ClinVar Miner

List of variants in gene CACNA1C reported as uncertain significance by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 186
Download table as spreadsheet
HGVS dbSNP
NC_000012.11:g.(?_2224370)_(2224731_?)dup
NC_000012.11:g.(?_2757621)_(2800385_?)dup
NC_000012.12:g.(?_2685716)_(2691219_?)dup
NM_000719.6(CACNA1C):c.1065G>A (p.Thr355=) rs757055492
NM_000719.6(CACNA1C):c.1097C>T (p.Thr366Met) rs1429990170
NM_000719.6(CACNA1C):c.1126G>A (p.Val376Ile)
NM_000719.6(CACNA1C):c.1130G>C (p.Gly377Ala) rs1555689622
NM_000719.6(CACNA1C):c.1337A>G (p.Asp446Gly) rs1060503452
NM_000719.6(CACNA1C):c.1342G>A (p.Asp448Asn) rs786205746
NM_000719.6(CACNA1C):c.1348G>C (p.Glu450Gln) rs369680588
NM_000719.6(CACNA1C):c.1381C>A (p.Pro461Thr) rs776242172
NM_000719.6(CACNA1C):c.1384C>G (p.Arg462Gly) rs761430418
NM_000719.6(CACNA1C):c.1410G>T (p.Glu470Asp) rs1555774889
NM_000719.6(CACNA1C):c.1435G>A (p.Val479Met) rs752677964
NM_000719.6(CACNA1C):c.1477C>A (p.Leu493Met)
NM_000719.6(CACNA1C):c.1485C>A (p.His495Gln) rs373335068
NM_000719.6(CACNA1C):c.1487G>A (p.Arg496Gln) rs369255950
NM_000719.6(CACNA1C):c.1510C>T (p.Arg504Cys)
NM_000719.6(CACNA1C):c.1520G>A (p.Arg507His) rs768830617
NM_000719.6(CACNA1C):c.1532G>A (p.Arg511Gln) rs786205747
NM_000719.6(CACNA1C):c.1553G>A (p.Arg518His) rs1057517711
NM_000719.6(CACNA1C):c.1558G>A (p.Ala520Thr) rs755167125
NM_000719.6(CACNA1C):c.162G>A (p.Ala54=) rs760297846
NM_000719.6(CACNA1C):c.1649A>G (p.Asn550Ser)
NM_000719.6(CACNA1C):c.1693G>A (p.Ala565Thr) rs777945001
NM_000719.6(CACNA1C):c.1722G>T (p.Lys574Asn)
NM_000719.6(CACNA1C):c.1729A>G (p.Ser577Gly) rs772171893
NM_000719.6(CACNA1C):c.1753G>A (p.Val585Met) rs763738559
NM_000719.6(CACNA1C):c.1823C>T (p.Thr608Ile) rs757507674
NM_000719.6(CACNA1C):c.1888A>G (p.Ile630Val) rs1555800433
NM_000719.6(CACNA1C):c.1951A>G (p.Ile651Val) rs1555825315
NM_000719.6(CACNA1C):c.1952T>A (p.Ile651Asn) rs1060503443
NM_000719.6(CACNA1C):c.209A>G (p.Asn70Ser) rs1265762175
NM_000719.6(CACNA1C):c.212C>T (p.Ala71Val) rs755579963
NM_000719.6(CACNA1C):c.2278G>A (p.Glu760Lys) rs1555832882
NM_000719.6(CACNA1C):c.2286_2288delCAC (p.Thr763del) rs1060503445
NM_000719.6(CACNA1C):c.2316G>T (p.Glu772Asp) rs1219744448
NM_000719.6(CACNA1C):c.2317_2319delAAG (p.Lys773del) rs786205771
NM_000719.6(CACNA1C):c.2327A>G (p.Lys776Arg) rs786205751
NM_000719.6(CACNA1C):c.232T>A (p.Ser78Thr) rs1555193020
NM_000719.6(CACNA1C):c.2333T>C (p.Leu778Pro) rs1060503447
NM_000719.6(CACNA1C):c.2350C>T (p.Pro784Ser) rs749935207
NM_000719.6(CACNA1C):c.236C>T (p.Thr79Met) rs749031775
NM_000719.6(CACNA1C):c.2404_2406delGAG (p.Glu802del)
