ClinVar Miner

List of variants in gene CREBBP studied for Rubinstein-Taybi syndrome 1

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 164
Download table as spreadsheet
HGVS dbSNP
CREBBP, 2-BP DEL, NT5222
GRCh37/hg19 16p13.3(chr16:3794894-3795355)
NC_000016.10:g.(?_3736016)_(3736835_?)dup
NC_000016.10:g.(?_3736630)_(3740569_?)dup
NC_000016.10:g.(?_3744874)_(3758992_?)del
NC_000016.10:g.(?_3749607)_(3771006_?)dup
NC_000016.10:g.(?_3767700)_(3767929_?)dup
NG_009873.1:g.(?_5000)_(160068_?)del
NM_001079846.1(CREBBP):c.2947-1G>T rs1555481030
NM_004380.2(CREBBP):c.(?_-23)_85+?del
NM_004380.2(CREBBP):c.-204_85del
NM_004380.2(CREBBP):c.1063C>T (p.Gln355Ter) rs587783460
NM_004380.2(CREBBP):c.1063_1063delCinsAC (p.Gln355Thrfs)
NM_004380.2(CREBBP):c.1069C>T (p.Gln357Ter) rs121434625
NM_004380.2(CREBBP):c.1089T>C (p.His363=) rs969407052
NM_004380.2(CREBBP):c.1149G>A (p.Pro383=) rs61759495
NM_004380.2(CREBBP):c.1156C>T (p.Arg386Ter) rs587783461
NM_004380.2(CREBBP):c.1237C>T (p.Arg413Ter) rs1302427305
NM_004380.2(CREBBP):c.1257G>A (p.Trp419Ter) rs587783463
NM_004380.2(CREBBP):c.1270C>T (p.Arg424Ter) rs587783464
NM_004380.2(CREBBP):c.1279_1280delTG (p.Cys427Serfs)
NM_004380.2(CREBBP):c.1447C>T (p.Arg483Ter) rs1555484797
NM_004380.2(CREBBP):c.1562_1563delTC (p.Leu521Glnfs)
NM_004380.2(CREBBP):c.1590del (p.Asn530Lysfs) rs587783465
NM_004380.2(CREBBP):c.164A>G (p.Asn55Ser) rs587783466
NM_004380.2(CREBBP):c.1651C>A (p.Leu551Ile) rs61753381
NM_004380.2(CREBBP):c.1732C>T (p.Pro578Ser) rs148023511
NM_004380.2(CREBBP):c.1738G>A (p.Ala580Thr)
NM_004380.2(CREBBP):c.1821del (p.Lys607Asnfs) rs587783467
NM_004380.2(CREBBP):c.1917dup (p.Met640Hisfs)
NM_004380.2(CREBBP):c.1941+1G>A rs1555483834
NM_004380.2(CREBBP):c.1941+1G>T
NM_004380.2(CREBBP):c.1953T>C (p.Tyr651=) rs130003
NM_004380.2(CREBBP):c.1955A>C (p.His652Pro) rs587783468
NM_004380.2(CREBBP):c.2026del (p.Gln676Lysfs) rs587783469
NM_004380.2(CREBBP):c.2031delC (p.Ile678Serfs) rs1555483716
NM_004380.2(CREBBP):c.2122_2123del (p.Leu708Valfs) rs587783470
NM_004380.2(CREBBP):c.2141G>T (p.Arg714Leu) rs141098117
NM_004380.2(CREBBP):c.2178_2179insC (p.Met727Hisfs) rs797045483
NM_004380.2(CREBBP):c.2193C>T (p.Asn731=) rs746813014
NM_004380.2(CREBBP):c.2312A>G (p.Gln771Arg) rs147805823
NM_004380.2(CREBBP):c.2314C>A (p.Pro772Thr) rs1555482779
NM_004380.2(CREBBP):c.2535C>A (p.Cys845Ter) rs587783471
NM_004380.2(CREBBP):c.2606T>C (p.Leu869Pro) rs587783472
NM_004380.2(CREBBP):c.2606_2607del (p.Leu869Profs) rs587783473
NM_004380.2(CREBBP):c.2678C>T (p.Ser893Leu) rs142047649
NM_004380.2(CREBBP):c.2679G>A (p.Ser893=) rs587783474
NM_004380.2(CREBBP):c.2679_2690delGTCTTCCGGGCAinsCC (p.Ser894Argfs) rs797045484
NM_004380.2(CREBBP):c.2728A>G (p.Thr910Ala) rs143247685
NM_004380.2(CREBBP):c.2784G>A (p.Pro928=) rs3025694
NM_004380.2(CREBBP):c.2791C>T (p.Gln931Ter) rs587783475
NM_004380.2(CREBBP):c.2810_2811insC (p.Ser938Valfs) rs797045485
NM_004380.2(CREBBP):c.2811G>A (p.Pro937=) rs146168040
NM_004380.2(CREBBP):c.282dup (p.Val95Argfs) rs797045486
