List of variants in gene CDKN2A reported by Fulgent Genetics, Fulgent Genetics

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Gene type: Distinguish antisense genes from sense genes
		ClinVar version:

Total variants: 15

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_000077.5(CDKN2A):c.379G>T (p.Ala127Ser)	rs6413464	0.00527
NM_000077.5(CDKN2A):c.430C>T (p.Arg144Cys)	rs116150891	0.00248
NM_000077.5(CDKN2A):c.365G>T (p.Gly122Val)	rs373291490	0.00016
NM_058195.4(CDKN2A):c.94G>A (p.Gly32Arg)	rs879254043	0.00006
NM_000077.5(CDKN2A):c.122C>A (p.Pro41Gln)	rs373407950	0.00002
NM_000077.5(CDKN2A):c.307C>T (p.Arg103Trp)	rs767642535	0.00001
NM_000077.5(CDKN2A):c.71G>C (p.Arg24Pro)	rs104894097	0.00001
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup)	rs587780668
NM_000077.5(CDKN2A):c.125A>G (p.Asn42Ser)	rs1060501264
NM_000077.5(CDKN2A):c.176T>G (p.Val59Gly)	rs104894099
NM_000077.5(CDKN2A):c.198C>G (p.His66Gln)	rs374984975
NM_000077.5(CDKN2A):c.236C>T (p.Thr79Ile)	rs1034265990
NM_000077.5(CDKN2A):c.253G>A (p.Ala85Thr)	rs878853646
NM_000077.5(CDKN2A):c.296G>C (p.Arg99Pro)	rs754806883
NM_000077.5(CDKN2A):c.377T>A (p.Val126Asp)	rs104894098

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.