NM_000719.6(CACNA1C):c.2430G>A (p.Thr810=) rs775571017
NM_000719.6(CACNA1C):c.2438G>A (p.Gly813Glu)
NM_000719.6(CACNA1C):c.2452G>A (p.Ala818Thr) rs765111782
NM_000719.6(CACNA1C):c.2460+6G>A rs369246066
NM_000719.6(CACNA1C):c.2486A>G (p.Asn829Ser)
NM_000719.6(CACNA1C):c.2547G>A (p.Glu849=) rs759093479
NM_000719.6(CACNA1C):c.2550G>C (p.Glu850Asp)
NM_000719.6(CACNA1C):c.2566G>A (p.Gly856Ser) rs145549773
NM_000719.6(CACNA1C):c.2633G>C (p.Ser878Thr) rs1060503446
NM_000719.6(CACNA1C):c.2633G>T (p.Ser878Ile)
NM_000719.6(CACNA1C):c.2635G>A (p.Ala879Thr)
NM_000719.6(CACNA1C):c.2674C>G (p.Gln892Glu) rs1555857966
NM_000719.6(CACNA1C):c.2684G>A (p.Arg895His) rs786205755
NM_000719.6(CACNA1C):c.2764C>G (p.Pro922Ala)
NM_000719.6(CACNA1C):c.2793T>G (p.His931Gln)
NM_000719.6(CACNA1C):c.2824A>G (p.Thr942Ala)
NM_000719.6(CACNA1C):c.2965A>G (p.Ser989Gly) rs1555878849
NM_000719.6(CACNA1C):c.2T>C (p.Met1Thr) rs761378545
NM_000719.6(CACNA1C):c.3161A>G (p.Lys1054Arg)
NM_000719.6(CACNA1C):c.3210-3C>T
NM_000719.6(CACNA1C):c.3216C>A (p.Asn1072Lys) rs1555882391
NM_000719.6(CACNA1C):c.3235G>A (p.Gly1079Arg) rs781440831
NM_000719.6(CACNA1C):c.3281G>A (p.Ser1094Asn) rs1165009288
NM_000719.6(CACNA1C):c.3295G>A (p.Asp1099Asn) rs771549676
NM_000719.6(CACNA1C):c.3331G>A (p.Val1111Ile) rs766023530
NM_000719.6(CACNA1C):c.3343G>A (p.Glu1115Lys) rs199473391
NM_000719.6(CACNA1C):c.3344A>G (p.Glu1115Gly) rs1555882813
NM_000719.6(CACNA1C):c.3347G>C (p.Gly1116Ala) rs878854141
NM_000719.6(CACNA1C):c.3391G>A (p.Asp1131Asn) rs776318939
NM_000719.6(CACNA1C):c.3398G>A (p.Gly1133Asp) rs1555884489
NM_000719.6(CACNA1C):c.3420G>A (p.Val1140=) rs1555884613
NM_000719.6(CACNA1C):c.3424A>C (p.Ile1142Leu) rs752247655
NM_000719.6(CACNA1C):c.3510G>A (p.Gln1170=)
NM_000719.6(CACNA1C):c.3643G>A (p.Val1215Met) rs747533547
NM_000719.6(CACNA1C):c.3678C>G (p.Phe1226Leu) rs775309900
NM_000719.6(CACNA1C):c.3679G>A (p.Val1227Ile) rs373124557
NM_000719.6(CACNA1C):c.3717+4A>G rs1184709095
NM_000719.6(CACNA1C):c.3790G>A (p.Val1264Met) rs760543068
NM_000719.6(CACNA1C):c.3824C>T (p.Pro1275Leu)
NM_000719.6(CACNA1C):c.3828+6C>T rs1060503449
NM_000719.6(CACNA1C):c.3862G>A (p.Ala1288Thr) rs367895193
NM_000719.6(CACNA1C):c.3934T>C (p.Ser1312Pro) rs749298267
NM_000719.6(CACNA1C):c.3943A>G (p.Met1315Val) rs756734279
NM_000719.6(CACNA1C):c.3946-10C>G rs370630496
NM_000719.6(CACNA1C):c.4140+4G>A rs111442547
NM_000719.6(CACNA1C):c.4165G>T (p.Asp1389Tyr)
NM_000719.6(CACNA1C):c.4232+4G>A rs550612732
NM_000719.6(CACNA1C):c.4322C>T (p.Thr1441Met) rs727503835
NM_000719.6(CACNA1C):c.4334C>T (p.Thr1445Ile) rs1555994788
NM_000719.6(CACNA1C):c.4336C>A (p.Pro1446Thr)
