.71_96del26 (p.Leu24Terfs) rs80359637
NM_000059.3(BRCA2):c.71delT (p.Leu24Terfs) rs397507903
NM_000059.3(BRCA2):c.7208_7211delCCAA (p.Thr2403Lysfs) rs80359641
NM_000059.3(BRCA2):c.7209_7212delCAAAinsGG (p.Lys2404Glyfs) rs876659770
NM_000059.3(BRCA2):c.7218dupT (p.Val2407Cysfs) rs876659345
NM_000059.3(BRCA2):c.721A>T (p.Lys241Ter) rs876659100
NM_000059.3(BRCA2):c.7230delT (p.Phe2410Leufs) rs1555286052
NM_000059.3(BRCA2):c.7241C>G (p.Ser2414Ter) rs80358951
NM_000059.3(BRCA2):c.7251_7252delCA (p.His2417Glnfs) rs397507907
NM_000059.3(BRCA2):c.7254_7255delAG (p.Arg2418Serfs) rs80359644
NM_000059.3(BRCA2):c.7258G>T (p.Glu2420Ter) rs397507385
NM_000059.3(BRCA2):c.7266T>A (p.Cys2422Ter) rs730882169
NM_000059.3(BRCA2):c.7279_7283delAACTT (p.Asn2427Glyfs) rs1555286065
NM_000059.3(BRCA2):c.729_732delTGAT (p.Asn243Lysfs) rs80359645
NM_000059.3(BRCA2):c.7301delA (p.Lys2434Serfs) rs786202441
NM_000059.3(BRCA2):c.733delA (p.Arg245Aspfs) rs876658927
NM_000059.3(BRCA2):c.7341_7342delTA (p.Asn2447Lysfs) rs876660563
NM_000059.3(BRCA2):c.7360delA (p.Ile2454Phefs) rs80359646
NM_000059.3(BRCA2):c.7366C>T (p.Gln2456Ter) rs397507912
NM_000059.3(BRCA2):c.7375A>T (p.Lys2459Ter) rs397507913
NM_000059.3(BRCA2):c.7379_7380insG (p.Asn2460Lysfs) rs80359647
NM_000059.3(BRCA2):c.7379delA (p.Asn2460Thrfs) rs397507914
NM_000059.3(BRCA2):c.7379dup (p.Asn2460Lysfs)
NM_000059.3(BRCA2):c.7412_7421delCAAAGTGTGA (p.Thr2471Lysfs) rs80359649
NM_000059.3(BRCA2):c.7414_7415delAA (p.Lys2472Valfs) rs80359650
NM_000059.3(BRCA2):c.7471C>T (p.Gln2491Ter) rs80358971
NM_000059.3(BRCA2):c.7480C>T (p.Arg2494Ter) rs80358972
NM_000059.3(BRCA2):c.7485dupT (p.Lys2496Terfs) rs886038171
NM_000059.3(BRCA2):c.7501C>T (p.Gln2501Ter) rs886040711
NM_000059.3(BRCA2):c.7504_7511delCGCGTCTT (p.Arg2502Serfs) rs1555286255
NM_000059.3(BRCA2):c.7516C>T (p.Gln2506Ter) rs876658631
NM_000059.3(BRCA2):c.7525dup (p.Ser2509Lysfs) rs80359656
NM_000059.3(BRCA2):c.7538delC (p.Ala2513Glufs) rs397507919
NM_000059.3(BRCA2):c.7543dupA (p.Thr2515Asnfs) rs80359657
NM_000059.3(BRCA2):c.7556dupC (p.Arg2520Serfs) rs80359660
NM_000059.3(BRCA2):c.7558C>T (p.Arg2520Ter) rs80358981
NM_000059.3(BRCA2):c.755_758delACAG (p.Asp252Valfs) rs80359659
NM_000059.3(BRCA2):c.7567_7568delCT (p.Leu2523Glufs) rs80359664
NM_000059.3(BRCA2):c.756_757delCA (p.Asp252Glufs) rs80359662
NM_000059.3(BRCA2):c.7570A>T (p.Lys2524Ter) rs1555286291
