ClinVar Miner

List of variants in gene CRPPA reported by CeGaT Center for Human Genetics Tuebingen

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 14
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_001101426.4(CRPPA):c.1054C>A (p.Gln352Lys) rs185594460 0.00151
NM_001101426.4(CRPPA):c.1059G>A (p.Lys353=) rs181099904 0.00151
NM_001101426.4(CRPPA):c.876A>G (p.Glu292=) rs371300262 0.00019
NM_001101426.4(CRPPA):c.1251+4G>A rs753402341 0.00002
NM_001101426.4(CRPPA):c.645A>G (p.Gln215=) rs532057629 0.00001
NM_001101426.4(CRPPA):c.840A>G (p.Arg280=) rs148054819 0.00001
GRCh37/hg19 7p21.2(chr7:16161141-16222888)x1
NM_001101426.4(CRPPA):c.*2369_*2379TA[3]CGTACACATACACACATATATGTATATACGTAC[1]
NM_001101426.4(CRPPA):c.1105GTT[3] (p.Val372del) rs587777798
NM_001101426.4(CRPPA):c.1354T>C (p.Ter452Arg) rs186882839
NM_001101426.4(CRPPA):c.347G>C (p.Arg116Pro) rs748777770
NM_001101426.4(CRPPA):c.360C>G (p.Val120=) rs183141256
NM_001101426.4(CRPPA):c.387A>C (p.Ser129=)
NM_001101426.4(CRPPA):c.895G>C (p.Gly299Arg) rs373890080

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.