ClinVar Miner

List of variants in gene CDKN1C reported as likely benign for Beckwith-Wiedemann syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 98
Download table as spreadsheet
NM_000076.2(CDKN1C):c.123G>A (p.Glu41=) rs1468271941
NM_000076.2(CDKN1C):c.12G>C (p.Ala4=) rs1220484886
NM_000076.2(CDKN1C):c.141G>A (p.Gln47=) rs1060503856
NM_000076.2(CDKN1C):c.15C>T (p.Ser5=) rs878853624
NM_000076.2(CDKN1C):c.171C>T (p.Asp57=) rs777465972
NM_000076.2(CDKN1C):c.204C>T (p.Asp68=) rs1554938190
NM_000076.2(CDKN1C):c.246G>A (p.Val82=) rs141005361
NM_000076.2(CDKN1C):c.258G>C (p.Ser86=) rs1015104953
NM_000076.2(CDKN1C):c.324C>T (p.Pro108=) rs534471786
NM_000076.2(CDKN1C):c.336G>C (p.Ala112=) rs931922290
NM_000076.2(CDKN1C):c.336G>T (p.Ala112=) rs931922290
NM_000076.2(CDKN1C):c.33G>T (p.Thr11=) rs780549417
NM_000076.2(CDKN1C):c.357C>T (p.Leu119=) rs1060503864
NM_000076.2(CDKN1C):c.387C>T (p.Leu129=) rs1426804435
NM_000076.2(CDKN1C):c.438C>G (p.Ser146=) rs1554938064
NM_000076.2(CDKN1C):c.444G>A (p.Pro148=) rs878853625
NM_000076.2(CDKN1C):c.450A>T (p.Pro150=) rs1486402339
NM_000076.2(CDKN1C):c.456G>A (p.Pro152=) rs878853626
NM_000076.2(CDKN1C):c.483T>A (p.Ala161=) rs898729531
NM_000076.2(CDKN1C):c.488_505delCTCCGGTCGCGGCTCCGG (p.Ala163_Pro168del) rs1554937999
NM_000076.2(CDKN1C):c.494_499delTCGCGG (p.Val165_Ala166del) rs878853627
NM_000076.2(CDKN1C):c.500_523delCTCCGGTCGCGGCTCCGGTCGCGG (p.Ala167_Ala174del) rs565544512
NM_000076.2(CDKN1C):c.500_523dup (p.Ala174_Val175insAlaProValAlaAlaProValAla) rs565544512
NM_000076.2(CDKN1C):c.512_517delCTCCGG (p.Ala171_Pro172del) rs1324090653
NM_000076.2(CDKN1C):c.512_523dup (p.Ala174_Val175insAlaProValAla) rs565544512
NM_000076.2(CDKN1C):c.512_529delCTCCGGTCGCGGTCGCGG (p.Ala171_Ala176del) rs1064792992
NM_000076.2(CDKN1C):c.525C>G (p.Val175=) rs878853628
NM_000076.2(CDKN1C):c.526_527delGCinsCT (p.Ala176Leu) rs1554937984
NM_000076.2(CDKN1C):c.526_531delGCGGTC (p.Ala176_Val177del) rs889984547
NM_000076.2(CDKN1C):c.526_531dup (p.Val177_Leu178insAlaVal) rs889984547
NM_000076.2(CDKN1C):c.528G>C (p.Ala176=) rs533485167
NM_000076.2(CDKN1C):c.537_554delCCCGGCCCCGGCCCCGGC (p.Ala189_Pro194del) rs878853629
NM_000076.2(CDKN1C):c.543_554delCCCGGCCCCGGC (p.Ala191_Pro194del) rs878853629
NM_000076.2(CDKN1C):c.543_560delCCCGGCCCCGGCTCCGGC (p.Ala189_Pro194del) rs1064792991
NM_000076.2(CDKN1C):c.543_566delCCCGGCCCCGGCTCCGGCTCCGGC (p.Ala187_Pro194del) rs1486933065
NM_000076.2(CDKN1C):c.549_554dupCCCGGC (p.Pro194_Val195insAlaPro) rs878853629
NM_000076.2(CDKN1C):c.549_560delCCCGGCTCCGGC (p.Ala191_Pro194del) rs1249284743
NM_000076.2(CDKN1C):c.558_581delGGCTCCGGCTCCGGCCCCGGCTCC (p.Ala187_Pro194del) rs878853630
NM_000076.2(CDKN1C):c.558_581dup (p.Pro194_Val195insAlaProAlaProAlaProAlaPro) rs878853630
NM_000076.2(CDKN1C):c.560_561insCCCGGC (p.Pro194_Val195insAlaPro) rs878853631
NM_000076.2(CDKN1C):c.561T>C (p.Ala187=) rs384713
NM_000076.2(CDKN1C):c.567T>C (p.Ala189=) rs112196492
NM_000076.2(CDKN1C):c.567_572dup (p.Pro194_Val195insAlaPro) rs878853632
NM_000076.2(CDKN1C):c.570G>C (p.Pro190=) rs550978405
NM_000076.2(CDKN1C):c.573_578dup (p.Pro194_Val195insAlaPro) rs1302209410
NM_000076.2(CDKN1C):c.579T>C (p.Ala193=) rs1412788622
NM_000076.2(CDKN1C):c.579_596delTCCAGTCGCGGCCCCGGC (p.Val195_Pro200del) rs1203797892
NM_000076.2(CDKN1C):c.579_614delTCCAGTCGCGGCCCCGGCCCCAGCCCCGGCCCCGGC (p.Val195_Pro206del) rs1554937877