NM_000059.3(BRCA2):c.7575delA (p.Ala2526Glnfs) rs869320797
NM_000059.3(BRCA2):c.7579delG (p.Val2527Terfs) rs1555286294
NM_000059.3(BRCA2):c.7580_7583dup (p.Gly2529Argfs) rs1555286296
NM_000059.3(BRCA2):c.7595_7596insTT (p.Ala2534Leufs) rs80359666
NM_000059.3(BRCA2):c.7602delG (p.Cys2535Valfs) rs876658470
NM_000059.3(BRCA2):c.7613_7614dup (p.Gln2539Asnfs)
NM_000059.3(BRCA2):c.7617+1G>A rs397507922
NM_000059.3(BRCA2):c.7618-1G>A rs397507389
NM_000059.3(BRCA2):c.7626_7637delGTATGGCGTTTCinsT (p.Tyr2543Terfs) rs1555286388
NM_000059.3(BRCA2):c.7666_7667dupAA (p.Asn2556Lysfs) rs878853303
NM_000059.3(BRCA2):c.7673_7674delAG (p.Glu2558Valfs) rs80359672
NM_000059.3(BRCA2):c.767_768delCA (p.Thr256Lysfs) rs80359670
NM_000059.3(BRCA2):c.7681C>T (p.Gln2561Ter) rs80358994
NM_000059.3(BRCA2):c.7689delC (p.His2563Glnfs) rs80359674
NM_000059.3(BRCA2):c.7718T>G (p.Leu2573Ter) rs786203680
NM_000059.3(BRCA2):c.7719dupA (p.Trp2574Metfs) rs80359676
NM_000059.3(BRCA2):c.771_775delTCAAA (p.Asn257Lysfs) rs80359671
NM_000059.3(BRCA2):c.7722G>A (p.Trp2574Ter) rs1060502433
NM_000059.3(BRCA2):c.772C>T (p.Gln258Ter) rs80358998
NM_000059.3(BRCA2):c.774_777delAAGA (p.Arg259Lysfs) rs1555281477
NM_000059.3(BRCA2):c.7757G>A (p.Trp2586Ter) rs80359003
NM_000059.3(BRCA2):c.7758G>A (p.Trp2586Ter) rs80359004
NM_000059.3(BRCA2):c.7762_7764delATAinsTT (p.Ile2588Phefs) rs483353072
NM_000059.3(BRCA2):c.7762delA (p.Ile2588Tyrfs) rs80359679
NM_000059.3(BRCA2):c.7777G>T (p.Gly2593Ter) rs587782028
NM_000059.3(BRCA2):c.778_779delGA (p.Glu260Serfs) rs80359677
NM_000059.3(BRCA2):c.7792G>T (p.Glu2598Ter) rs1135401919
NM_000059.3(BRCA2):c.7805+1G>A rs81002809
NM_000059.3(BRCA2):c.7806-1G>T rs81002860
NM_000059.3(BRCA2):c.7806-2A>G rs81002836
NM_000059.3(BRCA2):c.7819delA (p.Thr2607Leufs) rs1060502478
NM_000059.3(BRCA2):c.7833_7843delTCCAAAGCTTAinsG (p.Asp2611Glufs) rs1555286828
NM_000059.3(BRCA2):c.7846delT (p.Ser2616Leufs) rs397507940
NM_000059.3(BRCA2):c.7847delC (p.Ser2616Leufs) rs80359685
NM_000059.3(BRCA2):c.7855dupT (p.Trp2619Leufs) rs587781665
NM_000059.3(BRCA2):c.7857G>A (p.Trp2619Ter) rs80359011
NM_000059.3(BRCA2):c.7865dupA (p.Asn2622Lysfs) rs886040732
NM_000059.3(BRCA2):c.7877G>A (p.Trp2626Ter) rs587781506
NM_000059.3(BRCA2):c.7878G>A (p.Trp2626Ter) rs80359013
NM_000059.3(BRCA2):c.7878delG (p.Trp2626Terfs) rs1555286842
