ClinVar Miner

List of variants in gene CFTR reported by OMIM

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 106
Download table as spreadsheet
HGVS dbSNP
CFTR, ALA445GLU
CFTR, GLN524HIS
CFTR, HIS1282TER
LRG_663p1:p.Ser549Arg
NM_000492.3(CFTR):c.1000C>T (p.Arg334Trp) rs121909011
NM_000492.3(CFTR):c.1013C>T (p.Thr338Ile) rs77409459
NM_000492.3(CFTR):c.1021_1022dupTC (p.Phe342Hisfs) rs387906360
NM_000492.3(CFTR):c.1040G>A (p.Arg347His) rs77932196
NM_000492.3(CFTR):c.1040G>C (p.Arg347Pro) rs77932196
NM_000492.3(CFTR):c.1040G>T (p.Arg347Leu) rs77932196
NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) rs121909021
NM_000492.3(CFTR):c.1055G>A (p.Arg352Gln) rs121908753
NM_000492.3(CFTR):c.1081delT (p.Trp361Glyfs) rs387906361
NM_000492.3(CFTR):c.1083delG (p.Trp361Cysfs) rs387906375
NM_000492.3(CFTR):c.1093_1094delCT (p.Leu365Trpfs) rs387906365
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1364C>A (p.Ala455Glu) rs74551128
NM_000492.3(CFTR):c.1373G>T (p.Gly458Val) rs121909009
NM_000492.3(CFTR):c.1408G>A (p.Val470Met) rs213950
NM_000492.3(CFTR):c.1438G>T (p.Gly480Cys) rs79282516
NM_000492.3(CFTR):c.1475C>T (p.Ser492Phe) rs121909017
NM_000492.3(CFTR):c.1477C>T (p.Gln493Ter) rs77101217
NM_000492.3(CFTR):c.1477_1478delCA (p.Gln493Valfs) rs121908775
NM_000492.3(CFTR):c.1516A>G (p.Ile506Val) rs1800091
NM_000492.3(CFTR):c.1519_1521delATC (p.Ile507del) rs121908745
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.1523T>G (p.Phe508Cys) rs74571530
NM_000492.3(CFTR):c.1545_1546delTA (p.Tyr515Terfs) rs121908776
NM_000492.3(CFTR):c.1558G>T (p.Val520Phe) rs77646904
NM_000492.3(CFTR):c.1572C>A (p.Cys524Ter) rs121908754
NM_000492.3(CFTR):c.1682C>A (p.Ala561Glu) rs121909047
NM_000492.3(CFTR):c.1687T>A (p.Tyr563Asn) rs121909006
NM_000492.3(CFTR):c.1721C>A (p.Pro574His) rs121908758
NM_000492.3(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.3(CFTR):c.1766+1G>A rs121908748
NM_000492.3(CFTR):c.1820_1903del84 (p.Met607_Gln634del) rs121908777
NM_000492.3(CFTR):c.1943A>T (p.Asp648Val) rs121909033
NM_000492.3(CFTR):c.19G>T (p.Glu7Ter) rs121909045
NM_000492.3(CFTR):c.2128A>T (p.Lys710Ter) rs75115087
NM_000492.3(CFTR):c.2146A>T (p.Lys716Ter) rs121909023
NM_000492.3(CFTR):c.2175dup (p.Glu726Argfs) rs746418935
NM_000492.3(CFTR):c.2291delG (p.Arg764Glnfs) rs387906376
NM_000492.3(CFTR):c.2424_2425insAT (p.Ser809Ilefs) rs387906359
NM_000492.3(CFTR):c.2479G>T (p.Glu827Ter) rs121909018
NM_000492.3(CFTR):c.2490+1G>A rs141158996
NM_000492.3(CFTR):c.2538G>A (p.Trp846Ter) rs267606722
NM_000492.3(CFTR):c.254G>A (p.Gly85Glu) rs75961395
NM_000492.3(CFTR):c.2551C>T (p.Arg851Ter) rs121909012
NM_000492.3(CFTR):c.262_263delTT (p.Leu88Ilefs) rs121908769
NM_000492.3(CFTR):c.2668C>T (p.Gln890Ter) rs79633941
NM_000492.3(CFTR):c.271G>A (p.Gly91Arg) rs121908750
NM_000492.3(CFTR):c.273+4A>G rs387906374
NM_000492.3(CFTR):c.2735C>T (p.Ser912Leu) rs121909034
