ClinVar Miner

List of variants in gene CDKN2A reported as pathogenic for Melanoma-pancreatic cancer syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 19
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_000077.5(CDKN2A):c.159G>C (p.Met53Ile) rs104894095 0.00001
NM_000077.5(CDKN2A):c.248A>G (p.His83Arg) rs1057519881 0.00001
NM_000077.5(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097 0.00001
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.5(CDKN2A):c.126dup (p.Ser43Ter) rs2131112280
NM_000077.5(CDKN2A):c.146T>G (p.Ile49Ser) rs199907548
NM_000077.5(CDKN2A):c.151-1G>A rs730881677
NM_000077.5(CDKN2A):c.165C>T (p.Gly55=) rs1819725713
NM_000077.5(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.5(CDKN2A):c.19_23dup (p.Ser8fs) rs2131114005
NM_000077.5(CDKN2A):c.225_243del (p.Ala76fs) rs730881674
NM_000077.5(CDKN2A):c.226_244del (p.Ala76fs) rs587776716
NM_000077.5(CDKN2A):c.240_253del (p.Pro81fs) rs730881675
NM_000077.5(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.5(CDKN2A):c.377T>A (p.Val126Asp) rs104894098
NM_000077.5(CDKN2A):c.457G>T (p.Asp153Tyr) rs45476696
NM_000077.5(CDKN2A):c.68G>A (p.Gly23Asp) rs1064794292
NM_058195.4(CDKN2A):c.106del (p.Ala36fs) rs2489327427
NM_058195.4(CDKN2A):c.193+1G>A rs1060501262

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.