NM_000059.3(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.3(BRCA2):c.7913_7917delTTCCT (p.Phe2638Terfs) rs80359686
NM_000059.3(BRCA2):c.7934delG (p.Arg2645Asnfs) rs80359688
NM_000059.3(BRCA2):c.7958T>C (p.Leu2653Pro) rs80359022
NM_000059.3(BRCA2):c.7976+1G>A rs81002873
NM_000059.3(BRCA2):c.7976G>A (p.Arg2659Lys) rs80359027
NM_000059.3(BRCA2):c.7976G>C (p.Arg2659Thr) rs80359027
NM_000059.3(BRCA2):c.7977-1G>C rs81002874
NM_000059.3(BRCA2):c.7980T>G (p.Tyr2660Ter) rs397507949
NM_000059.3(BRCA2):c.7985dup (p.Glu2663Glyfs) rs1555286933
NM_000059.3(BRCA2):c.7987delG (p.Glu2663Lysfs) rs886040738
NM_000059.3(BRCA2):c.7988A>T (p.Glu2663Val) rs80359031
NM_000059.3(BRCA2):c.799G>T (p.Gly267Ter) rs786202796
NM_000059.3(BRCA2):c.7dup (p.Ile3Asnfs) rs1555280093
NM_000059.3(BRCA2):c.8002A>T (p.Arg2668Ter) rs276174900
NM_000059.3(BRCA2):c.8009C>A (p.Ser2670Ter) rs80359035
NM_000059.3(BRCA2):c.8009delC (p.Ser2670Trpfs) rs876659606
NM_000059.3(BRCA2):c.8020_8021delAA (p.Lys2674Aspfs) rs397507952
NM_000059.3(BRCA2):c.8021dupA (p.Ile2675Aspfs) rs397507952
NM_000059.3(BRCA2):c.8029G>T (p.Glu2677Ter) rs1555286958
NM_000059.3(BRCA2):c.8029delG (p.Glu2677Lysfs) rs80359691
NM_000059.3(BRCA2):c.8047_8054dupGCAAAAAC (p.Leu2686Glnfs) rs397507957
NM_000059.3(BRCA2):c.8067T>A (p.Cys2689Ter) rs80359046
NM_000059.3(BRCA2):c.8130delT (p.Ser2710Argfs) rs80359696
NM_000059.3(BRCA2):c.813delG (p.Asn272Ilefs) rs1555281599
NM_000059.3(BRCA2):c.8143A>T (p.Lys2715Ter) rs863224469
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8167G>C (p.Asp2723His) rs41293511
NM_000059.3(BRCA2):c.8168A>G (p.Asp2723Gly) rs41293513
NM_000059.3(BRCA2):c.818C>A (p.Ser273Ter) rs80359068
NM_000059.3(BRCA2):c.8237_8238delCA (p.Thr2746Serfs) rs80359700
NM_000059.3(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.3(BRCA2):c.8247_8248delGA (p.Lys2750Aspfs) rs80359701
NM_000059.3(BRCA2):c.8253dupT (p.Ile2752Tyrfs) rs80359704
NM_000059.3(BRCA2):c.8297delC (p.Thr2766Asnfs) rs80359705
NM_000059.3(BRCA2):c.8308delG (p.Ala2770Profs) rs398122601
NM_000059.3(BRCA2):c.8314G>T (p.Glu2772Ter) rs397507975
NM_000059.3(BRCA2):c.831delT (p.Asn277Lysfs) rs1555281604
NM_000059.3(BRCA2):c.8322dupT (p.Met2775Tyrfs) rs80359706
NM_000059.3(BRCA2):c.8332-1G>T rs397507979
NM_000059.3(BRCA2):c.8340_8343delTAAC (p.Asn2781Valfs) rs80359707
NM_000059.3(BRCA2):c.834delC (p.Cys279Alafs) rs876658861
NM_000059.3(BRCA2):c.8356delG (p.Ala2786Leufs) rs876660043
