ClinVar Miner

List of variants in gene COL6A1 reported as uncertain significance by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 133
Download table as spreadsheet
HGVS dbSNP
NM_001848.2(COL6A1):c.1002+6_1002+88delTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGAAGGTGAC rs1556425727
NM_001848.2(COL6A1):c.1015T>C (p.Tyr339His) rs186775751
NM_001848.2(COL6A1):c.1030G>C (p.Gly344Arg) rs1569518250
NM_001848.2(COL6A1):c.1043C>T (p.Ser348Leu) rs142882745
NM_001848.2(COL6A1):c.1056+5G>A rs886044511
NM_001848.2(COL6A1):c.1095_1096inv (p.Ala366Thr)
NM_001848.2(COL6A1):c.1122C>T (p.Gly374=) rs373535692
NM_001848.2(COL6A1):c.1160G>A (p.Ser387Asn)
NM_001848.2(COL6A1):c.1182+5G>C rs1473206283
NM_001848.2(COL6A1):c.1190C>T (p.Pro397Leu) rs746386684
NM_001848.2(COL6A1):c.1231G>A (p.Asp411Asn)
NM_001848.2(COL6A1):c.1271G>A (p.Arg424Gln) rs761729281
NM_001848.2(COL6A1):c.1294C>A (p.Pro432Thr) rs1436272876
NM_001848.2(COL6A1):c.1315C>T (p.Arg439Trp)
NM_001848.2(COL6A1):c.1342G>A (p.Ala448Thr) rs886057153
NM_001848.2(COL6A1):c.1378G>T (p.Val460Phe) rs375452881
NM_001848.2(COL6A1):c.1379T>C (p.Val460Ala) rs140735590
NM_001848.2(COL6A1):c.1397C>T (p.Pro466Leu) rs746962124
NM_001848.2(COL6A1):c.1447C>T (p.Pro483Ser)
NM_001848.2(COL6A1):c.1459G>A (p.Glu487Lys)
NM_001848.2(COL6A1):c.14G>A (p.Arg5His) rs1556423460
NM_001848.2(COL6A1):c.1508G>A (p.Gly503Glu) rs1556428597
NM_001848.2(COL6A1):c.1540G>A (p.Ala514Thr) rs760815168
NM_001848.2(COL6A1):c.1553C>A (p.Thr518Asn) rs201935658
NM_001848.2(COL6A1):c.1555G>A (p.Glu519Lys) rs754384963
NM_001848.2(COL6A1):c.1603G>A (p.Gly535Arg) rs764556767
NM_001848.2(COL6A1):c.1619A>G (p.Lys540Arg)
NM_001848.2(COL6A1):c.1666G>A (p.Gly556Arg) rs886043521
NM_001848.2(COL6A1):c.1681G>A (p.Asp561Asn) rs140517685
NM_001848.2(COL6A1):c.1684A>G (p.Ile562Val) rs374315921
NM_001848.2(COL6A1):c.170C>A (p.Ala57Asp) rs143502850
NM_001848.2(COL6A1):c.1712A>C (p.Lys571Thr) rs751040647
NM_001848.2(COL6A1):c.1729G>A (p.Glu577Lys) rs552634753
NM_001848.2(COL6A1):c.1732G>A (p.Gly578Ser)
NM_001848.2(COL6A1):c.1742G>C (p.Gly581Ala)
NM_001848.2(COL6A1):c.1745C>T (p.Pro582Leu) rs766478019
NM_001848.2(COL6A1):c.1782C>T (p.Cys594=) rs745847824
NM_001848.2(COL6A1):c.1825T>C (p.Cys609Arg)
NM_001848.2(COL6A1):c.1829A>C (p.Lys610Thr) rs768906709
NM_001848.2(COL6A1):c.1845_1847CCT[1] (p.Leu617del) rs1085307560