NM_000492.3(CFTR):c.2737_2738insG (p.Tyr913Terfs) rs121908788
NM_000492.3(CFTR):c.2738A>G (p.Tyr913Cys) rs121909008
NM_000492.3(CFTR):c.274G>A (p.Glu92Lys) rs121908751
NM_000492.3(CFTR):c.274G>T (p.Glu92Ter) rs121908751
NM_000492.3(CFTR):c.2845C>T (p.His949Tyr) rs121909035
NM_000492.3(CFTR):c.2988+1G>A rs75096551
NM_000492.3(CFTR):c.326A>G (p.Tyr109Cys) rs121909031
NM_000492.3(CFTR):c.328G>C (p.Asp110His) rs113993958
NM_000492.3(CFTR):c.3469-20T>C rs373002889
NM_000492.3(CFTR):c.3472C>T (p.Arg1158Ter) rs79850223
NM_000492.3(CFTR):c.3484C>T (p.Arg1162Ter) rs74767530
NM_000492.3(CFTR):c.3492dup (p.Lys1165Terfs) rs387906379
NM_000492.3(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000492.3(CFTR):c.3532_3535dupTCAA (p.Thr1179Ilefs) rs387906378
NM_000492.3(CFTR):c.3611G>A (p.Trp1204Ter) rs121908764
NM_000492.3(CFTR):c.3659C>T (p.Thr1220Ile) rs1800123
NM_000492.3(CFTR):c.3659delC (p.Thr1220Lysfs) rs121908811
NM_000492.3(CFTR):c.3700A>G (p.Ile1234Val) rs75389940
NM_000492.3(CFTR):c.3712C>T (p.Gln1238Ter) rs121908766
NM_000492.3(CFTR):c.3717+4A>G rs387906362
NM_000492.3(CFTR):c.3718-1G>A rs387906369
NM_000492.3(CFTR):c.3744delA (p.Lys1250Argfs) rs121908784
NM_000492.3(CFTR):c.3746G>A (p.Gly1249Glu) rs121909040
NM_000492.3(CFTR):c.3752G>A (p.Ser1251Asn) rs74503330
NM_000492.3(CFTR):c.3763T>C (p.Ser1255Pro) rs121909041
NM_000492.3(CFTR):c.3764C>A (p.Ser1255Ter) rs76649725
NM_000492.3(CFTR):c.3767dupC (p.Leu1258Phefs) rs387906370
NM_000492.3(CFTR):c.3808G>A (p.Asp1270Asn) rs11971167
NM_000492.3(CFTR):c.3846G>A (p.Trp1282Ter) rs77010898
NM_000492.3(CFTR):c.3848G>T (p.Arg1283Met) rs77902683
NM_000492.3(CFTR):c.3857T>C (p.Phe1286Ser) rs121909028
NM_000492.3(CFTR):c.3873+1G>A rs143570767
NM_000492.3(CFTR):c.3873G>C (p.Gln1291His) rs121909015
NM_000492.3(CFTR):c.3883_3886delATTT (p.Ile1295Phefs) rs387906373
NM_000492.3(CFTR):c.3907A>C (p.Asn1303His) rs121909042
NM_000492.3(CFTR):c.3909C>G (p.Asn1303Lys) rs80034486
NM_000492.3(CFTR):c.3937C>T (p.Gln1313Ter) rs121909026
NM_000492.3(CFTR):c.3947G>A (p.Trp1316Ter) rs121909010
NM_000492.3(CFTR):c.4056G>C (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.424delA (p.Ile142Phefs) rs387906363
NM_000492.3(CFTR):c.429delT (p.Phe143Leufs) rs387906364
NM_000492.3(CFTR):c.459_476delAATAGCTATGTTTAGTTT (p.Ala155_Ile160del) rs387906371
NM_000492.3(CFTR):c.617T>G (p.Leu206Trp) rs121908752
NM_000492.3(CFTR):c.650A>G (p.Glu217Gly) rs121909046
NM_000492.3(CFTR):c.720_741delAGGGAGAATGATGATGAAGTAC (p.Gly241Glufs) rs121908804
NM_000492.3(CFTR):c.744-14_744-3del rs387906367
NM_000492.3(CFTR):c.805_806delAT (p.Ile269Profs) rs121908773
NM_000492.3(CFTR):c.860dup (p.Asn287Lysfs) rs387906380
NM_000492.3(CFTR):c.933C>G (p.Phe311Leu) rs121909016
NM_000492.3(CFTR):c.948delT (p.Phe316Leufs) rs121908744
NM_000492.3(CFTR):c.[1075C>A;1079C>A]
NM_000492.3(CFTR):c.[2735C>T;3731G>T]
NP_000483.3(CFTR):p.Tyr1092Ter

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.