NM_000059.3(BRCA2):c.8364G>A (p.Trp2788Ter) rs397507981
NM_000059.3(BRCA2):c.8374_8384delCTTGGATTCTTinsAGG (p.Leu2792Argfs) rs886040766
NM_000059.3(BRCA2):c.8377G>A (p.Gly2793Arg) rs80359082
NM_000059.3(BRCA2):c.8395delA (p.Arg2799Aspfs) rs80359709
NM_000059.3(BRCA2):c.8400_8402delTTTinsAAAA (p.Phe2801Lysfs) rs483353077
NM_000059.3(BRCA2):c.8414_8416delTATinsC (p.Leu2805Serfs) rs397507402
NM_000059.3(BRCA2):c.8420C>A (p.Ser2807Ter) rs55763607
NM_000059.3(BRCA2):c.8463delT (p.Ile2822Phefs) rs397507988
NM_000059.3(BRCA2):c.8463dupT (p.Ile2822Tyrfs) rs397507988
NM_000059.3(BRCA2):c.8474delC (p.Ala2825Aspfs) rs80359711
NM_000059.3(BRCA2):c.8487+1G>A rs81002798
NM_000059.3(BRCA2):c.8488-1G>A rs397507404
NM_000059.3(BRCA2):c.8489G>A (p.Trp2830Ter) rs80359101
NM_000059.3(BRCA2):c.8494G>T (p.Glu2832Ter) rs876658951
NM_000059.3(BRCA2):c.8497A>T (p.Lys2833Ter) rs1555287732
NM_000059.3(BRCA2):c.8504C>A (p.Ser2835Ter) rs80359102
NM_000059.3(BRCA2):c.8505delA (p.Ser2836Leufs) rs80359713
NM_000059.3(BRCA2):c.8535_8538delAGAG (p.Glu2846Lysfs) rs80359714
NM_000059.3(BRCA2):c.8537_8538delAG (p.Glu2846Glyfs) rs80359714
NM_000059.3(BRCA2):c.8548G>T (p.Glu2850Ter) rs80359110
NM_000059.3(BRCA2):c.8548_8551delGAAG (p.Glu2850Glnfs) rs397507406
NM_000059.3(BRCA2):c.8575C>T (p.Gln2859Ter) rs80359115
NM_000059.3(BRCA2):c.8575delC (p.Gln2859Lysfs) rs80359718
NM_000059.3(BRCA2):c.857_860dupCAAT (p.Met287Ilefs) rs876660385
NM_000059.3(BRCA2):c.8581A>T (p.Arg2861Ter) rs398122608
NM_000059.3(BRCA2):c.8585dupT (p.Glu2863Argfs) rs80359720
NM_000059.3(BRCA2):c.8594dupT (p.Leu2865Phefs) rs80359721
NM_000059.3(BRCA2):c.8607delT (p.Gln2870Argfs) rs1060502471
NM_000059.3(BRCA2):c.8608C>T (p.Gln2870Ter) rs587782010
NM_000059.3(BRCA2):c.8629G>T (p.Glu2877Ter) rs80359121
NM_000059.3(BRCA2):c.8655dup (p.Pro2886Thrfs) rs1135401927
NM_000059.3(BRCA2):c.8673_8674delAA (p.Arg2892Thrfs) rs80359724
NM_000059.3(BRCA2):c.8680C>T (p.Gln2894Ter) rs397508002
NM_000059.3(BRCA2):c.8680delC (p.Gln2894Lysfs) rs397507410
NM_000059.3(BRCA2):c.8695C>T (p.Gln2899Ter) rs397507411
NM_000059.3(BRCA2):c.8707G>T (p.Glu2903Ter) rs1555288166
NM_000059.3(BRCA2):c.8724delG (p.Lys2909Argfs) rs1555288172
NM_000059.3(BRCA2):c.8744_8745insCTTA (p.Tyr2916Leufs) rs1555288177
NM_000059.3(BRCA2):c.8745_8748dupTTAC (p.Glu2918Profs) rs80359727
NM_000059.3(BRCA2):c.8754+1G>A rs397508006