NM_001848.2(COL6A1):c.1855G>A (p.Val619Met) rs150938324
NM_001848.2(COL6A1):c.185T>G (p.Val62Gly)
NM_001848.2(COL6A1):c.1877T>C (p.Ile626Thr) rs781626943
NM_001848.2(COL6A1):c.1908C>G (p.Asp636Glu) rs886042572
NM_001848.2(COL6A1):c.1930C>T (p.Arg644Trp) rs146622557
NM_001848.2(COL6A1):c.1945G>A (p.Glu649Lys) rs764129993
NM_001848.2(COL6A1):c.1959C>G (p.Phe653Leu)
NM_001848.2(COL6A1):c.1979C>T (p.Ala660Val)
NM_001848.2(COL6A1):c.1982G>A (p.Gly661Asp)
NM_001848.2(COL6A1):c.2009T>C (p.Met670Thr) rs776241591
NM_001848.2(COL6A1):c.2021T>G (p.Val674Gly)
NM_001848.2(COL6A1):c.202C>T (p.Arg68Cys) rs137964147
NM_001848.2(COL6A1):c.2044C>T (p.Arg682Trp) rs777378283
NM_001848.2(COL6A1):c.2045G>A (p.Arg682Gln) rs148962954
NM_001848.2(COL6A1):c.2050G>A (p.Val684Met)
NM_001848.2(COL6A1):c.2191C>T (p.Arg731Cys) rs398123635
NM_001848.2(COL6A1):c.2200A>G (p.Thr734Ala) rs562898957
NM_001848.2(COL6A1):c.2343G>A (p.Gln781=) rs755487987
NM_001848.2(COL6A1):c.2434+4C>T rs202147670
NM_001848.2(COL6A1):c.2437A>G (p.Lys813Glu) rs936641232
NM_001848.2(COL6A1):c.2464+1G>A
NM_001848.2(COL6A1):c.2481G>A (p.Pro827=)
NM_001848.2(COL6A1):c.2518G>A (p.Val840Met)
NM_001848.2(COL6A1):c.2554G>C (p.Ala852Pro) rs748327110
NM_001848.2(COL6A1):c.2561G>A (p.Arg854His) rs200732314
NM_001848.2(COL6A1):c.2569G>A (p.Glu857Lys) rs570688674
NM_001848.2(COL6A1):c.2603C>T (p.Ala868Val)
NM_001848.2(COL6A1):c.2611G>A (p.Val871Met) rs374685631
NM_001848.2(COL6A1):c.2614C>T (p.Arg872Trp) rs368561027
NM_001848.2(COL6A1):c.2615G>A (p.Arg872Gln) rs377586358
NM_001848.2(COL6A1):c.2642C>T (p.Thr881Met) rs150432347
NM_001848.2(COL6A1):c.2663G>A (p.Arg888Gln) rs138351067
NM_001848.2(COL6A1):c.269C>T (p.Ala90Val)
NM_001848.2(COL6A1):c.2705G>A (p.Ser902Asn) rs757422397
NM_001848.2(COL6A1):c.2713G>A (p.Asp905Asn)
NM_001848.2(COL6A1):c.2743G>A (p.Asp915Asn)
NM_001848.2(COL6A1):c.2746G>A (p.Val916Ile) rs563043611
NM_001848.2(COL6A1):c.2768T>G (p.Val923Gly)
NM_001848.2(COL6A1):c.2783G>T (p.Arg928Leu)
NM_001848.2(COL6A1):c.2784C>T (p.Arg928=) rs775569169
NM_001848.2(COL6A1):c.2785G>A (p.Glu929Lys) rs145846228
NM_001848.2(COL6A1):c.2803G>A (p.Ala935Thr) rs766416007
NM_001848.2(COL6A1):c.2821C>T (p.Leu941Phe) rs147882179
NM_001848.2(COL6A1):c.2852C>T (p.Thr951Met) rs371111712
NM_001848.2(COL6A1):c.2857G>A (p.Ala953Thr) rs150378645
NM_001848.2(COL6A1):c.2857G>T (p.Ala953Ser)
NM_001848.2(COL6A1):c.285C>G (p.Asp95Glu) rs145811554
