ClinVar Miner

List of variants in gene COL6A1 studied for not specified

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 197
Download table as spreadsheet
HGVS dbSNP
NM_001848.2(COL6A1):c.-5C>G rs7671
NM_001848.2(COL6A1):c.-8C>A rs886038491
NM_001848.2(COL6A1):c.1002+37A>G rs11702174
NM_001848.2(COL6A1):c.1002+42_1002+43insGACGGGGAGGGATGGGGTGGACAGTGTGAAGGTGACCGGGAGGACGGGGAGGGACGGGGAGG rs1556425767
NM_001848.2(COL6A1):c.1002+43A>G rs11702175
NM_001848.2(COL6A1):c.1002+43_1002+52delAATGGGGCGA rs398123629
NM_001848.2(COL6A1):c.1002+43_1002+81delAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGA rs72435610
NM_001848.2(COL6A1):c.1002+45T>C rs368643049
NM_001848.2(COL6A1):c.1002+50C>A rs11702079
NM_001848.2(COL6A1):c.1002+50C>T rs11702079
NM_001848.2(COL6A1):c.1003-15delT rs769487412
NM_001848.2(COL6A1):c.1043C>T (p.Ser348Leu) rs142882745
NM_001848.2(COL6A1):c.1056C>T (p.Asp352=) rs116343553
NM_001848.2(COL6A1):c.105C>G (p.Pro35=) rs145579577
NM_001848.2(COL6A1):c.1095T>C (p.Gly365=) rs1980982
NM_001848.2(COL6A1):c.1119+13C>T rs199655304
NM_001848.2(COL6A1):c.1119+19delC rs750949530
NM_001848.2(COL6A1):c.1119+39C>T rs74982956
NM_001848.2(COL6A1):c.1120-12G>A rs115107397
NM_001848.2(COL6A1):c.1182+20C>T rs7275706
NM_001848.2(COL6A1):c.1182+3G>A rs62215499
NM_001848.2(COL6A1):c.1186C>G (p.Gln396Glu) rs886038493
NM_001848.2(COL6A1):c.1236+14C>T rs372483312
NM_001848.2(COL6A1):c.1272+11C>T rs371785147
NM_001848.2(COL6A1):c.1273-8C>T rs7280215
NM_001848.2(COL6A1):c.1298G>A (p.Arg433Gln) rs151158105
NM_001848.2(COL6A1):c.1314G>A (p.Thr438=) rs7279254
NM_001848.2(COL6A1):c.1316G>A (p.Arg439Gln) rs35059000
NM_001848.2(COL6A1):c.1335+20G>C rs9306146
NM_001848.2(COL6A1):c.1335+27A>C rs2850173
NM_001848.2(COL6A1):c.1336-15C>T rs201003020
NM_001848.2(COL6A1):c.1336-17G>A rs185337381
NM_001848.2(COL6A1):c.1350G>A (p.Pro450=) rs144887329
NM_001848.2(COL6A1):c.1398+10G>A rs143438559
NM_001848.2(COL6A1):c.1399-32T>C rs2839077
NM_001848.2(COL6A1):c.1399-3C>T rs200095847
NM_001848.2(COL6A1):c.1425delA (p.Gly476Alafs) rs878854398
NM_001848.2(COL6A1):c.1443G>A (p.Glu481=) rs80244281
NM_001848.2(COL6A1):c.1461+18C>A rs2276254
NM_001848.2(COL6A1):c.1461+41dupG rs3216137
NM_001848.2(COL6A1):c.1462-19G>A rs191393017
NM_001848.2(COL6A1):c.1462-36A>G rs2276255
NM_001848.2(COL6A1):c.1462-8C>T rs199849694
NM_001848.2(COL6A1):c.1475C>T (p.Ala492Val) rs117340427
NM_001848.2(COL6A1):c.1506G>C (p.Pro502=) rs139987124
NM_001848.2(COL6A1):c.1518T>C (p.Gly506=) rs35134265
