ClinVar Miner

List of variants in gene CACNA1A reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 227
Download table as spreadsheet
HGVS dbSNP
NC_000019.10:g.(?_13359586)_(13359819_?)del
NM_001127221.1(CACNA1A):c.1082+1G>A rs1272886269
NM_001127221.1(CACNA1A):c.1170T>C (p.Asn390=) rs768768744
NM_001127221.1(CACNA1A):c.1171G>A (p.Gly391Arg) rs749309558
NM_001127221.1(CACNA1A):c.1198+5G>A
NM_001127221.1(CACNA1A):c.1212C>G (p.Leu404=) rs540579196
NM_001127221.1(CACNA1A):c.1225A>C (p.Thr409Pro) rs187259531
NM_001127221.1(CACNA1A):c.1330G>A (p.Ala444Thr) rs866479368
NM_001127221.1(CACNA1A):c.1360G>A (p.Ala454Thr) rs41276886
NM_001127221.1(CACNA1A):c.1373T>A (p.Ile458Asn)
NM_001127221.1(CACNA1A):c.1398G>A (p.Ser466=) rs374307014
NM_001127221.1(CACNA1A):c.1415dup (p.Glu473Glyfs)
NM_001127221.1(CACNA1A):c.1416G>C (p.Lys472Asn)
NM_001127221.1(CACNA1A):c.1442delG (p.Arg481Profs) rs1555762908
NM_001127221.1(CACNA1A):c.1447A>G (p.Met483Val) rs1555762900
NM_001127221.1(CACNA1A):c.1472G>A (p.Trp491Ter)
NM_001127221.1(CACNA1A):c.1503G>A (p.Thr501=) rs373192672
NM_001127221.1(CACNA1A):c.1503_1524delGCTGTGTGTTGCTATTGTTCAC (p.Leu502Thrfs) rs1555762855
NM_001127221.1(CACNA1A):c.1537G>C (p.Glu513Gln)
NM_001127221.1(CACNA1A):c.1548C>T (p.Ser516=) rs372275167
NM_001127221.1(CACNA1A):c.1575T>A (p.Ile525=) rs16010
NM_001127221.1(CACNA1A):c.1591A>G (p.Met531Val)
NM_001127221.1(CACNA1A):c.1617C>T (p.Tyr539=) rs182505786
NM_001127221.1(CACNA1A):c.1626G>A (p.Gly542=) rs375628894
NM_001127221.1(CACNA1A):c.1629G>A (p.Thr543=) rs16011
NM_001127221.1(CACNA1A):c.1701C>T (p.Ile567=) rs190603219
NM_001127221.1(CACNA1A):c.1704G>A (p.Trp568Ter) rs1555759066
NM_001127221.1(CACNA1A):c.1779C>G (p.Val593=) rs16012
NM_001127221.1(CACNA1A):c.1908C>T (p.Phe636=) rs115452236
NM_001127221.1(CACNA1A):c.1913G>T (p.Gly638Val) rs121908246
NM_001127221.1(CACNA1A):c.2014G>A (p.Glu672Lys) rs1434942721
NM_001127221.1(CACNA1A):c.2028C>T (p.Asp676=) rs1170735669
NM_001127221.1(CACNA1A):c.2042delA (p.Gln681Argfs) rs1555757523
NM_001127221.1(CACNA1A):c.2133C>G (p.Ala711=) rs16017
NM_001127221.1(CACNA1A):c.2136C>A (p.Ile712=)
NM_001127221.1(CACNA1A):c.2194G>T (p.Glu732Ter) rs1555756737
NM_001127221.1(CACNA1A):c.2195A>C (p.Glu732Ala) rs16019
NM_001127221.1(CACNA1A):c.2259C>G (p.Ser753=) rs764816582
NM_001127221.1(CACNA1A):c.2320_2322delGTGinsAC (p.Val774Thrfs) rs1555756461
NM_001127221.1(CACNA1A):c.235_237delTTC (p.Phe79del)
NM_001127221.1(CACNA1A):c.2377G>T (p.Ala793Ser) rs753248182
NM_001127221.1(CACNA1A):c.2407C>A (p.Arg803Ser) rs760816963
NM_001127221.1(CACNA1A):c.2438G>T (p.Arg813Leu)
NM_001127221.1(CACNA1A):c.2494C>A (p.Arg832Ser)
