ClinVar Miner

List of variants in gene CDKN1C reported as uncertain significance

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 114
Download table as spreadsheet
HGVS dbSNP
GRCh38/hg38 11p15.4(chr11:2883714-2883812)x3
NM_000076.2(CDKN1C):c.-266G>A rs147317732
NM_000076.2(CDKN1C):c.107C>G (p.Pro36Arg)
NM_000076.2(CDKN1C):c.11C>T (p.Ala4Val) rs201368350
NM_000076.2(CDKN1C):c.131G>A (p.Arg44His)
NM_000076.2(CDKN1C):c.131G>T (p.Arg44Leu) rs1477382841
NM_000076.2(CDKN1C):c.143C>T (p.Ala48Val) rs774548414
NM_000076.2(CDKN1C):c.17T>C (p.Leu6Pro) rs201715947
NM_000076.2(CDKN1C):c.182G>C (p.Trp61Ser) rs1554938211
NM_000076.2(CDKN1C):c.19C>T (p.Arg7Cys) rs374634184
NM_000076.2(CDKN1C):c.218G>A (p.Gly73Asp) rs1060500179
NM_000076.2(CDKN1C):c.223G>A (p.Gly75Arg) rs1224283171
NM_000076.2(CDKN1C):c.226C>T (p.Arg76Cys) rs750526402
NM_000076.2(CDKN1C):c.227G>T (p.Arg76Leu)
NM_000076.2(CDKN1C):c.265G>A (p.Ala89Thr) rs1177512372
NM_000076.2(CDKN1C):c.271T>C (p.Tyr91His) rs1060499712
NM_000076.2(CDKN1C):c.29C>A (p.Ser10Tyr)
NM_000076.2(CDKN1C):c.307C>G (p.Leu103Val)
NM_000076.2(CDKN1C):c.31A>G (p.Thr11Ala)
NM_000076.2(CDKN1C):c.341C>T (p.Ala114Val) rs1486019596
NM_000076.2(CDKN1C):c.349C>T (p.Pro117Ser) rs570636789
NM_000076.2(CDKN1C):c.350C>G (p.Pro117Arg) rs945890937
NM_000076.2(CDKN1C):c.352C>G (p.Pro118Ala) rs772684721
NM_000076.2(CDKN1C):c.353C>T (p.Pro118Leu) rs771731330
NM_000076.2(CDKN1C):c.355C>T (p.Leu119Phe) rs1323156745
NM_000076.2(CDKN1C):c.358G>C (p.Glu120Gln)
NM_000076.2(CDKN1C):c.364G>A (p.Ala122Thr)
NM_000076.2(CDKN1C):c.366C>A (p.Ala122=) rs1554938097
NM_000076.2(CDKN1C):c.373T>C (p.Ser125Pro) rs1319558011
NM_000076.2(CDKN1C):c.374C>A (p.Ser125Tyr)
NM_000076.2(CDKN1C):c.388G>A (p.Glu130Lys)
NM_000076.2(CDKN1C):c.395C>T (p.Ala132Val) rs1364155293
NM_000076.2(CDKN1C):c.400G>C (p.Glu134Gln) rs1013695050
NM_000076.2(CDKN1C):c.40_41insAAGA (p.Arg14Glnfs)
NM_000076.2(CDKN1C):c.410C>T (p.Pro137Leu)
NM_000076.2(CDKN1C):c.415G>A (p.Val139Ile) rs1183623363
NM_000076.2(CDKN1C):c.429_434dup (p.Ala145_Ser146insProAla) rs1201148541
NM_000076.2(CDKN1C):c.443C>A (p.Pro148Gln) rs754671425
NM_000076.2(CDKN1C):c.444G>A (p.Pro148=) rs878853625
NM_000076.2(CDKN1C):c.446C>T (p.Pro149Leu) rs1060500175
NM_000076.2(CDKN1C):c.447_464delCCCAGTCCCGGTCCTGGC (p.Val151_Pro156del) rs1159599818
NM_000076.2(CDKN1C):c.451G>A (p.Val151Ile) rs753342439
NM_000076.2(CDKN1C):c.455_460delCGGTCC (p.Pro152_Val153del) rs1060500173
NM_000076.2(CDKN1C):c.472C>G (p.Pro158Ala)
NM_000076.2(CDKN1C):c.475G>A (p.Ala159Thr)
NM_000076.2(CDKN1C):c.476C>A (p.Ala159Asp)
NM_000076.2(CDKN1C):c.488_493dup (p.Pro164_Val165insAlaPro)
NM_000076.2(CDKN1C):c.491C>T (p.Pro164Leu) rs1315960524
NM_000076.2(CDKN1C):c.492G>A (p.Pro164=)
NM_000076.2(CDKN1C):c.493G>A (p.Val165Ile) rs1060500172
NM_000076.2(CDKN1C):c.498G>A (p.Ala166=)
NM_000076.2(CDKN1C):c.50C>T (p.Ala17Val)
NM_000076.2(CDKN1C):c.528G>A (p.Ala176=) rs533485167
NM_000076.2(CDKN1C):c.529G>A (p.Val177Ile) rs1060500174
NM_000076.2(CDKN1C):c.533T>A (p.Leu178Gln)
NM_000076.2(CDKN1C):c.533T>C (p.Leu178Pro) rs1060500177