NM_001848.2(COL6A1):c.1524+15G>A rs116000285
NM_001848.2(COL6A1):c.1524+19G>A rs2276256
NM_001848.2(COL6A1):c.1524+19G>C rs2276256
NM_001848.2(COL6A1):c.1525-60A>G rs3737437
NM_001848.2(COL6A1):c.1525-9C>T rs768508076
NM_001848.2(COL6A1):c.1584G>A (p.Pro528=) rs139243418
NM_001848.2(COL6A1):c.1611+20C>T rs369940697
NM_001848.2(COL6A1):c.1611+48C>T rs886038494
NM_001848.2(COL6A1):c.1611+9G>A rs186975997
NM_001848.2(COL6A1):c.1611C>T (p.Asn537=) rs200023632
NM_001848.2(COL6A1):c.1612-10G>A rs141892165
NM_001848.2(COL6A1):c.1612-6C>T rs143812383
NM_001848.2(COL6A1):c.1644C>T (p.Asp548=) rs182425338
NM_001848.2(COL6A1):c.1665C>T (p.Pro555=) rs369802454
NM_001848.2(COL6A1):c.1671C>T (p.Asp557=) rs770099663
NM_001848.2(COL6A1):c.1674+15G>A rs749423625
NM_001848.2(COL6A1):c.1674+46_1674+47dupCA rs200245740
NM_001848.2(COL6A1):c.1675-16C>T rs200659458
NM_001848.2(COL6A1):c.1675-55C>T rs4819179
NM_001848.2(COL6A1):c.170C>A (p.Ala57Asp) rs143502850
NM_001848.2(COL6A1):c.1716del (p.Tyr573Thrfs) rs878854381
NM_001848.2(COL6A1):c.1740+50C>T rs148205490
NM_001848.2(COL6A1):c.1773G>A (p.Pro591=) rs74852641
NM_001848.2(COL6A1):c.1776+13C>T rs201734661
NM_001848.2(COL6A1):c.1776C>T (p.Asp592=) rs148439285
NM_001848.2(COL6A1):c.1782C>T (p.Cys594=) rs745847824
NM_001848.2(COL6A1):c.1813+25T>G rs191946565
NM_001848.2(COL6A1):c.1814-6C>G rs182804464
NM_001848.2(COL6A1):c.1822+42G>C rs13053065
NM_001848.2(COL6A1):c.1822+45C>G rs7276098
NM_001848.2(COL6A1):c.1822+45C>T rs7276098
NM_001848.2(COL6A1):c.1822+80G>A rs7283989
NM_001848.2(COL6A1):c.1822+88A>G rs7276782
NM_001848.2(COL6A1):c.1823-31C>T rs117330552
NM_001848.2(COL6A1):c.1823-8G>A rs184666690
NM_001848.2(COL6A1):c.1829A>C (p.Lys610Thr) rs768906709
NM_001848.2(COL6A1):c.1833C>T (p.Cys611=) rs142554239
NM_001848.2(COL6A1):c.1887G>A (p.Gln629=) rs1447613750
NM_001848.2(COL6A1):c.1941G>A (p.Arg647=) rs139914666
NM_001848.2(COL6A1):c.1956+15C>T rs11701124
NM_001848.2(COL6A1):c.1957-11C>T rs8132521
NM_001848.2(COL6A1):c.1957-17C>T rs370007363
NM_001848.2(COL6A1):c.1957-5C>T rs78224483
NM_001848.2(COL6A1):c.202C>T (p.Arg68Cys) rs137964147
NM_001848.2(COL6A1):c.2042T>C (p.Ile681Thr) rs138884734
NM_001848.2(COL6A1):c.2045G>A (p.Arg682Gln) rs148962954
NM_001848.2(COL6A1):c.2049C>T (p.Asn683=) rs143695871
NM_001848.2(COL6A1):c.2061C>A (p.Leu687=) rs8132678
NM_001848.2(COL6A1):c.2066+15C>A rs201407082
NM_001848.2(COL6A1):c.2067-10T>C rs200727020
NM_001848.2(COL6A1):c.2109G>A (p.Thr703=) rs760649238
NM_001848.2(COL6A1):c.2130G>A (p.Thr710=) rs147219060