NM_001127221.1(CACNA1A):c.2504A>C (p.Asn835Thr)
NM_001127221.1(CACNA1A):c.2623T>G (p.Ser875Ala) rs751675055
NM_001127221.1(CACNA1A):c.2679C>T (p.Ser893=) rs780515850
NM_001127221.1(CACNA1A):c.2681G>A (p.Arg894Gln) rs374664760
NM_001127221.1(CACNA1A):c.2690C>G (p.Pro897Arg) rs121908242
NM_001127221.1(CACNA1A):c.2695G>A (p.Gly899Ser)
NM_001127221.1(CACNA1A):c.2740C>T (p.Pro914Ser) rs16020
NM_001127221.1(CACNA1A):c.2742C>G (p.Pro914=) rs16021
NM_001127221.1(CACNA1A):c.2742C>T (p.Pro914=) rs16021
NM_001127221.1(CACNA1A):c.2752G>A (p.Glu918Lys) rs368081042
NM_001127221.1(CACNA1A):c.2757C>T (p.Gly919=) rs371757002
NM_001127221.1(CACNA1A):c.2758G>T (p.Glu920Ter) rs1555756130
NM_001127221.1(CACNA1A):c.2777C>T (p.Ala926Val)
NM_001127221.1(CACNA1A):c.2781G>A (p.Gly927=) rs1035531839
NM_001127221.1(CACNA1A):c.2790C>T (p.His930=) rs1555756078
NM_001127221.1(CACNA1A):c.2800G>A (p.Val934Met)
NM_001127221.1(CACNA1A):c.2821A>G (p.Arg941Gly)
NM_001127221.1(CACNA1A):c.2826G>A (p.Glu942=) rs374511141
NM_001127221.1(CACNA1A):c.2829C>T (p.Ser943=) rs181024112
NM_001127221.1(CACNA1A):c.2847C>G (p.Arg949=) rs559862641
NM_001127221.1(CACNA1A):c.2860G>A (p.Gly954Arg) rs1057518292
NM_001127221.1(CACNA1A):c.2889C>T (p.Arg963=) rs1443085599
NM_001127221.1(CACNA1A):c.2890A>C (p.Arg964=) rs1555755942
NM_001127221.1(CACNA1A):c.2892G>A (p.Arg964=) rs1390620211
NM_001127221.1(CACNA1A):c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG (p.Pro970Alafs) rs1555755909
NM_001127221.1(CACNA1A):c.2910G>A (p.Pro970=) rs772557121
NM_001127221.1(CACNA1A):c.2912A>G (p.Glu971Gly) rs1555755916
NM_001127221.1(CACNA1A):c.2927G>A (p.Arg976Gln)
NM_001127221.1(CACNA1A):c.294-6C>A rs764502828
NM_001127221.1(CACNA1A):c.2941C>T (p.Arg981Cys)
NM_001127221.1(CACNA1A):c.2977_2988delGAGGGCGAGGGC (p.Glu993_Gly996del) rs764399373
NM_001127221.1(CACNA1A):c.297C>T (p.Pro99=) rs370211834
NM_001127221.1(CACNA1A):c.2983_2988delGAGGGC (p.Glu995_Gly996del) rs764399373
NM_001127221.1(CACNA1A):c.29C>T (p.Ala10Val) rs952757731
NM_001127221.1(CACNA1A):c.3019C>T (p.Arg1007Trp)
NM_001127221.1(CACNA1A):c.3020G>C (p.Arg1007Pro)
NM_001127221.1(CACNA1A):c.3031C>G (p.Pro1011Ala) rs28413664
NM_001127221.1(CACNA1A):c.3043G>A (p.Glu1015Lys) rs16024
NM_001127221.1(CACNA1A):c.3046G>A (p.Gly1016Arg) rs190551509
NM_001127221.1(CACNA1A):c.3056G>C (p.Arg1019Pro)
NM_001127221.1(CACNA1A):c.3066C>A (p.Asp1022Glu) rs1038705410
NM_001127221.1(CACNA1A):c.3070G>A (p.Glu1024Lys) rs1555755809
NM_001127221.1(CACNA1A):c.3169C>T (p.Arg1057Cys) rs187393245
NM_001127221.1(CACNA1A):c.3181C>T (p.Pro1061Ser) rs969592968
NM_001127221.1(CACNA1A):c.3229G>A (p.Ala1077Thr) rs554091859