NM_004380.2(CREBBP):c.286C>T (p.Gln96Ter) rs587783476
NM_004380.2(CREBBP):c.2941G>A (p.Ala981Thr) rs61753380
NM_004380.2(CREBBP):c.299del (p.Gly100Valfs) rs587783477
NM_004380.2(CREBBP):c.2T>A (p.Met1Lys) rs797045487
NM_004380.2(CREBBP):c.3077_3085delTGCAAGGAGinsAA (p.Leu1026Terfs) rs797045488
NM_004380.2(CREBBP):c.316C>T (p.Gln106Ter) rs587783478
NM_004380.2(CREBBP):c.3190G>A (p.Glu1064Lys) rs886041006
NM_004380.2(CREBBP):c.3310C>T (p.Gln1104Ter) rs587783479
NM_004380.2(CREBBP):c.3369+1G>T rs587783480
NM_004380.2(CREBBP):c.3436C>T (p.Gln1146Ter) rs797045489
NM_004380.2(CREBBP):c.3461dup (p.Asp1155Glyfs) rs797045490
NM_004380.2(CREBBP):c.348_349dup (p.Ala117Valfs) rs797045491
NM_004380.2(CREBBP):c.3490G>C (p.Ala1164Pro) rs797045492
NM_004380.2(CREBBP):c.3500A>G (p.Tyr1167Cys) rs587783481
NM_004380.2(CREBBP):c.3512C>G (p.Thr1171Arg)
NM_004380.2(CREBBP):c.3524A>G (p.Tyr1175Cys) rs28937315
NM_004380.2(CREBBP):c.3613G>T (p.Glu1205Ter) rs587783482
NM_004380.2(CREBBP):c.3698+7G>A rs374345970
NM_004380.2(CREBBP):c.3779+1G>A rs587783483
NM_004380.2(CREBBP):c.37A>G (p.Lys13Glu) rs587783484
NM_004380.2(CREBBP):c.3832G>A (p.Glu1278Lys) rs267606752
NM_004380.2(CREBBP):c.3836+1G>A rs200782888
NM_004380.2(CREBBP):c.3836+1G>C
NM_004380.2(CREBBP):c.3837-2A>T
NM_004380.2(CREBBP):c.3900C>A (p.Ile1300=) rs129974
NM_004380.2(CREBBP):c.3914+1G>T rs1555475352
NM_004380.2(CREBBP):c.3914+3G>T rs587783485
NM_004380.2(CREBBP):c.3977delC (p.Ala1326Valfs)
NM_004380.2(CREBBP):c.3982+1G>A rs398124145
NM_004380.2(CREBBP):c.3983-2A>G rs587783486
NM_004380.2(CREBBP):c.3985C>T (p.Leu1329=) rs149055008
NM_004380.2(CREBBP):c.3989A>G (p.Gln1330Arg) rs587783487
NM_004380.2(CREBBP):c.4022G>C (p.Arg1341Pro) rs587783488
NM_004380.2(CREBBP):c.4045C>T (p.Gln1349Ter) rs587783489
NM_004380.2(CREBBP):c.406C>T (p.Gln136Ter) rs121434624
NM_004380.2(CREBBP):c.4078C>T (p.Arg1360Ter) rs587783490
NM_004380.2(CREBBP):c.4133+1G>A rs587783491
NM_004380.2(CREBBP):c.4133G>C (p.Arg1378Pro) rs121434626
NM_004380.2(CREBBP):c.4134-1G>T rs886041048
NM_004380.2(CREBBP):c.4226T>C (p.Phe1409Ser) rs587783492
NM_004380.2(CREBBP):c.4230dup (p.Gly1411Trpfs) rs1555473668
NM_004380.2(CREBBP):c.4281-11C>G rs587783493
NM_004380.2(CREBBP):c.4281G>T (p.Arg1427Ser) rs797045494
NM_004380.2(CREBBP):c.4336C>T (p.Arg1446Cys) rs398124146
NM_004380.2(CREBBP):c.4376A>G (p.Glu1459Gly) rs587783494
NM_004380.2(CREBBP):c.4394G>A (p.Gly1465Glu) rs1555473491
NM_004380.2(CREBBP):c.4398T>A (p.Tyr1466Ter) rs147688139
NM_004380.2(CREBBP):c.4421_4422delGTinsTC (p.Cys1474Phe) rs1555473126
NM_004380.2(CREBBP):c.4436_4438delGAG (p.Gly1479del) rs1555473122
NM_004380.2(CREBBP):c.4444T>G (p.Tyr1482Asp) rs587783495
NM_004380.2(CREBBP):c.4445A>G (p.Tyr1482Cys) rs587783496
NM_004380.2(CREBBP):c.4508A>G (p.Tyr1503Cys) rs587783497
NM_004380.2(CREBBP):c.459G>A (p.Pro153=) rs56388626
NM_004380.2(CREBBP):c.4644_4645delGT (p.Leu1549Argfs) rs1555472938
NM_004380.2(CREBBP):c.4660A>T (p.Lys1554Ter)
NM_004380.2(CREBBP):c.4663G>T (p.Glu1555Ter) rs1555472931
NM_004380.2(CREBBP):c.4689del (p.Lys1565Argfs) rs587783499