NM_001848.2(COL6A1):c.2148G>A (p.Pro716=) rs780032842
NM_001848.2(COL6A1):c.2187C>T (p.Asp729=) rs369502543
NM_001848.2(COL6A1):c.2220G>A (p.Pro740=) rs138976133
NM_001848.2(COL6A1):c.2220G>T (p.Pro740=) rs138976133
NM_001848.2(COL6A1):c.2250+19G>C rs1057521436
NM_001848.2(COL6A1):c.2250+6G>C rs202212586
NM_001848.2(COL6A1):c.2251-29C>T rs35796750
NM_001848.2(COL6A1):c.227+15C>T rs199730779
NM_001848.2(COL6A1):c.2298A>G (p.Ser766=) rs761665024
NM_001848.2(COL6A1):c.2348G>A (p.Arg783Gln) rs200261890
NM_001848.2(COL6A1):c.2418C>T (p.Thr806=) rs760768642
NM_001848.2(COL6A1):c.2424G>T (p.Gln808His) rs140547835
NM_001848.2(COL6A1):c.2434+15A>G rs2236485
NM_001848.2(COL6A1):c.2434+15_2434+54del40 rs1064795349
NM_001848.2(COL6A1):c.2434+20G>A rs2236486
NM_001848.2(COL6A1):c.2434+55G>A rs2236487
NM_001848.2(COL6A1):c.2435-19C>T rs115181427
NM_001848.2(COL6A1):c.2441A>G (p.Lys814Arg) rs11553518
NM_001848.2(COL6A1):c.2464+11C>T rs202074876
NM_001848.2(COL6A1):c.2464+18C>T rs754626987
NM_001848.2(COL6A1):c.2464+9C>T rs368651226
NM_001848.2(COL6A1):c.2465-4G>A rs769559126
NM_001848.2(COL6A1):c.2469G>A (p.Thr823=) rs146662894
NM_001848.2(COL6A1):c.2480C>T (p.Pro827Leu) rs761774962
NM_001848.2(COL6A1):c.2512G>A (p.Ala838Thr) rs529770550
NM_001848.2(COL6A1):c.2517C>T (p.Ser839=) rs141463437
NM_001848.2(COL6A1):c.2549G>A (p.Arg850His) rs1053312
NM_001848.2(COL6A1):c.2569G>A (p.Glu857Lys) rs570688674
NM_001848.2(COL6A1):c.2573G>A (p.Arg858His) rs537763400
NM_001848.2(COL6A1):c.2601C>T (p.Pro867=) rs200124802
NM_001848.2(COL6A1):c.2622G>A (p.Ala874=) rs371763977
NM_001848.2(COL6A1):c.2635A>G (p.Ser879Gly) rs140534207
NM_001848.2(COL6A1):c.2642C>T (p.Thr881Met) rs150432347
NM_001848.2(COL6A1):c.2667G>A (p.Ala889=) rs1053315
NM_001848.2(COL6A1):c.2669C>T (p.Ser890Leu) rs13051496
NM_001848.2(COL6A1):c.2670G>A (p.Ser890=) rs527265374
NM_001848.2(COL6A1):c.2709C>T (p.Ala903=) rs139018148
NM_001848.2(COL6A1):c.2736C>T (p.Asp912=) rs13879
NM_001848.2(COL6A1):c.2742C>T (p.Thr914=) rs115163637
NM_001848.2(COL6A1):c.2758C>T (p.Leu920=) rs141620374
NM_001848.2(COL6A1):c.2781C>T (p.Tyr927=) rs61735853
NM_001848.2(COL6A1):c.2783G>A (p.Arg928His) rs144671871
NM_001848.2(COL6A1):c.2796C>T (p.Ser932=) rs1053320
NM_001848.2(COL6A1):c.2809A>G (p.Lys937Glu) rs117583120
NM_001848.2(COL6A1):c.2856C>T (p.Pro952=) rs140427635
NM_001848.2(COL6A1):c.2865C>T (p.Ile955=) rs138062080
NM_001848.2(COL6A1):c.2866G>A (p.Glu956Lys) rs149534094
NM_001848.2(COL6A1):c.2874C>T (p.Ala958=) rs769441014
