ClinVar Miner

List of variants in gene CNGB3 reported as benign by Natera, Inc.

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 23
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_019098.5(CNGB3):c.702T>G (p.Cys234Trp) rs6471482 0.88912
NM_019098.5(CNGB3):c.892A>C (p.Thr298Pro) rs4961206 0.64246
NM_019098.5(CNGB3):c.2264A>G (p.Glu755Gly) rs3735972 0.08214
NM_019098.5(CNGB3):c.2214A>G (p.Glu738=) rs3735970 0.08211
NM_019098.5(CNGB3):c.919A>G (p.Ile307Val) rs13265557 0.05793
NM_019098.5(CNGB3):c.1356G>A (p.Gln452=) rs34839859 0.05572
NM_019098.5(CNGB3):c.608G>A (p.Arg203Gln) rs16916632 0.05057
NM_019098.5(CNGB3):c.1781+10A>T rs7000747 0.05032
NM_019098.5(CNGB3):c.595G>A (p.Glu199Lys) rs114305748 0.01886
NM_019098.5(CNGB3):c.80A>G (p.Asn27Ser) rs35807406 0.01728
NM_019098.5(CNGB3):c.354G>T (p.Pro118=) rs75858066 0.01037
NM_019098.5(CNGB3):c.1397T>C (p.Met466Thr) rs35010099 0.00978
NM_019098.5(CNGB3):c.1626C>T (p.Ser542=) rs35903042 0.00786
NM_019098.5(CNGB3):c.212-3T>C rs79126074 0.00635
NM_019098.5(CNGB3):c.1492T>A (p.Leu498Met) rs115246141 0.00350
NM_019098.5(CNGB3):c.2420C>G (p.Ala807Gly) rs142846289 0.00300
NM_019098.5(CNGB3):c.1405T>G (p.Tyr469Asp) rs35365413 0.00248
NM_019098.5(CNGB3):c.1510A>G (p.Thr504Ala) rs140286824 0.00065
NM_019098.5(CNGB3):c.1383C>T (p.Asp461=) rs112847374 0.00039
NM_019098.5(CNGB3):c.2415A>C (p.Glu805Asp) rs186448979 0.00025
NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1]) rs746549330
NM_019098.5(CNGB3):c.339-10dup rs200792506
NM_019098.5(CNGB3):c.494-11dup rs36008065

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.