NM_000059.3(BRCA2):c.8754+4A>G rs81002893
NM_000059.3(BRCA2):c.8755-1G>A rs81002812
NM_000059.3(BRCA2):c.8770G>T (p.Glu2924Ter) rs80359133
NM_000059.3(BRCA2):c.8773C>T (p.Gln2925Ter) rs80359134
NM_000059.3(BRCA2):c.8818_8824delAAACAAG (p.Lys2940Leufs) rs1555288379
NM_000059.3(BRCA2):c.8837T>A (p.Leu2946Ter) rs431825371
NM_000059.3(BRCA2):c.8839G>T (p.Glu2947Ter) rs398122715
NM_000059.3(BRCA2):c.8875G>T (p.Glu2959Ter) rs786202920
NM_000059.3(BRCA2):c.8878C>T (p.Gln2960Ter) rs80359140
NM_000059.3(BRCA2):c.888T>A (p.Tyr296Ter) rs876659359
NM_000059.3(BRCA2):c.8904delC (p.Val2969Cysfs) rs80359730
NM_000059.3(BRCA2):c.891_899delAACAGTTGTinsGATACTTCAG (p.Thr298Ilefs) rs276174914
NM_000059.3(BRCA2):c.8930delA (p.Tyr2977Phefs) rs869320799
NM_000059.3(BRCA2):c.8933C>A (p.Ser2978Ter) rs80359144
NM_000059.3(BRCA2):c.8940dupA (p.Glu2981Argfs) rs80359732
NM_000059.3(BRCA2):c.8945_8946delAA (p.Lys2982Argfs) rs80359733
NM_000059.3(BRCA2):c.8946dupA (p.Asp2983Argfs) rs80359733
NM_000059.3(BRCA2):c.8953+1G>T rs81002882
NM_000059.3(BRCA2):c.8954-1_8955delGTTinsAA rs276174916
NM_000059.3(BRCA2):c.8956dupA (p.Ile2986Asnfs) rs397508024
NM_000059.3(BRCA2):c.8961_8964delGAGT (p.Ser2988Phefs) rs80359734
NM_000059.3(BRCA2):c.8969G>A (p.Trp2990Ter) rs80359148
NM_000059.3(BRCA2):c.8970G>A (p.Trp2990Ter) rs80359149
NM_000059.3(BRCA2):c.8978C>G (p.Ser2993Ter) rs397508025
NM_000059.3(BRCA2):c.8988_8990delATAinsTT (p.Leu2996Phefs) rs397508027
NM_000059.3(BRCA2):c.8991T>G (p.Tyr2997Ter) rs397508028
NM_000059.3(BRCA2):c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT (p.Ser2998Ilefs) rs1555288450
NM_000059.3(BRCA2):c.8996dupT (p.Leu3000Valfs) rs786202353
NM_000059.3(BRCA2):c.9004G>A (p.Glu3002Lys) rs80359152
NM_000059.3(BRCA2):c.9014_9015delGA (p.Arg3005Ilefs) rs876661023
NM_000059.3(BRCA2):c.9018C>A (p.Tyr3006Ter) rs80359154
NM_000059.3(BRCA2):c.9018C>G (p.Tyr3006Ter) rs80359154
NM_000059.3(BRCA2):c.9025delT (p.Tyr3009Ilefs) rs786203575
NM_000059.3(BRCA2):c.9026_9030delATCAT (p.Tyr3009Serfs) rs80359741
NM_000059.3(BRCA2):c.9027delT (p.His3010Ilefs) rs80359742
NM_000059.3(BRCA2):c.9041C>G (p.Ser3014Ter) rs80359156
NM_000059.3(BRCA2):c.9054_9055delTA (p.Ser3018Argfs) rs80359743
NM_000059.3(BRCA2):c.9069_9076delTAACATAC (p.Asn3024Valfs) rs80359746
NM_000059.3(BRCA2):c.906delC (p.Ser303Leufs) rs397508033
NM_000059.3(BRCA2):c.9076C>T (p.Gln3026Ter) rs80359159
