ClinVar Miner

List of variants in gene COL6A1 reported as benign

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 169
Download table as spreadsheet
GRCh37/hg19 21q22.3(chr21:47402620-47465205)x3
GRCh37/hg19 21q22.3(chr21:47417303-47426252)x3
GRCh37/hg19 21q22.3(chr21:47421947-47427839)x3
GRCh37/hg19 21q22.3(chr21:47423636-47427839)x1
NM_001848.2(COL6A1):c.*260A>G rs1053331
NM_001848.2(COL6A1):c.*379C>A rs138073264
NM_001848.2(COL6A1):c.*419A>G rs9254
NM_001848.2(COL6A1):c.-5C>G rs7671
NM_001848.2(COL6A1):c.1002+37A>G rs11702174
NM_001848.2(COL6A1):c.1002+43A>G rs11702175
NM_001848.2(COL6A1):c.1002+43_1002+52delAATGGGGCGA rs398123629
NM_001848.2(COL6A1):c.1002+43_1002+81delAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGA rs72435610
NM_001848.2(COL6A1):c.1002+45T>C rs368643049
NM_001848.2(COL6A1):c.1002+50C>A rs11702079
NM_001848.2(COL6A1):c.1002+50C>T rs11702079
NM_001848.2(COL6A1):c.1056C>T (p.Asp352=) rs116343553
NM_001848.2(COL6A1):c.1095T>C (p.Gly365=) rs1980982
NM_001848.2(COL6A1):c.1119+39C>T rs74982956
NM_001848.2(COL6A1):c.1120-12G>A rs115107397
NM_001848.2(COL6A1):c.1182+20C>T rs7275706
NM_001848.2(COL6A1):c.1182+3G>A rs62215499
NM_001848.2(COL6A1):c.1273-8C>T rs7280215
NM_001848.2(COL6A1):c.1298G>A (p.Arg433Gln) rs151158105
NM_001848.2(COL6A1):c.1314G>A (p.Thr438=) rs7279254
NM_001848.2(COL6A1):c.1316G>A (p.Arg439Gln) rs35059000
NM_001848.2(COL6A1):c.1335+20G>C rs9306146
NM_001848.2(COL6A1):c.1335+27A>C rs2850173
NM_001848.2(COL6A1):c.1399-32T>C rs2839077
NM_001848.2(COL6A1):c.1443G>A (p.Glu481=) rs80244281
NM_001848.2(COL6A1):c.1461+18C>A rs2276254
NM_001848.2(COL6A1):c.1461+41dupG rs3216137
NM_001848.2(COL6A1):c.1462-36A>G rs2276255
NM_001848.2(COL6A1):c.1475C>T (p.Ala492Val) rs117340427
NM_001848.2(COL6A1):c.1506G>C (p.Pro502=) rs139987124
NM_001848.2(COL6A1):c.1518T>C (p.Gly506=) rs35134265
NM_001848.2(COL6A1):c.1524+15G>A rs116000285
NM_001848.2(COL6A1):c.1524+19G>C rs2276256
NM_001848.2(COL6A1):c.1525-60A>G rs3737437
NM_001848.2(COL6A1):c.1584G>A (p.Pro528=) rs139243418
NM_001848.2(COL6A1):c.1612-10G>A rs141892165
NM_001848.2(COL6A1):c.1612-6C>T rs143812383
NM_001848.2(COL6A1):c.1644C>T (p.Asp548=) rs182425338
NM_001848.2(COL6A1):c.1674+46_1674+47dupCA rs200245740
NM_001848.2(COL6A1):c.1675-55C>T rs4819179
NM_001848.2(COL6A1):c.1740+50C>T rs148205490
NM_001848.2(COL6A1):c.1773G>A (p.Pro591=) rs74852641
NM_001848.2(COL6A1):c.1813+25T>G rs191946565
NM_001848.2(COL6A1):c.1814-6C>G rs182804464
NM_001848.2(COL6A1):c.1822+42G>C rs13053065
NM_001848.2(COL6A1):c.1822+45C>G rs7276098
NM_001848.2(COL6A1):c.1822+45C>T rs7276098
NM_001848.2(COL6A1):c.1822+80G>A rs7283989
NM_001848.2(COL6A1):c.1822+88A>G rs7276782
NM_001848.2(COL6A1):c.1823-31C>T rs117330552
NM_001848.2(COL6A1):c.1823-8G>A rs184666690
NM_001848.2(COL6A1):c.1833C>T (p.Cys611=) rs142554239
