ClinVar Miner

List of variants in gene COL6A1 reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 210
Download table as spreadsheet
HGVS dbSNP
NC_000021.9:g.(?_45989064)_(45989157_?)del
NM_001848.2(COL6A1):c.1002+6_1002+88delTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGAAGGTGAC rs1556425727
NM_001848.2(COL6A1):c.1003-2delA rs1556425835
NM_001848.2(COL6A1):c.1003_1056del54 rs398123631
NM_001848.2(COL6A1):c.1022G>T (p.Gly341Val) rs121912935
NM_001848.2(COL6A1):c.1029A>C (p.Pro343=) rs1556425843
NM_001848.2(COL6A1):c.1030G>C (p.Gly344Arg)
NM_001848.2(COL6A1):c.1043C>T (p.Ser348Leu) rs142882745
NM_001848.2(COL6A1):c.1047C>T (p.Pro349=) rs202227298
NM_001848.2(COL6A1):c.1056+5G>A rs886044511
NM_001848.2(COL6A1):c.1056C>T (p.Asp352=) rs116343553
NM_001848.2(COL6A1):c.105C>G (p.Pro35=) rs145579577
NM_001848.2(COL6A1):c.1095_1096invTG (p.Ala366Thr)
NM_001848.2(COL6A1):c.1115A>G (p.Glu372Gly) rs149338158
NM_001848.2(COL6A1):c.1122C>T (p.Gly374=) rs373535692
NM_001848.2(COL6A1):c.1182+3G>A rs62215499
NM_001848.2(COL6A1):c.1182+5G>C
NM_001848.2(COL6A1):c.1190C>T (p.Pro397Leu) rs746386684
NM_001848.2(COL6A1):c.1227G>A (p.Ala409=) rs557250335
NM_001848.2(COL6A1):c.1231G>A (p.Asp411Asn)
NM_001848.2(COL6A1):c.1271G>A (p.Arg424Gln) rs761729281
NM_001848.2(COL6A1):c.1273-8C>T rs7280215
NM_001848.2(COL6A1):c.1294C>A (p.Pro432Thr)
NM_001848.2(COL6A1):c.1298G>A (p.Arg433Gln) rs151158105
NM_001848.2(COL6A1):c.1314G>A (p.Thr438=) rs7279254
NM_001848.2(COL6A1):c.1316G>A (p.Arg439Gln) rs35059000
NM_001848.2(COL6A1):c.1342G>A (p.Ala448Thr) rs886057153
NM_001848.2(COL6A1):c.1350G>A (p.Pro450=) rs144887329
NM_001848.2(COL6A1):c.1378G>T (p.Val460Phe) rs375452881
NM_001848.2(COL6A1):c.1379T>C (p.Val460Ala) rs140735590
NM_001848.2(COL6A1):c.1397C>T (p.Pro466Leu) rs746962124
NM_001848.2(COL6A1):c.1398+10G>A rs143438559
NM_001848.2(COL6A1):c.1398+2T>G
NM_001848.2(COL6A1):c.1399-8C>G rs749529856
NM_001848.2(COL6A1):c.1443G>A (p.Glu481=) rs80244281
NM_001848.2(COL6A1):c.1459G>A (p.Glu487Lys)
NM_001848.2(COL6A1):c.1462-8C>T rs199849694
NM_001848.2(COL6A1):c.1475C>T (p.Ala492Val) rs117340427
NM_001848.2(COL6A1):c.148delC (p.Leu50Terfs) rs1556423728
NM_001848.2(COL6A1):c.14G>A (p.Arg5His) rs1556423460
NM_001848.2(COL6A1):c.1506G>C (p.Pro502=) rs139987124
NM_001848.2(COL6A1):c.1508G>A (p.Gly503Glu) rs1556428597
NM_001848.2(COL6A1):c.1518T>C (p.Gly506=) rs35134265
NM_001848.2(COL6A1):c.1540G>A (p.Ala514Thr) rs760815168
NM_001848.2(COL6A1):c.1576-1G>A
NM_001848.2(COL6A1):c.1584G>A (p.Pro528=) rs139243418
NM_001848.2(COL6A1):c.1602C>T (p.Pro534=) rs143755280
NM_001848.2(COL6A1):c.1603G>A (p.Gly535Arg) rs764556767
NM_001848.2(COL6A1):c.1611C>T (p.Asn537=) rs200023632
NM_001848.2(COL6A1):c.1612-10G>A rs141892165
NM_001848.2(COL6A1):c.1612-6C>T rs143812383
