ClinVar Miner

List of variants in gene CACNA1A reported as pathogenic for not provided

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 47
Download table as spreadsheet
NM_000068.3(CACNA1A):c.2009G>A (p.Trp670Ter) rs1555757537
NM_000068.3(CACNA1A):c.2746C>T (p.Gln916Ter) rs1555756161
NM_000068.3(CACNA1A):c.3227del (p.Lys1076Serfs) rs1555753042
NM_000068.3(CACNA1A):c.3704dup (p.Leu1236Profs)
NM_000068.3(CACNA1A):c.3937dup (p.Arg1313Profs)
NM_000068.3(CACNA1A):c.4045C>T (p.Arg1349Ter)
NM_000068.3(CACNA1A):c.41del (p.Gly14Glufs) rs1555797179
NM_000068.3(CACNA1A):c.439G>A (p.Glu147Lys)
NM_000068.3(CACNA1A):c.6046C>T (p.Gln2016Ter) rs1355062450
NM_001127221.1(CACNA1A):c.1363C>T (p.Arg455Ter) rs886039668
NM_001127221.1(CACNA1A):c.1442delG (p.Arg481Profs) rs1555762908
NM_001127221.1(CACNA1A):c.1503_1524delGCTGTGTGTTGCTATTGTTCAC (p.Leu502Thrfs) rs1555762855
NM_001127221.1(CACNA1A):c.1748G>A (p.Arg583Gln) rs121908217
NM_001127221.1(CACNA1A):c.1997C>T (p.Thr666Met) rs121908212
NM_001127221.1(CACNA1A):c.2042_2043delAG (p.Gln681Argfs) rs1064794262
NM_001127221.1(CACNA1A):c.2130G>T (p.Leu710Phe) rs886041654
NM_001127221.1(CACNA1A):c.2137G>A (p.Ala713Thr) rs886037945
NM_001127221.1(CACNA1A):c.2340_2341insCAAGTCCGTGTGGGAGCAGCGGACCAGT (p.Glu781Glnfs) rs1057520154
NM_001127221.1(CACNA1A):c.2542C>T (p.Gln848Ter) rs1420078244
NM_001127221.1(CACNA1A):c.2847_2856delCACGGGCGCG (p.Ala952Serfs) rs1555755977
NM_001127221.1(CACNA1A):c.2906delG (p.Gly969Valfs) rs1555755926
NM_001127221.1(CACNA1A):c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG (p.Pro970Alafs) rs1555755909
NM_001127221.1(CACNA1A):c.2961_2962dup (p.Arg988Profs) rs1555755878
NM_001127221.1(CACNA1A):c.3106dup (p.Ser1036Phefs) rs1131691712
NM_001127221.1(CACNA1A):c.3157C>T (p.Gln1053Ter)
NM_001127221.1(CACNA1A):c.3535dupC (p.Leu1179Profs) rs757953057
NM_001127221.1(CACNA1A):c.3825+1G>A rs794727355
NM_001127221.1(CACNA1A):c.4037G>A (p.Arg1346Gln) rs121908230
NM_001127221.1(CACNA1A):c.4046G>A (p.Arg1349Gln) rs1057520918
NM_001127221.1(CACNA1A):c.4058C>T (p.Pro1353Leu) rs1064794808
NM_001127221.1(CACNA1A):c.4070T>G (p.Ile1357Ser) rs886041541
NM_001127221.1(CACNA1A):c.4075C>T (p.Arg1359Trp) rs1555745461
NM_001127221.1(CACNA1A):c.4099T>A (p.Phe1367Ile) rs1057520749
NM_001127221.1(CACNA1A):c.4105T>C (p.Cys1369Arg) rs886041909
NM_001127221.1(CACNA1A):c.4177G>A (p.Val1393Met) rs794727411
NM_001127221.1(CACNA1A):c.4177G>C (p.Val1393Leu) rs794727411
NM_001127221.1(CACNA1A):c.4503_4505delCTT (p.Phe1502del) rs886041279
NM_001127221.1(CACNA1A):c.4504_4506delTTT (p.Phe1502del) rs1131691374
NM_001127221.1(CACNA1A):c.4900G>A (p.Asp1634Asn) rs1555740805
NM_001127221.1(CACNA1A):c.4990C>T (p.Arg1664Ter) rs1555738369
NM_001127221.1(CACNA1A):c.4991G>A (p.Arg1664Gln) rs121908247
NM_001127221.1(CACNA1A):c.526G>A (p.Val176Met) rs1057521920
NM_001127221.1(CACNA1A):c.5396C>T (p.Ser1799Leu) rs1064794261
NM_001127221.1(CACNA1A):c.6158dup (p.Thr2054Tyrfs) rs1158454977
NM_001127221.1(CACNA1A):c.6400C>T (p.Arg2134Ter) rs1555730878
NM_001127221.1(CACNA1A):c.6492dup (p.Glu2165Terfs) rs1555730801

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.