ClinVar Miner

List of variants in gene DICER1 reported as pathogenic

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 200
Download table as spreadsheet
HGVS dbSNP
DICER1, 1-BP INS, 2574A
DICER1, 2457C-G
DICER1, 4-BP DEL, 871AAAG
DICER1, ASP1709TYR
DICER1, ASP1713VAL
DICER1, IVS17AS, G-T, -1
DICER1, SER1826TER
NC_000014.8:g.(?_95556825)_(95599805_?)del
NM_177438.2(DICER1):c.100C>T (p.Gln34Ter) rs1555376548
NM_177438.2(DICER1):c.1024del (p.Arg342fs) rs1131691218
NM_177438.2(DICER1):c.1029dup (p.Phe344fs) rs1555374772
NM_177438.2(DICER1):c.1137del (p.Lys379fs) rs1555374734
NM_177438.2(DICER1):c.1144G>T (p.Glu382Ter) rs886037667
NM_177438.2(DICER1):c.1174C>T (p.Arg392Ter) rs1131691211
NM_177438.2(DICER1):c.1185_1187delTGAinsC (p.E396Kfs*3) rs886037668
NM_177438.2(DICER1):c.1202dupA (p.Y401*) rs886037669
NM_177438.2(DICER1):c.1234del (p.Trp412fs) rs1555374679
NM_177438.2(DICER1):c.1246G>T (p.Glu416Ter) rs1131691220
NM_177438.2(DICER1):c.1280_1283del (p.Lys427fs)
NM_177438.2(DICER1):c.1325dup (p.Leu442fs) rs1131691190
NM_177438.2(DICER1):c.1356C>G (p.Tyr452Ter) rs1131691219
NM_177438.2(DICER1):c.1376+1G>A
NM_177438.2(DICER1):c.1376+1G>T rs886037670
NM_177438.2(DICER1):c.1400_1401del (p.Gln467fs) rs1131691203
NM_177438.2(DICER1):c.1408G>T (p.Glu470Ter) rs886037671
NM_177438.2(DICER1):c.1417del (p.Tyr473fs) rs1555373228
NM_177438.2(DICER1):c.1462dup (p.Gln488fs) rs1131691209
NM_177438.2(DICER1):c.1498A>T (p.Lys500Ter) rs875989782
NM_177438.2(DICER1):c.1501C>T (p.Gln501Ter)
NM_177438.2(DICER1):c.1507G>T (p.Glu503Ter) rs137852977
NM_177438.2(DICER1):c.1525C>T (p.Arg509Ter) rs886037672
NM_177438.2(DICER1):c.1630C>T (p.Arg544Ter) rs137852979
NM_177438.2(DICER1):c.1651G>T (p.Gly551Ter) rs886037673
NM_177438.2(DICER1):c.1684_1685delAT (p.M562Vfs*11) rs886037674
NM_177438.2(DICER1):c.1694_1695delAT (p.T566Rfs*7) rs886037675
NM_177438.2(DICER1):c.1694del (p.Asp565fs) rs1555372851
NM_177438.2(DICER1):c.1706_1710del (p.Ile569fs) rs1060503665
NM_177438.2(DICER1):c.1716delT (p.F572Lfs*15) rs886037676
NM_177438.2(DICER1):c.1726del (p.Thr578fs) rs1555372838
NM_177438.2(DICER1):c.1732dup (p.Thr578fs) rs1131691193
NM_177438.2(DICER1):c.1747del (p.Glu583fs) rs1060503633
NM_177438.2(DICER1):c.1748_1752delAAAAG rs1131691232
NM_177438.2(DICER1):c.1752+1delG rs886037677
NM_177438.2(DICER1):c.1767del (p.Lys589fs) rs1060503662
NM_177438.2(DICER1):c.1787delC (p.T596Mfs*21) rs886037678
NM_177438.2(DICER1):c.1827_1828insAG (p.Val610fs) rs886037679
NM_177438.2(DICER1):c.1839del (p.Tyr614fs) rs1131691207
NM_177438.2(DICER1):c.1847T>A (p.Leu616Ter)
NM_177438.2(DICER1):c.1870C>T (p.Arg624Ter) rs754818927
NM_177438.2(DICER1):c.1880_1883delTCAA (p.I627Tfs*22) rs886037680
NM_177438.2(DICER1):c.1907+1G>A rs1131691217
NM_177438.2(DICER1):c.1907+1delG rs886037681
NM_177438.2(DICER1):c.1910dupA (p.Y637*) rs886037682
NM_177438.2(DICER1):c.1966C>T (p.Arg656Ter) rs754081635
NM_177438.2(DICER1):c.2018C>G (p.Ser673Ter)
NM_177438.2(DICER1):c.2026C>T (p.Arg676Ter) rs878855246
NM_177438.2(DICER1):c.2040+1G>A rs886037683
NM_177438.2(DICER1):c.2040+1G>T rs886037683
NM_177438.2(DICER1):c.2062C>T (p.Arg688Ter) rs886037684
NM_177438.2(DICER1):c.2158_2159delGT (p.V720*) rs886037685