NM_001848.2(COL6A1):c.162C>T (p.Pro54=) rs775062782
NM_001848.2(COL6A1):c.1644C>T (p.Asp548=) rs182425338
NM_001848.2(COL6A1):c.1666G>A (p.Gly556Arg) rs886043521
NM_001848.2(COL6A1):c.1681G>A (p.Asp561Asn) rs140517685
NM_001848.2(COL6A1):c.1684A>G (p.Ile562Val) rs374315921
NM_001848.2(COL6A1):c.1708G>A (p.Ala570Thr) rs144358858
NM_001848.2(COL6A1):c.170C>A (p.Ala57Asp) rs143502850
NM_001848.2(COL6A1):c.1729G>A (p.Glu577Lys) rs552634753
NM_001848.2(COL6A1):c.1741-6G>A rs200334019
NM_001848.2(COL6A1):c.1745C>T (p.Pro582Leu) rs766478019
NM_001848.2(COL6A1):c.1773G>A (p.Pro591=) rs74852641
NM_001848.2(COL6A1):c.1776C>T (p.Asp592=) rs148439285
NM_001848.2(COL6A1):c.1814-6C>G rs182804464
NM_001848.2(COL6A1):c.1823-1G>T
NM_001848.2(COL6A1):c.1823-8G>A rs184666690
NM_001848.2(COL6A1):c.1825T>C (p.Cys609Arg)
NM_001848.2(COL6A1):c.1829A>C (p.Lys610Thr) rs768906709
NM_001848.2(COL6A1):c.1833C>T (p.Cys611=) rs142554239
NM_001848.2(COL6A1):c.1848_1850delCCT (p.Leu617del) rs1085307560
NM_001848.2(COL6A1):c.1855G>A (p.Val619Met) rs150938324
NM_001848.2(COL6A1):c.1877T>C (p.Ile626Thr) rs781626943
NM_001848.2(COL6A1):c.1908C>G (p.Asp636Glu) rs886042572
NM_001848.2(COL6A1):c.1930C>T (p.Arg644Trp) rs146622557
NM_001848.2(COL6A1):c.1957-5C>T rs78224483
NM_001848.2(COL6A1):c.1959C>T (p.Phe653=) rs112104768
NM_001848.2(COL6A1):c.2009T>C (p.Met670Thr) rs776241591
NM_001848.2(COL6A1):c.2022G>A (p.Val674=) rs764099825
NM_001848.2(COL6A1):c.202C>T (p.Arg68Cys) rs137964147
NM_001848.2(COL6A1):c.2042T>C (p.Ile681Thr) rs138884734
NM_001848.2(COL6A1):c.2044C>T (p.Arg682Trp) rs777378283
NM_001848.2(COL6A1):c.2045G>A (p.Arg682Gln) rs148962954
NM_001848.2(COL6A1):c.2049C>T (p.Asn683=) rs143695871
NM_001848.2(COL6A1):c.2061C>A (p.Leu687=) rs8132678
NM_001848.2(COL6A1):c.2067-10T>C rs200727020
NM_001848.2(COL6A1):c.2067-6A>G rs113876477
NM_001848.2(COL6A1):c.2130G>A (p.Thr710=) rs147219060
NM_001848.2(COL6A1):c.2157G>C (p.Pro719=) rs377152990
NM_001848.2(COL6A1):c.2200A>G (p.Thr734Ala) rs562898957
NM_001848.2(COL6A1):c.2220G>A (p.Pro740=) rs138976133
NM_001848.2(COL6A1):c.2250+6G>C rs202212586
NM_001848.2(COL6A1):c.2343G>A (p.Gln781=) rs755487987
NM_001848.2(COL6A1):c.2348G>A (p.Arg783Gln) rs200261890
NM_001848.2(COL6A1):c.2352C>T (p.Pro784=) rs377558756
NM_001848.2(COL6A1):c.2355C>A (p.Gly785=) rs149910296
NM_001848.2(COL6A1):c.2424G>T (p.Gln808His) rs140547835
NM_001848.2(COL6A1):c.2431_2434+36del rs759918870
NM_001848.2(COL6A1):c.2434+15_2434+54del40 rs1064795349
NM_001848.2(COL6A1):c.2434+4C>T rs202147670
NM_001848.2(COL6A1):c.2437A>G (p.Lys813Glu) rs936641232
NM_001848.2(COL6A1):c.2441A>G (p.Lys814Arg) rs11553518
NM_001848.2(COL6A1):c.2464+9C>T rs368651226
NM_001848.2(COL6A1):c.2469G>A (p.Thr823=) rs146662894
NM_001848.2(COL6A1):c.2517C>T (p.Ser839=) rs141463437