NM_000076.2(CDKN1C):c.539C>T (p.Pro180Leu) rs113374868
NM_000076.2(CDKN1C):c.540G>A (p.Pro180=) rs1419249357
NM_000076.2(CDKN1C):c.542C>T (p.Ala181Val)
NM_000076.2(CDKN1C):c.557C>T (p.Pro186Leu)
NM_000076.2(CDKN1C):c.558G>A (p.Pro186=) rs1554937948
NM_000076.2(CDKN1C):c.567_572delTCCGGC (p.Ala193_Pro194del) rs878853632
NM_000076.2(CDKN1C):c.570_581dupGGCCCCGGCTCC (p.Pro194_Val195insAlaProAlaPro) rs997267634
NM_000076.2(CDKN1C):c.571G>T (p.Ala191Ser) rs1060500180
NM_000076.2(CDKN1C):c.575C>G (p.Pro192Arg)
NM_000076.2(CDKN1C):c.584T>C (p.Val195Ala) rs1261515352
NM_000076.2(CDKN1C):c.586G>C (p.Ala196Pro) rs1281835164
NM_000076.2(CDKN1C):c.610C>G (p.Pro204Ala)
NM_000076.2(CDKN1C):c.612G>A (p.Pro204=) rs794726872
NM_000076.2(CDKN1C):c.619G>A (p.Ala207Thr) rs1554937870
NM_000076.2(CDKN1C):c.624_629dupGGCCCC (p.Pro216_Asp217insAlaPro) rs759134767
NM_000076.2(CDKN1C):c.625G>A (p.Ala209Thr) rs750581456
NM_000076.2(CDKN1C):c.626C>G (p.Ala209Gly)
NM_000076.2(CDKN1C):c.631G>A (p.Ala211Thr) rs1060500178
NM_000076.2(CDKN1C):c.641C>T (p.Pro214Leu)
NM_000076.2(CDKN1C):c.644C>A (p.Ala215Asp) rs1060500176
NM_000076.2(CDKN1C):c.644C>T (p.Ala215Val)
NM_000076.2(CDKN1C):c.653C>T (p.Ala218Val)
NM_000076.2(CDKN1C):c.670G>A (p.Ala224Thr) rs528634940
NM_000076.2(CDKN1C):c.676C>G (p.Gln226Glu) rs483352987
NM_000076.2(CDKN1C):c.691G>A (p.Gly231Arg)
NM_000076.2(CDKN1C):c.698_699delGCinsAG (p.Arg233Gln) rs1554937778
NM_000076.2(CDKN1C):c.702C>G (p.Gly234=) rs546016935
NM_000076.2(CDKN1C):c.709C>T (p.Pro237Ser) rs1240280374
NM_000076.2(CDKN1C):c.712C>T (p.Leu238Phe) rs878853640
NM_000076.2(CDKN1C):c.733G>A (p.Gly245Arg) rs1060500181
NM_000076.2(CDKN1C):c.73G>C (p.Val25Leu)
NM_000076.2(CDKN1C):c.740C>T (p.Ser247Leu) rs104894200
NM_000076.2(CDKN1C):c.741G>A (p.Ser247=) rs1404692297
NM_000076.2(CDKN1C):c.742G>A (p.Gly248Arg)
NM_000076.2(CDKN1C):c.745C>T (p.Arg249Cys) rs878853641
NM_000076.2(CDKN1C):c.752C>T (p.Ala251Val)
NM_000076.2(CDKN1C):c.763G>A (p.Ala255Thr) rs760038657
NM_000076.2(CDKN1C):c.769G>T (p.Ala257Ser) rs754283907
NM_000076.2(CDKN1C):c.770C>G (p.Ala257Gly) rs878853642
NM_000076.2(CDKN1C):c.784G>A (p.Ala262Thr)
NM_000076.2(CDKN1C):c.802T>A (p.Ser268Thr) rs781340171
NM_000076.2(CDKN1C):c.808C>A (p.Pro270Thr) rs1416211722
NM_000076.2(CDKN1C):c.818C>G (p.Ser273Cys)
NM_000076.2(CDKN1C):c.819C>T (p.Ser273=) rs1430282098
NM_000076.2(CDKN1C):c.820+1G>A rs1554937699
NM_000076.2(CDKN1C):c.820+6C>T
NM_000076.2(CDKN1C):c.837C>T (p.Arg279=)
NM_000076.2(CDKN1C):c.848C>T (p.Ala283Val) rs776541692
NM_000076.2(CDKN1C):c.860C>G (p.Ser287Trp)
NM_000076.2(CDKN1C):c.860C>T (p.Ser287Leu) rs928007699
NM_000076.2(CDKN1C):c.874C>G (p.Pro292Ala)
NM_000076.2(CDKN1C):c.885T>C (p.Cys295=)
NM_000076.2(CDKN1C):c.886C>T (p.Pro296Ser) rs531059713
NM_000076.2(CDKN1C):c.901G>T (p.Ala301Ser) rs749702191
NM_000076.2(CDKN1C):c.909C>T (p.Gly303=) rs377216794
NM_000076.2(CDKN1C):c.91C>A (p.Arg31Ser) rs1467420956
NM_000076.2(CDKN1C):c.91C>T (p.Arg31Cys)
NM_000076.2:c.494_565delTCGCGGCTCCGGTCGCGGCTCCGGTCGCGGTCGCGGTCCTGGCCCCGGCCCCGGCCCCGGCTCCGGCTCCGG

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.