NM_001848.2(COL6A1):c.1956+15C>T rs11701124
NM_001848.2(COL6A1):c.1957-11C>T rs8132521
NM_001848.2(COL6A1):c.1957-5C>T rs78224483
NM_001848.2(COL6A1):c.2042T>C (p.Ile681Thr) rs138884734
NM_001848.2(COL6A1):c.2049C>T (p.Asn683=) rs143695871
NM_001848.2(COL6A1):c.2061C>A (p.Leu687=) rs8132678
NM_001848.2(COL6A1):c.2067-10T>C rs200727020
NM_001848.2(COL6A1):c.2130G>A (p.Thr710=) rs147219060
NM_001848.2(COL6A1):c.2220G>A (p.Pro740=) rs138976133
NM_001848.2(COL6A1):c.2250+6G>C rs202212586
NM_001848.2(COL6A1):c.2251-29C>T rs35796750
NM_001848.2(COL6A1):c.2424G>T (p.Gln808His) rs140547835
NM_001848.2(COL6A1):c.2434+15A>G rs2236485
NM_001848.2(COL6A1):c.2434+15_2434+54del rs1064795349
NM_001848.2(COL6A1):c.2434+20G>A rs2236486
NM_001848.2(COL6A1):c.2434+55G>A rs2236487
NM_001848.2(COL6A1):c.2435-19C>T rs115181427
NM_001848.2(COL6A1):c.2441A>G (p.Lys814Arg) rs11553518
NM_001848.2(COL6A1):c.2517C>T (p.Ser839=) rs141463437
NM_001848.2(COL6A1):c.2549G>A (p.Arg850His) rs1053312
NM_001848.2(COL6A1):c.2622G>A (p.Ala874=) rs371763977
NM_001848.2(COL6A1):c.2635A>G (p.Ser879Gly) rs140534207
NM_001848.2(COL6A1):c.2638G>A (p.Gly880Ser) rs544927344
NM_001848.2(COL6A1):c.2667G>A (p.Ala889=) rs1053315
NM_001848.2(COL6A1):c.2669C>T (p.Ser890Leu) rs13051496
NM_001848.2(COL6A1):c.2736C>T (p.Asp912=) rs13879
NM_001848.2(COL6A1):c.2742C>T (p.Thr914=) rs115163637
NM_001848.2(COL6A1):c.2758C>T (p.Leu920=) rs141620374
NM_001848.2(COL6A1):c.2781C>T (p.Tyr927=) rs61735853
NM_001848.2(COL6A1):c.2783G>A (p.Arg928His) rs144671871
NM_001848.2(COL6A1):c.2796C>T (p.Ser932=) rs1053320
NM_001848.2(COL6A1):c.2865C>T (p.Ile955=) rs138062080
NM_001848.2(COL6A1):c.2866G>A (p.Glu956Lys) rs149534094
NM_001848.2(COL6A1):c.3054C>T (p.His1018=) rs141237809
NM_001848.2(COL6A1):c.324C>T (p.Gly108=) rs138646508
NM_001848.2(COL6A1):c.347G>A (p.Ser116Asn) rs11553519
NM_001848.2(COL6A1):c.381C>T (p.Thr127=) rs75180385
NM_001848.2(COL6A1):c.428+14A>G rs3746993
NM_001848.2(COL6A1):c.428+39C>G rs148766287
NM_001848.2(COL6A1):c.428+40G>A rs71324475
NM_001848.2(COL6A1):c.429-19G>A rs741956
NM_001848.2(COL6A1):c.579C>T (p.Pro193=) rs61751027
NM_001848.2(COL6A1):c.588+13C>A rs754507
NM_001848.2(COL6A1):c.588+19dup rs111710378
NM_001848.2(COL6A1):c.588+37A>G rs117470181
NM_001848.2(COL6A1):c.588+8C>G rs398123638
NM_001848.2(COL6A1):c.645G>A (p.Ala215=) rs115292913
NM_001848.2(COL6A1):c.717+32C>T rs114454809
NM_001848.2(COL6A1):c.739-18C>T rs144843800
NM_001848.2(COL6A1):c.739-51C>T rs62215498
NM_001848.2(COL6A1):c.759+16G>A rs373366336
NM_001848.2(COL6A1):c.777G>A (p.Pro259=) rs61735854
NM_001848.2(COL6A1):c.859-19A>G rs2277814
NM_001848.2(COL6A1):c.859-20C>T rs78884675
NM_001848.2(COL6A1):c.903+14C>A rs34495634
NM_001848.2(COL6A1):c.958-17G>A rs79364611
NM_001848.2(COL6A1):c.97+20G>A rs114178849

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.