NM_000076.2(CDKN1C):c.582A>G (p.Pro194=) rs1340993922
NM_000076.2(CDKN1C):c.588G>A (p.Ala196=) rs878853633
NM_000076.2(CDKN1C):c.594_599delGGCCCC (p.Ala215_Pro216del) rs1060503855
NM_000076.2(CDKN1C):c.594_599dupGGCCCC (p.Pro216_Asp217insAlaPro) rs1060503855
NM_000076.2(CDKN1C):c.597C>T (p.Ala199=) rs1554937891
NM_000076.2(CDKN1C):c.600_605dupAGCCCC (p.Pro216_Asp217insAlaPro) rs1060503860
NM_000076.2(CDKN1C):c.600_623dup (p.Pro216_Asp217insAlaProAlaProAlaProAlaPro) rs878853637
NM_000076.2(CDKN1C):c.600_629delAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC (p.Ala207_Pro216del) rs1064792990
NM_000076.2(CDKN1C):c.600_629dup (p.Pro216_Asp217insAlaProAlaProAlaProAlaProAlaPro) rs1064792990
NM_000076.2(CDKN1C):c.606_629dup (p.Pro216_Asp217insAlaProAlaProAlaProAlaPro) rs759134767
NM_000076.2(CDKN1C):c.612G>A (p.Pro204=) rs794726872
NM_000076.2(CDKN1C):c.612_629delGGCCCCGGCCCCGGCCCC (p.Ala211_Pro216del) rs759134767
NM_000076.2(CDKN1C):c.618G>A (p.Pro206=) rs1060503858
NM_000076.2(CDKN1C):c.620_649delCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG (p.Ala207_Pro216del) rs878853638
NM_000076.2(CDKN1C):c.620_649dup (p.Pro216_Asp217insAlaProAlaProAlaProAlaProAlaPro) rs878853638
NM_000076.2(CDKN1C):c.624_629delGGCCCC (p.Ala215_Pro216del) rs759134767
NM_000076.2(CDKN1C):c.626_649dup (p.Pro216_Asp217insAlaProAlaProAlaProAlaPro) rs778468310
NM_000076.2(CDKN1C):c.627C>T (p.Ala209=) rs1060503866
NM_000076.2(CDKN1C):c.630C>G (p.Pro210=) rs767656648
NM_000076.2(CDKN1C):c.630_635dupCGCCCC (p.Pro216_Asp217insAlaPro) rs786205238
NM_000076.2(CDKN1C):c.630_641dup (p.Pro216_Asp217insAlaProAlaPro) rs1380480846
NM_000076.2(CDKN1C):c.630_647delCGCCCCGGCCCCGGCCCC (p.Ala211_Pro216del) rs747360016
NM_000076.2(CDKN1C):c.632_633insACCGGC (p.Pro216_Asp217insAlaPro) rs771450542
NM_000076.2(CDKN1C):c.638_649delCCCCGGCCCCGG (p.Ala213_Pro216del) rs772704243
NM_000076.2(CDKN1C):c.644_649delCCCCGG (p.Ala215_Pro216del) rs772704243
NM_000076.2(CDKN1C):c.644_649dupCCCCGG (p.Pro216_Asp217insAlaPro) rs772704243
NM_000076.2(CDKN1C):c.684G>T (p.Ala228=) rs761539484
NM_000076.2(CDKN1C):c.693G>A (p.Gly231=) rs1554937788
NM_000076.2(CDKN1C):c.702C>G (p.Gly234=) rs546016935
NM_000076.2(CDKN1C):c.732G>C (p.Ser244=) rs751650132
NM_000076.2(CDKN1C):c.78C>T (p.Arg26=) rs1360965916
NM_000076.2(CDKN1C):c.801G>C (p.Leu267=) rs745815931
NM_000076.2(CDKN1C):c.804C>A (p.Ser268=) rs747104008
NM_000076.2(CDKN1C):c.804C>T (p.Ser268=) rs747104008
NM_000076.2(CDKN1C):c.820+10G>A rs777855717
NM_000076.2(CDKN1C):c.821-5C>G rs775227462
NM_000076.2(CDKN1C):c.821-5C>T rs775227462
NM_000076.2(CDKN1C):c.821-8G>T rs762520730
NM_000076.2(CDKN1C):c.849G>A (p.Ala283=) rs1554937506
NM_000076.2(CDKN1C):c.861G>A (p.Ser287=) rs373252940
NM_000076.2(CDKN1C):c.861G>C (p.Ser287=) rs373252940
NM_000076.2(CDKN1C):c.864G>A (p.Ser288=) rs370564696
NM_000076.2(CDKN1C):c.876C>G (p.Pro292=) rs773166985
NM_000076.2(CDKN1C):c.888C>T (p.Pro296=) rs779172459
NM_000076.2(CDKN1C):c.897C>T (p.Ser299=) rs1554937479
NM_000076.2(CDKN1C):c.906T>C (p.Pro302=) rs780417247
NM_000076.2(CDKN1C):c.906T>G (p.Pro302=) rs780417247
NM_000076.2(CDKN1C):c.90C>T (p.Cys30=) rs759365577
NM_000076.2(CDKN1C):c.918G>C (p.Ser306=) rs1060503861
NM_000076.2(CDKN1C):c.950G>A (p.Ter317=) rs1363802623

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.