NM_000059.3(BRCA2):c.9093_9094delAAinsG (p.Thr3033Leufs) rs876660532
NM_000059.3(BRCA2):c.9097_9098insT (p.Thr3033Ilefs) rs1555288494
NM_000059.3(BRCA2):c.9097delA (p.Thr3033Leufs) rs397507419
NM_000059.3(BRCA2):c.9097dupA (p.Thr3033Asnfs) rs397507419
NM_000059.3(BRCA2):c.9117+1G>A rs81002802
NM_000059.3(BRCA2):c.9117G>A (p.Pro3039=) rs28897756
NM_000059.3(BRCA2):c.9118-2A>G rs81002862
NM_000059.3(BRCA2):c.9127G>T (p.Glu3043Ter) rs398122610
NM_000059.3(BRCA2):c.9147C>G (p.Tyr3049Ter) rs886040823
NM_000059.3(BRCA2):c.9148C>T (p.Gln3050Ter) rs80359170
NM_000059.3(BRCA2):c.9154C>T (p.Arg3052Trp) rs45580035
NM_000059.3(BRCA2):c.917_920delATAG (p.Asp306Valfs) rs1555281630
NM_000059.3(BRCA2):c.9182T>A (p.Leu3061Ter) rs80359175
NM_000059.3(BRCA2):c.9183dup (p.Asp3062Argfs) rs1555288544
NM_000059.3(BRCA2):c.9194_9195delTT (p.Phe3065Serfs) rs587782378
NM_000059.3(BRCA2):c.9194_9195insA (p.Phe3065Leufs) rs1555288549
NM_000059.3(BRCA2):c.9195_9196delTCinsAT (p.Phe3065_Gln3066delinsLeuTer) rs876659047
NM_000059.3(BRCA2):c.9196C>T (p.Gln3066Ter) rs80359180
NM_000059.3(BRCA2):c.9212dup (p.Val3072Glyfs) rs1555288557
NM_000059.3(BRCA2):c.9219_9228del10 (p.Ile3075Serfs) rs1555288559
NM_000059.3(BRCA2):c.9225dup (p.Gly3076Argfs) rs1555288564
NM_000059.3(BRCA2):c.9233delT (p.Val3078Alafs) rs876660599
NM_000059.3(BRCA2):c.9235delG (p.Val3079Phefs) rs397507422
NM_000059.3(BRCA2):c.9246dupG (p.Lys3083Glufs) rs886038189
NM_000059.3(BRCA2):c.9253delA (p.Thr3085Glnfs) rs397508041
NM_000059.3(BRCA2):c.9253dupA (p.Thr3085Asnfs) rs80359752
NM_000059.3(BRCA2):c.9256_9256+1delGGinsTA rs587781422
NM_000059.3(BRCA2):c.9257-1G>C rs81002889
NM_000059.3(BRCA2):c.9257-5_9278del27 rs587781648
NM_000059.3(BRCA2):c.9262delG (p.Ala3088Profs) rs786203843
NM_000059.3(BRCA2):c.926dup (p.Leu310Ilefs) rs1555281638
NM_000059.3(BRCA2):c.9275_9276delAT (p.Tyr3092Phefs) rs397508043
NM_000059.3(BRCA2):c.9278delT (p.Leu3093Cysfs) rs876658643
NM_000059.3(BRCA2):c.9285C>G (p.Asp3095Glu) rs80359198
NM_000059.3(BRCA2):c.9294C>G (p.Tyr3098Ter) rs80359200
NM_000059.3(BRCA2):c.930_931delAT (p.Cys311Phefs) rs80359755
NM_000059.3(BRCA2):c.9310A>T (p.Lys3104Ter) rs1555289521
NM_000059.3(BRCA2):c.9329dup (p.Asn3110Lysfs) rs1405341259
NM_000059.3(BRCA2):c.9330dup (p.Glu3111Terfs) rs1555289529
NM_000059.3(BRCA2):c.9331G>T (p.Glu3111Ter) rs397508047
NM_000059.3(BRCA2):c.9352_9353delAT (p.Met3118Valfs) rs786203318
