List of variants in gene CDKN2A reported as likely pathogenic by Fulgent Genetics, Fulgent Genetics

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Gene type: Distinguish antisense genes from sense genes
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants: 3

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_000077.5(CDKN2A):c.146T>C (p.Ile49Thr)	rs199907548	0.00006
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup)	rs587780668
NM_000077.5(CDKN2A):c.296G>C (p.Arg99Pro)	rs754806883

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.