NM_001848.2(COL6A1):c.2968A>C (p.Lys990Gln) rs141663473
NM_001848.2(COL6A1):c.2994C>T (p.Tyr998=) rs148405880
NM_001848.2(COL6A1):c.3029A>G (p.Gln1010Arg) rs141605607
NM_001848.2(COL6A1):c.3054C>T (p.His1018=) rs141237809
NM_001848.2(COL6A1):c.3078G>A (p.Ala1026=)
NM_001848.2(COL6A1):c.324C>T (p.Gly108=) rs138646508
NM_001848.2(COL6A1):c.347G>A (p.Ser116Asn) rs11553519
NM_001848.2(COL6A1):c.348C>T (p.Ser116=) rs189444981
NM_001848.2(COL6A1):c.349G>A (p.Val117Met) rs150686304
NM_001848.2(COL6A1):c.350T>C (p.Val117Ala) rs138899581
NM_001848.2(COL6A1):c.381C>T (p.Thr127=) rs75180385
NM_001848.2(COL6A1):c.394G>A (p.Ala132Thr)
NM_001848.2(COL6A1):c.423C>A (p.Leu141=) rs373486149
NM_001848.2(COL6A1):c.423C>T (p.Leu141=) rs373486149
NM_001848.2(COL6A1):c.428+14A>G rs3746993
NM_001848.2(COL6A1):c.428+39C>G rs148766287
NM_001848.2(COL6A1):c.428+40G>A rs71324475
NM_001848.2(COL6A1):c.429-19G>A rs741956
NM_001848.2(COL6A1):c.429-30C>T rs190029634
NM_001848.2(COL6A1):c.510G>A (p.Gly170=) rs373970248
NM_001848.2(COL6A1):c.579C>T (p.Pro193=) rs61751027
NM_001848.2(COL6A1):c.588+13C>A rs754507
NM_001848.2(COL6A1):c.588+19dupC rs111710378
NM_001848.2(COL6A1):c.588+37A>G rs117470181
NM_001848.2(COL6A1):c.588+8C>G rs398123638
NM_001848.2(COL6A1):c.588+9C>T rs776935888
NM_001848.2(COL6A1):c.615G>A (p.Thr205=) rs192125814
NM_001848.2(COL6A1):c.645G>A (p.Ala215=) rs115292913
NM_001848.2(COL6A1):c.666C>T (p.Arg222=) rs372581026
NM_001848.2(COL6A1):c.717+32C>T rs114454809
NM_001848.2(COL6A1):c.717+33G>A rs373394656
NM_001848.2(COL6A1):c.739-11delT rs573196191
NM_001848.2(COL6A1):c.739-18C>T rs144843800
NM_001848.2(COL6A1):c.739-51C>T rs62215498
NM_001848.2(COL6A1):c.759+16G>A rs373366336
NM_001848.2(COL6A1):c.760-11C>T rs1556425140
NM_001848.2(COL6A1):c.777G>A (p.Pro259=) rs61735854
NM_001848.2(COL6A1):c.805-36G>A rs202231424
NM_001848.2(COL6A1):c.859-18T>A rs398123641
NM_001848.2(COL6A1):c.859-19A>G rs2277814
NM_001848.2(COL6A1):c.859-20C>T rs78884675
NM_001848.2(COL6A1):c.903+14C>A rs34495634
NM_001848.2(COL6A1):c.930+14G>A rs766551754
NM_001848.2(COL6A1):c.930+20G>C rs765683206
NM_001848.2(COL6A1):c.930+30T>C rs148909683
NM_001848.2(COL6A1):c.931-4G>A rs758332867
NM_001848.2(COL6A1):c.958-17G>A rs79364611
NM_001848.2(COL6A1):c.97+20G>A rs114178849
NM_001848.2(COL6A1):c.981C>T (p.Ile327=) rs138401567
NM_001848.2(COL6A1):c.993C>T (p.Asp331=) rs373948031
NM_001848.2(COL6A1):c.997G>A (p.Val333Met) rs201525908

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.