NM_001127221.1(CACNA1A):c.3230C>T (p.Ala1077Val) rs199512932
NM_001127221.1(CACNA1A):c.3240C>T (p.Ala1080=) rs16026
NM_001127221.1(CACNA1A):c.3265G>A (p.Ala1089Thr) rs371820430
NM_001127221.1(CACNA1A):c.3307G>A (p.Asp1103Asn) rs372823282
NM_001127221.1(CACNA1A):c.3328A>T (p.Ile1110Phe)
NM_001127221.1(CACNA1A):c.3334G>T (p.Ala1112Ser)
NM_001127221.1(CACNA1A):c.3337A>C (p.Met1113Leu)
NM_001127221.1(CACNA1A):c.3375G>A (p.Thr1125=) rs770311284
NM_001127221.1(CACNA1A):c.3412C>G (p.Pro1138Ala) rs199793367
NM_001127221.1(CACNA1A):c.345C>G (p.Leu115=) rs747917423
NM_001127221.1(CACNA1A):c.3460C>G (p.Gln1154Glu) rs201612257
NM_001127221.1(CACNA1A):c.3467A>T (p.Asn1156Ile) rs992828062
NM_001127221.1(CACNA1A):c.346G>A (p.Ala116Thr) rs778725158
NM_001127221.1(CACNA1A):c.3493G>A (p.Asp1165Asn) rs775838621
NM_001127221.1(CACNA1A):c.3534C>A (p.Pro1178=) rs184723350
NM_001127221.1(CACNA1A):c.3547G>A (p.Val1183Ile) rs369742607
NM_001127221.1(CACNA1A):c.3549C>T (p.Val1183=) rs16029
NM_001127221.1(CACNA1A):c.3587C>T (p.Pro1196Leu)
NM_001127221.1(CACNA1A):c.3607_3609delAAG (p.Lys1203del) rs772989979
NM_001127221.1(CACNA1A):c.3618_3620delGGA (p.Glu1207del) rs750826355
NM_001127221.1(CACNA1A):c.3621A>G (p.Glu1207=) rs201236364
NM_001127221.1(CACNA1A):c.3625G>A (p.Asp1209Asn)
NM_001127221.1(CACNA1A):c.3687G>A (p.Thr1229=) rs368048030
NM_001127221.1(CACNA1A):c.3696C>G (p.Pro1232=) rs1555751817
NM_001127221.1(CACNA1A):c.3787G>A (p.Ala1263Thr)
NM_001127221.1(CACNA1A):c.3790G>A (p.Glu1264Lys) rs1555751762
NM_001127221.1(CACNA1A):c.3817C>T (p.Arg1273Trp) rs372970430
NM_001127221.1(CACNA1A):c.3823_3825delAAC (p.Asn1275del) rs1085307864
NM_001127221.1(CACNA1A):c.3825C>T (p.Asn1275=) rs201230929
NM_001127221.1(CACNA1A):c.3846C>T (p.Tyr1282=) rs774224202
NM_001127221.1(CACNA1A):c.3885+10G>C rs183712582
NM_001127221.1(CACNA1A):c.3885+7G>A rs376836245
NM_001127221.1(CACNA1A):c.3929G>A (p.Arg1310His)
NM_001127221.1(CACNA1A):c.4224C>T (p.Asp1408=) rs201200430
NM_001127221.1(CACNA1A):c.4266C>T (p.Leu1422=) rs1173445536
NM_001127221.1(CACNA1A):c.4293G>A (p.Ala1431=) rs555959123
NM_001127221.1(CACNA1A):c.4294C>T (p.Arg1432Ter)
NM_001127221.1(CACNA1A):c.4314G>A (p.Lys1438=) rs572036869
NM_001127221.1(CACNA1A):c.4401G>A (p.Lys1467=) rs1555743957
NM_001127221.1(CACNA1A):c.4429C>T (p.Gln1477Ter) rs1555743942
NM_001127221.1(CACNA1A):c.4594-4G>A rs370348070
NM_001127221.1(CACNA1A):c.4594-9C>G rs16032
NM_001127221.1(CACNA1A):c.462C>T (p.Ala154=) rs1800039
NM_001127221.1(CACNA1A):c.4635C>T (p.Thr1545=) rs150378053
NM_001127221.1(CACNA1A):c.4647G>A (p.Pro1549=) rs199854716
NM_001127221.1(CACNA1A):c.4673G>A (p.Arg1558His) rs755172189