NM_000719.6(CACNA1C):c.4369A>T (p.Ile1457Phe)
NM_000719.6(CACNA1C):c.447A>G (p.Glu149=)
NM_000719.6(CACNA1C):c.4565G>A (p.Arg1522Gln)
NM_000719.6(CACNA1C):c.4625G>A (p.Arg1542His)
NM_000719.6(CACNA1C):c.4625G>T (p.Arg1542Leu) rs771053661
NM_000719.6(CACNA1C):c.4757G>A (p.Arg1586Gln) rs375656252
NM_000719.6(CACNA1C):c.4837G>A (p.Val1613Ile) rs757629968
NM_000719.6(CACNA1C):c.4942G>A (p.Ala1648Thr) rs370432385
NM_000719.6(CACNA1C):c.4999C>T (p.Arg1667Trp) rs917884780
NM_000719.6(CACNA1C):c.5033A>G (p.Glu1678Gly) rs786205781
NM_000719.6(CACNA1C):c.5039A>G (p.Asp1680Gly) rs1556050949
NM_000719.6(CACNA1C):c.5065G>A (p.Ala1689Thr) rs368700869
NM_000719.6(CACNA1C):c.5084T>C (p.Ile1695Thr)
NM_000719.6(CACNA1C):c.5098G>A (p.Gly1700Ser) rs761966966
NM_000719.6(CACNA1C):c.50G>A (p.Gly17Asp) rs747083495
NM_000719.6(CACNA1C):c.5110G>A (p.Gly1704Ser) rs758268349
NM_000719.6(CACNA1C):c.5120T>C (p.Val1707Ala) rs531161884
NM_000719.6(CACNA1C):c.5137G>A (p.Asp1713Asn) rs747708938
NM_000719.6(CACNA1C):c.5138A>G (p.Asp1713Gly) rs769297492
NM_000719.6(CACNA1C):c.5140G>A (p.Gly1714Ser) rs533676935
NM_000719.6(CACNA1C):c.5144G>A (p.Arg1715Gln) rs376706496
NM_000719.6(CACNA1C):c.5150C>T (p.Ala1717Val) rs201492706
NM_000719.6(CACNA1C):c.5158C>G (p.Gln1720Glu) rs1008863902
NM_000719.6(CACNA1C):c.5164T>G (p.Phe1722Val) rs751493277
NM_000719.6(CACNA1C):c.5198C>T (p.Ala1733Val) rs201049603
NM_000719.6(CACNA1C):c.5225C>T (p.Ser1742Leu)
NM_000719.6(CACNA1C):c.5245G>A (p.Val1749Met) rs1556109769
NM_000719.6(CACNA1C):c.5255C>T (p.Thr1752Ile) rs752694570
NM_000719.6(CACNA1C):c.5284G>C (p.Gly1762Arg) rs374863121
NM_000719.6(CACNA1C):c.5338C>T (p.Arg1780Cys) rs371760034
NM_000719.6(CACNA1C):c.5339G>T (p.Arg1780Leu)
NM_000719.6(CACNA1C):c.5375A>G (p.Glu1792Gly) rs374177870
NM_000719.6(CACNA1C):c.538G>A (p.Ala180Thr) rs786205769
NM_000719.6(CACNA1C):c.5408G>A (p.Arg1803Gln) rs201918158
NM_000719.6(CACNA1C):c.5411T>C (p.Val1804Ala) rs756492434
NM_000719.6(CACNA1C):c.5456G>A (p.Arg1819Gln) rs764212214
NM_000719.6(CACNA1C):c.5477C>T (p.Ala1826Val) rs750289082
NM_000719.6(CACNA1C):c.5486A>G (p.Glu1829Gly) rs1350126839
NM_000719.6(CACNA1C):c.5492C>T (p.Thr1831Met) rs186015395
NM_000719.6(CACNA1C):c.5503G>A (p.Glu1835Lys) rs1060503442
NM_000719.6(CACNA1C):c.5561T>C (p.Leu1854Pro) rs1556205510
NM_000719.6(CACNA1C):c.5593G>A (p.Glu1865Lys) rs200231105
NM_000719.6(CACNA1C):c.5600G>A (p.Arg1867Gln) rs535350857
NM_000719.6(CACNA1C):c.5622_5624delGGA (p.Glu1874del) rs757172314
NM_000719.6(CACNA1C):c.5644T>C (p.Ser1882Pro) rs369438564
NM_000719.6(CACNA1C):c.5648C>T (p.Pro1883Leu)
NM_000719.6(CACNA1C):c.5657G>C (p.Gly1886Ala)
