ClinVar Miner

List of variants in gene CDKN2A reported as risk factor

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 19
Download table as spreadsheet
CDKN2A, -34G-T
CDKN2A, IVS2, A-G, -105
NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile) rs104894095
NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly) rs104894099
NM_000077.4(CDKN2A):c.226_244del (p.Ala76fs) rs587776716
NM_000077.4(CDKN2A):c.238C>T (p.Arg80Ter) rs121913388
NM_000077.4(CDKN2A):c.265G>A (p.Gly89Ser) rs137854597
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.4(CDKN2A):c.339_340delGCinsCT (p.Pro114Ser) rs387906410
NM_000077.4(CDKN2A):c.364G>C (p.Gly122Arg) rs113798404
NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp) rs104894098
NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097
NM_058195.3(CDKN2A):c.184_186AGA[3] (p.Arg63dup) rs1563902635

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.