NM_001127221.1(CACNA1A):c.4698G>A (p.Pro1566=) rs753924411
NM_001127221.1(CACNA1A):c.4723A>G (p.Met1575Val) rs1555743201
NM_001127221.1(CACNA1A):c.4839T>G (p.Cys1613Trp) rs781413708
NM_001127221.1(CACNA1A):c.486C>T (p.Gly162=) rs753180610
NM_001127221.1(CACNA1A):c.4879C>T (p.Arg1627Cys)
NM_001127221.1(CACNA1A):c.4880G>A (p.Arg1627His)
NM_001127221.1(CACNA1A):c.4882G>A (p.Asp1628Asn)
NM_001127221.1(CACNA1A):c.488C>T (p.Ser163Phe) rs1555789107
NM_001127221.1(CACNA1A):c.4899C>T (p.Phe1633=) rs374613316
NM_001127221.1(CACNA1A):c.4953+1G>T
NM_001127221.1(CACNA1A):c.4991G>A (p.Arg1664Gln) rs121908247
NM_001127221.1(CACNA1A):c.5063C>T (p.Ser1688Phe)
NM_001127221.1(CACNA1A):c.5098G>A (p.Ala1700Thr) rs371273055
NM_001127221.1(CACNA1A):c.5136+10G>A rs369033909
NM_001127221.1(CACNA1A):c.5253-8G>C rs1555737120
NM_001127221.1(CACNA1A):c.5259C>T (p.Ala1753=) rs753902560
NM_001127221.1(CACNA1A):c.5262C>T (p.Thr1754=) rs376684786
NM_001127221.1(CACNA1A):c.5263G>A (p.Gly1755Arg) rs1555737113
NM_001127221.1(CACNA1A):c.526G>C (p.Val176Leu) rs1057521920
NM_001127221.1(CACNA1A):c.5339G>A (p.Arg1780Gln)
NM_001127221.1(CACNA1A):c.5397G>A (p.Ser1799=) rs201681631
NM_001127221.1(CACNA1A):c.5403+3G>A rs1034627495
NM_001127221.1(CACNA1A):c.549G>A (p.Ala183=) rs16004
NM_001127221.1(CACNA1A):c.549G>T (p.Ala183=) rs16004
NM_001127221.1(CACNA1A):c.5531+7A>G rs367551746
NM_001127221.1(CACNA1A):c.5559_5560delCA (p.Tyr1853Terfs)
NM_001127221.1(CACNA1A):c.5590G>A (p.Gly1864Ser)
NM_001127221.1(CACNA1A):c.5613T>C (p.His1871=) rs201292159
NM_001127221.1(CACNA1A):c.5629-6C>G
NM_001127221.1(CACNA1A):c.5653G>A (p.Val1885Ile) rs201836062
NM_001127221.1(CACNA1A):c.5655C>T (p.Val1885=) rs17846921
NM_001127221.1(CACNA1A):c.5735-6T>C rs16043
NM_001127221.1(CACNA1A):c.5742C>T (p.Ala1914=) rs16044
NM_001127221.1(CACNA1A):c.579G>A (p.Thr193=) rs41276894
NM_001127221.1(CACNA1A):c.5871C>T (p.Tyr1957=) rs371972266
NM_001127221.1(CACNA1A):c.5900G>A (p.Arg1967Gln) rs199886234
NM_001127221.1(CACNA1A):c.5987C>T (p.Pro1996Leu)
NM_001127221.1(CACNA1A):c.5989A>G (p.Thr1997Ala) rs141963371
NM_001127221.1(CACNA1A):c.6008G>A (p.Gly2003Asp)
NM_001127221.1(CACNA1A):c.6070G>A (p.Gly2024Ser) rs574805525
NM_001127221.1(CACNA1A):c.6128C>T (p.Thr2043Met) rs563345694
NM_001127221.1(CACNA1A):c.6129G>A (p.Thr2043=) rs7249722
NM_001127221.1(CACNA1A):c.6205C>T (p.Arg2069Ter)
NM_001127221.1(CACNA1A):c.6265G>A (p.Gly2089Ser) rs1259126760
NM_001127221.1(CACNA1A):c.6268C>A (p.Arg2090=) rs200093958
NM_001127221.1(CACNA1A):c.6298G>A (p.Glu2100Lys) rs757385012
NM_001127221.1(CACNA1A):c.62C>T (p.Ala21Val) rs15999
NM_001127221.1(CACNA1A):c.6345C>G (p.Thr2115=) rs16049