NM_001848.2(COL6A1):c.2554G>C (p.Ala852Pro) rs748327110
NM_001848.2(COL6A1):c.2595G>A (p.Thr865=) rs367832752
NM_001848.2(COL6A1):c.2603C>T (p.Ala868Val)
NM_001848.2(COL6A1):c.2611G>A (p.Val871Met) rs374685631
NM_001848.2(COL6A1):c.2614C>T (p.Arg872Trp) rs368561027
NM_001848.2(COL6A1):c.2615G>A (p.Arg872Gln) rs377586358
NM_001848.2(COL6A1):c.2622G>A (p.Ala874=) rs371763977
NM_001848.2(COL6A1):c.2635A>G (p.Ser879Gly) rs140534207
NM_001848.2(COL6A1):c.2637C>T (p.Ser879=) rs540554122
NM_001848.2(COL6A1):c.2638G>A (p.Gly880Ser) rs544927344
NM_001848.2(COL6A1):c.2642C>T (p.Thr881Met) rs150432347
NM_001848.2(COL6A1):c.2663G>A (p.Arg888Gln) rs138351067
NM_001848.2(COL6A1):c.2694G>A (p.Thr898=) rs372931456
NM_001848.2(COL6A1):c.2705G>A (p.Ser902Asn) rs757422397
NM_001848.2(COL6A1):c.2709C>T (p.Ala903=) rs139018148
NM_001848.2(COL6A1):c.2736C>T (p.Asp912=) rs13879
NM_001848.2(COL6A1):c.273G>A (p.Leu91=) rs759821375
NM_001848.2(COL6A1):c.2742C>T (p.Thr914=) rs115163637
NM_001848.2(COL6A1):c.2746G>A (p.Val916Ile) rs563043611
NM_001848.2(COL6A1):c.2751C>T (p.Asn917=) rs767760988
NM_001848.2(COL6A1):c.2758C>T (p.Leu920=) rs141620374
NM_001848.2(COL6A1):c.2768T>G (p.Val923Gly)
NM_001848.2(COL6A1):c.2781C>T (p.Tyr927=) rs61735853
NM_001848.2(COL6A1):c.2783G>A (p.Arg928His) rs144671871
NM_001848.2(COL6A1):c.2784C>T (p.Arg928=) rs775569169
NM_001848.2(COL6A1):c.2785G>A (p.Glu929Lys) rs145846228
NM_001848.2(COL6A1):c.2809A>G (p.Lys937Glu) rs117583120
NM_001848.2(COL6A1):c.2820G>A (p.Leu940=) rs111451684
NM_001848.2(COL6A1):c.2852C>T (p.Thr951Met) rs371111712
NM_001848.2(COL6A1):c.2857G>T (p.Ala953Ser)
NM_001848.2(COL6A1):c.285C>G (p.Asp95Glu) rs145811554
NM_001848.2(COL6A1):c.2863A>G (p.Ile955Val) rs373070436
NM_001848.2(COL6A1):c.2865C>T (p.Ile955=) rs138062080
NM_001848.2(COL6A1):c.2866G>A (p.Glu956Lys) rs149534094
NM_001848.2(COL6A1):c.286G>A (p.Glu96Lys) rs759023976
NM_001848.2(COL6A1):c.2875G>A (p.Val959Met) rs200959957
NM_001848.2(COL6A1):c.2876T>C (p.Val959Ala) rs144814689
NM_001848.2(COL6A1):c.2899A>G (p.Ile967Val) rs777671647
NM_001848.2(COL6A1):c.2911G>A (p.Val971Met) rs769795690
NM_001848.2(COL6A1):c.2941C>A (p.Pro981Thr)
NM_001848.2(COL6A1):c.2950C>T (p.Arg984Cys)
NM_001848.2(COL6A1):c.3029A>G (p.Gln1010Arg) rs141605607
NM_001848.2(COL6A1):c.3034C>T (p.Leu1012=) rs150509473
NM_001848.2(COL6A1):c.3041G>A (p.Arg1014His)
NM_001848.2(COL6A1):c.3054C>T (p.His1018=) rs141237809
NM_001848.2(COL6A1):c.324C>T (p.Gly108=) rs138646508
NM_001848.2(COL6A1):c.325G>A (p.Gly109Ser) rs368580280
NM_001848.2(COL6A1):c.331G>A (p.Asp111Asn)
NM_001848.2(COL6A1):c.344G>A (p.Ser115Asn)
NM_001848.2(COL6A1):c.347G>A (p.Ser116Asn) rs11553519
NM_001848.2(COL6A1):c.349G>A (p.Val117Met) rs150686304
NM_001848.2(COL6A1):c.350T>C (p.Val117Ala) rs138899581
NM_001848.2(COL6A1):c.356C>T (p.Ala119Val) rs571641824