NM_000719.6(CACNA1C):c.5671G>C (p.Ala1891Pro) rs542914369
NM_000719.6(CACNA1C):c.5684G>A (p.Arg1895Gln) rs753954220
NM_000719.6(CACNA1C):c.5717G>A (p.Arg1906Gln) rs758166168
NM_000719.6(CACNA1C):c.5729G>A (p.Arg1910Gln) rs190288386
NM_000719.6(CACNA1C):c.5731G>C (p.Gly1911Arg) rs374528680
NM_000719.6(CACNA1C):c.5885G>A (p.Arg1962Gln) rs199776761
NM_000719.6(CACNA1C):c.5924A>C (p.Glu1975Ala) rs1556308664
NM_000719.6(CACNA1C):c.5957G>A (p.Ser1986Asn) rs755280013
NM_000719.6(CACNA1C):c.5975G>T (p.Cys1992Phe) rs375818733
NM_000719.6(CACNA1C):c.5996C>T (p.Thr1999Ile) rs532551057
NM_000719.6(CACNA1C):c.6001G>A (p.Gly2001Ser)
NM_000719.6(CACNA1C):c.6006C>T (p.Gly2002=) rs373253192
NM_000719.6(CACNA1C):c.6011G>T (p.Gly2004Val) rs374991642
NM_000719.6(CACNA1C):c.6026G>A (p.Arg2009Gln) rs535291848
NM_000719.6(CACNA1C):c.6034C>T (p.Arg2012Trp) rs553500083
NM_000719.6(CACNA1C):c.6059G>A (p.Ser2020Asn) rs373503739
NM_000719.6(CACNA1C):c.6064G>C (p.Ala2022Pro) rs758974396
NM_000719.6(CACNA1C):c.609G>A (p.Val203=) rs1417477759
NM_000719.6(CACNA1C):c.6116C>G (p.Ala2039Gly) rs549476254
NM_000719.6(CACNA1C):c.6140G>A (p.Gly2047Glu)
NM_000719.6(CACNA1C):c.6193G>A (p.Asp2065Asn) rs1060503451
NM_000719.6(CACNA1C):c.6197C>T (p.Ala2066Val) rs1216146146
NM_000719.6(CACNA1C):c.6235G>A (p.Asp2079Asn)
NM_000719.6(CACNA1C):c.6250G>A (p.Gly2084Arg) rs1060503444
NM_000719.6(CACNA1C):c.6254G>A (p.Gly2085Asp) rs776275799
NM_000719.6(CACNA1C):c.6260_6280delCACAGAGCCCCAATGGCGCCC (p.Pro2087_Ala2093del)
NM_000719.6(CACNA1C):c.6275G>A (p.Gly2092Asp) rs755430543
NM_000719.6(CACNA1C):c.6275G>C (p.Gly2092Ala) rs755430543
NM_000719.6(CACNA1C):c.6308C>T (p.Ala2103Val)
NM_000719.6(CACNA1C):c.6323C>T (p.Ala2108Val) rs1453140106
NM_000719.6(CACNA1C):c.6329dupG (p.Glu2111Argfs) rs771708175
NM_000719.6(CACNA1C):c.6334G>C (p.Glu2112Gln) rs1279028766
NM_000719.6(CACNA1C):c.6344G>A (p.Gly2115Asp)
NM_000719.6(CACNA1C):c.6355G>A (p.Ala2119Thr) rs1470889027
NM_000719.6(CACNA1C):c.6368C>G (p.Pro2123Arg)
NM_000719.6(CACNA1C):c.6407G>A (p.Ser2136Asn) rs1556337119
NM_000719.6(CACNA1C):c.65G>T (p.Ser22Ile)
NM_000719.6(CACNA1C):c.70C>T (p.Arg24Cys) rs773211348
NM_000719.6(CACNA1C):c.76G>A (p.Ala26Thr) rs369483452
NM_000719.6(CACNA1C):c.77C>T (p.Ala26Val) rs1555192348
NM_000719.6(CACNA1C):c.898A>G (p.Asn300Asp) rs200289321
NM_000719.6(CACNA1C):c.91A>G (p.Asn31Asp) rs531598856
NM_000719.6(CACNA1C):c.953T>C (p.Leu318Pro) rs745856938
NM_000719.7(CACNA1C):c.2573G>A (p.Arg858His) rs786205753
NM_001129838.1(CACNA1C):c.5558C>T (p.Thr1853Met) rs779315017

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.