NM_001127221.1(CACNA1A):c.6364A>T (p.Met2122Leu) rs1317004203
NM_001127221.1(CACNA1A):c.6381C>T (p.Ser2127=) rs16050
NM_001127221.1(CACNA1A):c.6382G>A (p.Val2128Met) rs368183370
NM_001127221.1(CACNA1A):c.6403C>T (p.Arg2135Cys) rs121908235
NM_001127221.1(CACNA1A):c.6438C>T (p.Pro2146=) rs1456597171
NM_001127221.1(CACNA1A):c.6439G>A (p.Glu2147Lys)
NM_001127221.1(CACNA1A):c.643G>A (p.Val215Ile) rs1555774867
NM_001127221.1(CACNA1A):c.6451C>T (p.Arg2151Trp)
NM_001127221.1(CACNA1A):c.6452G>A (p.Arg2151Gln) rs751044309
NM_001127221.1(CACNA1A):c.6459C>A (p.His2153Gln)
NM_001127221.1(CACNA1A):c.6467G>T (p.Arg2156Leu) rs572722130
NM_001127221.1(CACNA1A):c.6470G>A (p.Arg2157His) rs755749925
NM_001127221.1(CACNA1A):c.6497G>A (p.Arg2166His) rs727503832
NM_001127221.1(CACNA1A):c.6508C>T (p.Arg2170Cys) rs375354077
NM_001127221.1(CACNA1A):c.6530-7G>A rs1555730686
NM_001127221.1(CACNA1A):c.6530G>T (p.Gly2177Val) rs763045560
NM_001127221.1(CACNA1A):c.654G>A (p.Ser218=) rs201991581
NM_001127221.1(CACNA1A):c.654G>C (p.Ser218=) rs201991581
NM_001127221.1(CACNA1A):c.6587G>A (p.Arg2196Gln) rs373192655
NM_001127221.1(CACNA1A):c.6616C>T (p.Arg2206Trp) rs780467849
NM_001127221.1(CACNA1A):c.6617G>A (p.Arg2206Gln) rs756685971
NM_001127221.1(CACNA1A):c.6630dup (p.His2211Alafs)
NM_001127221.1(CACNA1A):c.6650_6661delACCACCACCATC (p.His2217_His2220del) rs770368215
NM_001127221.1(CACNA1A):c.6653_6661delACCACCATC (p.His2218_His2220del) rs776181081
NM_001127221.1(CACNA1A):c.6657_6659delCCA (p.His2220del) rs759331923
NM_001127221.1(CACNA1A):c.6660T>C (p.His2220=) rs16051
NM_001127221.1(CACNA1A):c.6661_6662insACC (p.His2220_Pro2221insHis) rs768950814
NM_001127221.1(CACNA1A):c.6662C>A (p.Pro2221His) rs16052
NM_001127221.1(CACNA1A):c.6701C>T (p.Pro2234Leu)
NM_001127221.1(CACNA1A):c.6709G>T (p.Gly2237Cys) rs752808137
NM_001127221.1(CACNA1A):c.6713_6722delGGGCACGGGC (p.Arg2238Leufs) rs1042488847
NM_001127221.1(CACNA1A):c.6718C>T (p.Arg2240Trp)
NM_001127221.1(CACNA1A):c.6754G>A (p.Glu2252Lys)
NM_001127221.1(CACNA1A):c.6778C>A (p.Arg2260=) rs750267834
NM_001127221.1(CACNA1A):c.688G>A (p.Gly230Ser) rs1555774859
NM_001127221.1(CACNA1A):c.712_726dup (p.Ile242_Ile243insLeuIlePheAlaIle)
NM_001127221.1(CACNA1A):c.745A>G (p.Met249Val) rs1005732031
NM_001127221.1(CACNA1A):c.784+10C>T rs781363787
NM_001127221.1(CACNA1A):c.832G>A (p.Ala278Thr)
NM_001127221.1(CACNA1A):c.889G>A (p.Gly297Arg)
NM_001127221.1(CACNA1A):c.978+9T>C rs111366222
NM_001127222.1(CACNA1A):c.1345+7C>T rs192536793
NM_001127222.1(CACNA1A):c.1518T>C (p.Val506=) rs16009
NM_001127222.1(CACNA1A):c.1914-4G>A rs191026552

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.