NM_004380.2(CREBBP):c.472delC (p.Gln158Lysfs) rs1555496581
NM_004380.2(CREBBP):c.4792del (p.Ser1598Alafs) rs587783500
NM_004380.2(CREBBP):c.4890+6C>T
NM_004380.2(CREBBP):c.4894T>C (p.Phe1632Leu) rs587783501
NM_004380.2(CREBBP):c.5014A>T (p.Arg1672Ter) rs1555471874
NM_004380.2(CREBBP):c.5027G>A (p.Trp1676Ter) rs797045495
NM_004380.2(CREBBP):c.5039_5041del (p.Ser1680del) rs587783502
NM_004380.2(CREBBP):c.5050T>C (p.Ser1684Pro) rs587783503
NM_004380.2(CREBBP):c.5051C>A (p.Ser1684Tyr) rs1555471841
NM_004380.2(CREBBP):c.508C>T (p.Gln170Ter) rs1555496560
NM_004380.2(CREBBP):c.5237G>T (p.Gly1746Val) rs869312714
NM_004380.2(CREBBP):c.5412C>A (p.His1804Gln) rs797045496
NM_004380.2(CREBBP):c.5614A>G (p.Met1872Val) rs797045037
NM_004380.2(CREBBP):c.5623C>T (p.Arg1875Cys)
NM_004380.2(CREBBP):c.5641_5642delAG (p.Leu1882Alafs)
NM_004380.2(CREBBP):c.5694_5703delCACACCCCAG (p.Ser1898Argfs) rs1555471323
NM_004380.2(CREBBP):c.5719G>A (p.Ala1907Thr) rs199990883
NM_004380.2(CREBBP):c.5740G>A (p.Val1914Met)
NM_004380.2(CREBBP):c.5800T>C (p.Ser1934Pro) rs587783504
NM_004380.2(CREBBP):c.5821C>T (p.Gln1941Ter) rs587783505
NM_004380.2(CREBBP):c.5834_5844del (p.Pro1945Argfs) rs587783506
NM_004380.2(CREBBP):c.5837C>A (p.Pro1946Gln)
NM_004380.2(CREBBP):c.5837delC (p.Pro1946Hisfs) rs587783507
NM_004380.2(CREBBP):c.5837dup (p.Pro1947Thrfs) rs587783507
NM_004380.2(CREBBP):c.5869del (p.Glu1957Lysfs) rs587783508
NM_004380.2(CREBBP):c.5905C>T (p.Gln1969Ter)
NM_004380.2(CREBBP):c.5936_5937insT (p.Ser1980Glnfs) rs797045498
NM_004380.2(CREBBP):c.5988C>T (p.Ala1996=) rs181646656
NM_004380.2(CREBBP):c.598C>T (p.Gln200Ter) rs587783509
NM_004380.2(CREBBP):c.6071C>T (p.Ala2024Val) rs745551441
NM_004380.2(CREBBP):c.6088C>T (p.Gln2030Ter) rs587783510
NM_004380.2(CREBBP):c.6107_6116del (p.Pro2036Argfs) rs797045499
NM_004380.2(CREBBP):c.6130_6171del (p.Ala2044_Gln2057del) rs587783511
NM_004380.2(CREBBP):c.6275C>G (p.Ser2092Ter) rs1555471077
NM_004380.2(CREBBP):c.6324C>A (p.Tyr2108Ter) rs199821421
NM_004380.2(CREBBP):c.6395_6417dup (p.Gln2140Alafs) rs797045500
NM_004380.2(CREBBP):c.6444C>T (p.Gly2148=) rs148539895
NM_004380.2(CREBBP):c.6449C>T (p.Pro2150Leu) rs587783512
NM_004380.2(CREBBP):c.6621A>G (p.Gln2207=) rs55960450
NM_004380.2(CREBBP):c.6711C>T (p.Pro2237=) rs3751845
NM_004380.2(CREBBP):c.7058_7078delGGCCCCAGTCCCAGCCTCCAC (p.Arg2353_Pro2359del)
NM_004380.2(CREBBP):c.7162G>A (p.Ala2388Thr)
NM_004380.2(CREBBP):c.7212A>G (p.Glu2404=) rs55916120
NM_004380.2(CREBBP):c.7245C>T (p.Pro2415=) rs1555470758
NM_004380.2(CREBBP):c.7261_*247del316insC rs1555470631
NM_004380.2(CREBBP):c.7311G>T (p.Lys2437Asn)
NM_004380.2(CREBBP):c.827_828dup (p.Gly277Leufs) rs797045502
NM_004380.2(CREBBP):c.86-1G>T rs11644721
NM_004380.2(CREBBP):c.86-2A>C rs587783515
NM_004380.2(CREBBP):c.879G>A (p.Val293=) rs144344016
NM_004380.2(CREBBP):c.939T>C (p.Asp313=) rs3025702
NM_004380.2(CREBBP):c.953C>A (p.Ser318Ter) rs587783516
NM_004380.2(CREBBP):c.[4112T>A;4118C>A]

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.