NM_001848.2(COL6A1):c.362A>G (p.Lys121Arg) rs121912936
NM_001848.2(COL6A1):c.377G>T (p.Gly126Val)
NM_001848.2(COL6A1):c.381C>T (p.Thr127=) rs75180385
NM_001848.2(COL6A1):c.409C>G (p.Leu137Val) rs139648899
NM_001848.2(COL6A1):c.423C>T (p.Leu141=) rs373486149
NM_001848.2(COL6A1):c.424G>C (p.Val142Leu) rs144282452
NM_001848.2(COL6A1):c.539A>G (p.Lys180Arg) rs756141940
NM_001848.2(COL6A1):c.554A>G (p.Lys185Arg) rs754667407
NM_001848.2(COL6A1):c.579C>T (p.Pro193=) rs61751027
NM_001848.2(COL6A1):c.588+8C>G rs398123638
NM_001848.2(COL6A1):c.596G>A (p.Arg199His)
NM_001848.2(COL6A1):c.5G>A (p.Arg2Lys)
NM_001848.2(COL6A1):c.609C>T (p.Ile203=) rs369590506
NM_001848.2(COL6A1):c.621C>A (p.His207Gln) rs866987981
NM_001848.2(COL6A1):c.623C>T (p.Thr208Met) rs372199631
NM_001848.2(COL6A1):c.624G>A (p.Thr208=) rs573282005
NM_001848.2(COL6A1):c.631C>G (p.Arg211Gly) rs375217284
NM_001848.2(COL6A1):c.631C>T (p.Arg211Cys) rs375217284
NM_001848.2(COL6A1):c.645G>A (p.Ala215=) rs115292913
NM_001848.2(COL6A1):c.666C>T (p.Arg222=) rs372581026
NM_001848.2(COL6A1):c.669C>T (p.Asp223=) rs552000247
NM_001848.2(COL6A1):c.678G>A (p.Glu226=) rs1370178953
NM_001848.2(COL6A1):c.680C>T (p.Ala227Val)
NM_001848.2(COL6A1):c.69G>A (p.Pro23=) rs149741299
NM_001848.2(COL6A1):c.717+4A>G rs762867111
NM_001848.2(COL6A1):c.717+9C>T rs183868804
NM_001848.2(COL6A1):c.750C>A (p.Phe250Leu) rs748153811
NM_001848.2(COL6A1):c.763G>A (p.Ala255Thr) rs145473829
NM_001848.2(COL6A1):c.777G>A (p.Pro259=) rs61735854
NM_001848.2(COL6A1):c.788G>T (p.Gly263Val)
NM_001848.2(COL6A1):c.813A>G (p.Arg271=) rs748184568
NM_001848.2(COL6A1):c.814G>C (p.Gly272Arg)
NM_001848.2(COL6A1):c.821C>T (p.Pro274Leu) rs201093313
NM_001848.2(COL6A1):c.823G>T (p.Gly275Trp) rs1556425467
NM_001848.2(COL6A1):c.824G>T (p.Gly275Val) rs1556425468
NM_001848.2(COL6A1):c.846_854delAGCCGGAGA (p.Glu282_Gly284del) rs1556425474
NM_001848.2(COL6A1):c.850G>A (p.Gly284Arg) rs121912938
NM_001848.2(COL6A1):c.85G>A (p.Val29Met)
NM_001848.2(COL6A1):c.868G>A (p.Gly290Arg) rs121912939
NM_001848.2(COL6A1):c.868G>T (p.Gly290Trp) rs121912939
NM_001848.2(COL6A1):c.877G>A (p.Gly293Arg) rs398123643
NM_001848.2(COL6A1):c.880C>G (p.Pro294Ala) rs141572895
NM_001848.2(COL6A1):c.903+5G>A
NM_001848.2(COL6A1):c.905G>A (p.Gly302Glu) rs1556425566
NM_001848.2(COL6A1):c.930+189C>T rs1556425596
NM_001848.2(COL6A1):c.957_957+7del rs1556425687
NM_001848.2(COL6A1):c.958-2A>G rs1556425717
NM_001848.2(COL6A1):c.98-6G>A rs886042599
NM_001848.2(COL6A1):c.981C>T (p.Ile327=) rs138401567
NM_001848.2(COL6A1):c.984C>T (p.Asp328=) rs781038607
NM_001848.2(COL6A1):c.993C>T (p.Asp331=) rs373948031
NM_001848.2(COL6A1):c.996C>T (p.Gly332=) rs11702055
NM_001848.2(COL6A1):c.997G>A (p.Val333Met) rs201525908

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.