NM_001848.2(COL6A1):c.2863A>G (p.Ile955Val) rs373070436
NM_001848.2(COL6A1):c.286G>A (p.Glu96Lys) rs759023976
NM_001848.2(COL6A1):c.2873C>A (p.Ala958Asp) rs763228065
NM_001848.2(COL6A1):c.2875G>A (p.Val959Met) rs200959957
NM_001848.2(COL6A1):c.2876T>C (p.Val959Ala) rs144814689
NM_001848.2(COL6A1):c.2890C>T (p.Arg964Trp) rs375007666
NM_001848.2(COL6A1):c.2899A>G (p.Ile967Val) rs777671647
NM_001848.2(COL6A1):c.2920G>A (p.Val974Met)
NM_001848.2(COL6A1):c.2941C>A (p.Pro981Thr) rs1569519253
NM_001848.2(COL6A1):c.2950C>T (p.Arg984Cys)
NM_001848.2(COL6A1):c.2963C>G (p.Thr988Ser)
NM_001848.2(COL6A1):c.2996G>A (p.Gly999Asp)
NM_001848.2(COL6A1):c.3029A>G (p.Gln1010Arg) rs141605607
NM_001848.2(COL6A1):c.3040C>T (p.Arg1014Cys)
NM_001848.2(COL6A1):c.3041G>A (p.Arg1014His)
NM_001848.2(COL6A1):c.3056A>G (p.Gln1019Arg) rs751518356
NM_001848.2(COL6A1):c.325G>A (p.Gly109Ser) rs368580280
NM_001848.2(COL6A1):c.331G>A (p.Asp111Asn) rs1309822720
NM_001848.2(COL6A1):c.334G>A (p.Ala112Thr)
NM_001848.2(COL6A1):c.344G>A (p.Ser115Asn)
NM_001848.2(COL6A1):c.356C>T (p.Ala119Val) rs571641824
NM_001848.2(COL6A1):c.375G>C (p.Lys125Asn)
NM_001848.2(COL6A1):c.377G>T (p.Gly126Val) rs1300015385
NM_001848.2(COL6A1):c.509G>C (p.Gly170Ala)
NM_001848.2(COL6A1):c.539A>G (p.Lys180Arg) rs756141940
NM_001848.2(COL6A1):c.554A>G (p.Lys185Arg) rs754667407
NM_001848.2(COL6A1):c.596G>A (p.Arg199His)
NM_001848.2(COL6A1):c.5G>A (p.Arg2Lys) rs1305504243
NM_001848.2(COL6A1):c.621C>A (p.His207Gln) rs866987981
NM_001848.2(COL6A1):c.623C>T (p.Thr208Met) rs372199631
NM_001848.2(COL6A1):c.631C>G (p.Arg211Gly) rs375217284
NM_001848.2(COL6A1):c.631C>T (p.Arg211Cys) rs375217284
NM_001848.2(COL6A1):c.665G>A (p.Arg222His) rs780638665
NM_001848.2(COL6A1):c.680C>T (p.Ala227Val)
NM_001848.2(COL6A1):c.697G>A (p.Asp233Asn)
NM_001848.2(COL6A1):c.717+4A>G rs762867111
NM_001848.2(COL6A1):c.750C>A (p.Phe250Leu) rs748153811
NM_001848.2(COL6A1):c.763G>A (p.Ala255Thr) rs145473829
NM_001848.2(COL6A1):c.821C>T (p.Pro274Leu) rs201093313
NM_001848.2(COL6A1):c.85G>A (p.Val29Met)
NM_001848.2(COL6A1):c.880C>G (p.Pro294Ala) rs141572895
NM_001848.2(COL6A1):c.903+4C>T
NM_001848.2(COL6A1):c.903+5G>A
NM_001848.2(COL6A1):c.931-6C>A
NM_001848.2(COL6A1):c.956A>G (p.Lys319Arg) rs794727059
NM_001848.2(COL6A1):c.98-6G>A rs886042599

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.