NM_000059.3(BRCA2):c.9356T>A (p.Leu3119Ter) rs80359207
NM_000059.3(BRCA2):c.9357_9360delAATT (p.Ile3120Leufs) rs886040836
NM_000059.3(BRCA2):c.9371A>T (p.Asn3124Ile) rs28897759
NM_000059.3(BRCA2):c.9376C>T (p.Gln3126Ter) rs80359210
NM_000059.3(BRCA2):c.9380G>A (p.Trp3127Ter) rs80359211
NM_000059.3(BRCA2):c.9381G>A (p.Trp3127Ter) rs876661242
NM_000059.3(BRCA2):c.9382C>T (p.Arg3128Ter) rs80359212
NM_000059.3(BRCA2):c.9401delG (p.Gly3134Alafs) rs80359759
NM_000059.3(BRCA2):c.9403delC (p.Leu3135Phefs) rs80359760
NM_000059.3(BRCA2):c.9409_9412delACTT (p.Thr3137Tyrfs) rs876659211
NM_000059.3(BRCA2):c.9413dupT (p.Leu3138Phefs) rs876659435
NM_000059.3(BRCA2):c.9423dup (p.Asp3142Argfs) rs1555289589
NM_000059.3(BRCA2):c.9430delT (p.Ser3144Leufs) rs80359762
NM_000059.3(BRCA2):c.9435_9436delGT (p.Ser3147Cysfs) rs80359763
NM_000059.3(BRCA2):c.9454G>T (p.Glu3152Ter) rs80359218
NM_000059.3(BRCA2):c.9458delG (p.Gly3153Alafs) rs397508052
NM_000059.3(BRCA2):c.9513_9516delACTT (p.Leu3172Alafs) rs80359769
NM_000059.3(BRCA2):c.9522_9523delTGinsAT (p.Asn3174_Glu3175delinsLysTer) rs786202945
NM_000059.3(BRCA2):c.9556_9567delGCAAATGATCCCinsAAGTGGTCCACCCCAACTA (p.Ala3186Lysfs) rs1555289777
NM_000059.3(BRCA2):c.956dupA (p.Asn319Lysfs) rs80359770
NM_000059.3(BRCA2):c.9573G>A (p.Trp3191Ter) rs398122617
NM_000059.3(BRCA2):c.9580_9581delCC (p.Pro3194Asnfs) rs80359771
NM_000059.3(BRCA2):c.9588delA (p.Asp3197Thrfs) rs876661285
NM_000059.3(BRCA2):c.959delT (p.Leu320Hisfs) rs1060502454
NM_000059.3(BRCA2):c.9610_9611delAC (p.Thr3204Cysfs) rs1555289791
NM_000059.3(BRCA2):c.961C>T (p.Gln321Ter) rs80359234
NM_000059.3(BRCA2):c.9666delT (p.Cys3222Trpfs) rs80359772
NM_000059.3(BRCA2):c.9672dupA (p.Tyr3225Ilefs) rs80359773
NM_000059.3(BRCA2):c.9682delA (p.Ser3228Valfs) rs398122618
NM_000059.3(BRCA2):c.9717_9718insAT (p.Val3240Metfs) rs876660287
NM_000059.3(BRCA2):c.9770_9773delAAGA (p.Lys3257Argfs) rs587781772
NM_000059.3(BRCA2):c.9808delG (p.Ala3270Profs) rs398122622
NM_000059.3(BRCA2):c.9810dup (p.Asp3272Glyfs) rs1555289966
NM_000059.3(BRCA2):c.9871delT (p.Ser3291Leufs) rs886040854
NM_000059.3(BRCA2):c.9891_9894dupATTT (p.Gln3299Ilefs) rs730881619
NM_000059.3(BRCA2):c.9919A>T (p.Lys3307Ter) rs1555290003
NM_000059.3(BRCA2):c.9924C>G (p.Tyr3308Ter) rs4987049
NM_000059.3(BRCA2):c.994delA (p.Ile332Phefs) rs80359777

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.