NM_177438.2(DICER1):c.2181_2187dup (p.Asp730delinsPheAlaTer) rs1131691213
NM_177438.2(DICER1):c.2197_2198GA[3] (p.Thr734fs) rs1555371596
NM_177438.2(DICER1):c.2233C>T (p.Arg745Ter) rs1060503584
NM_177438.2(DICER1):c.2236A>G (p.Arg746Gly) rs886037686
NM_177438.2(DICER1):c.2243_2244delinsAA (p.Cys748Ter) rs886037687
NM_177438.2(DICER1):c.2243_2244insACTA (p.Cys748Ter) rs886037688
NM_177438.2(DICER1):c.2245_2248dup (p.Pro750fs) rs1555371565
NM_177438.2(DICER1):c.2247C>A (p.Tyr749Ter) rs886037689
NM_177438.2(DICER1):c.2256+1G>A rs1131691231
NM_177438.2(DICER1):c.2350G>T (p.Glu784Ter) rs1131691210
NM_177438.2(DICER1):c.2370_2373dup (p.Leu792fs) rs1555370915
NM_177438.2(DICER1):c.238G>T (p.Glu80Ter)
NM_177438.2(DICER1):c.2392dupA (p.T798Nfs*33) rs886037690
NM_177438.2(DICER1):c.2399del (p.Arg800fs) rs1131691228
NM_177438.2(DICER1):c.2507_2508del (p.Phe836fs) rs1060503628
NM_177438.2(DICER1):c.2516C>T (p.Ser839Phe) rs387906934
NM_177438.2(DICER1):c.256del (p.Arg86fs) rs1555376375
NM_177438.2(DICER1):c.2650+1G>T rs886037691
NM_177438.2(DICER1):c.2749G>T (p.Glu917Ter) rs886037692
NM_177438.2(DICER1):c.282_283dup (p.Arg95fs) rs1555376368
NM_177438.2(DICER1):c.2830C>T (p.Arg944Ter) rs137852978
NM_177438.2(DICER1):c.2863delA (p.T955Pfs*26) rs886037693
NM_177438.2(DICER1):c.2867_2869delCACinsAA (p.P956Qfs*25) rs886037694
NM_177438.2(DICER1):c.2888_2889delCT (p.P963Rfs*3) rs886037695
NM_177438.2(DICER1):c.2953del (p.Gln985fs) rs1060503627
NM_177438.2(DICER1):c.2955delinsTT (p.Gln985fs) rs1555370268
NM_177438.2(DICER1):c.2988-1G>T rs1131691192
NM_177438.2(DICER1):c.2988-20_2988del
NM_177438.2(DICER1):c.3007C>T (p.Arg1003Ter) rs1060503605
NM_177438.2(DICER1):c.3019C>T (p.Gln1007Ter) rs1131691189
NM_177438.2(DICER1):c.3073G>T (p.Glu1025Ter) rs1131691225
NM_177438.2(DICER1):c.3135_3137delATCins10 (p.?)
NM_177438.2(DICER1):c.3135_3137delATCinsTGAACTCATG (p.S1046Efs*47) rs886037696
NM_177438.2(DICER1):c.3175dupT (p.Y1059Lfs*32) rs886037697
NM_177438.2(DICER1):c.3273C>G (p.Tyr1091Ter) rs886037698
NM_177438.2(DICER1):c.3277_3280delAACT (p.N1093*) rs886037699
NM_177438.2(DICER1):c.3300delA (p.K1100Nfs*44) rs886037700
NM_177438.2(DICER1):c.3345dup (p.Ala1116fs) rs1131691215
NM_177438.2(DICER1):c.3349G>T (p.Glu1117Ter) rs1060503617
NM_177438.2(DICER1):c.3402del (p.Gln1135fs)
NM_177438.2(DICER1):c.3450_3451TG[1] (p.Val1151fs) rs1555369632
NM_177438.2(DICER1):c.3515_3525delTTACAGCAATTinsA (p.L1172Qfs*17) rs886037701
NM_177438.2(DICER1):c.3516_3525delinsA (p.Thr1173_Ile1175del) rs1555369579
NM_177438.2(DICER1):c.3531_3534TCTT[1] (p.Ser1179fs) rs1131691191
NM_177438.2(DICER1):c.3534_3535insAA (p.Ser1179fs) rs886037702
NM_177438.2(DICER1):c.3538_3539delTA (p.Y1180Qfs*10) rs886037703
NM_177438.2(DICER1):c.3540C>A (p.Tyr1180Ter) rs886037704
NM_177438.2(DICER1):c.3579_3580delCA (p.N1193Kfs*41) rs886037705
NM_177438.2(DICER1):c.3589delT (p.C1197Afs*6) rs886037706
NM_177438.2(DICER1):c.3591C>A (p.Cys1197Ter) rs1566768212
NM_177438.2(DICER1):c.3611_3616delinsT (p.Tyr1204fs) rs886037651
NM_177438.2(DICER1):c.3658C>T (p.Gln1220Ter) rs886037707
NM_177438.2(DICER1):c.3675C>G (p.Tyr1225Ter) rs184830847
NM_177438.2(DICER1):c.3676G>T (p.Glu1226Ter) rs748087536
NM_177438.2(DICER1):c.3688C>T (p.Gln1230Ter) rs1566767799
NM_177438.2(DICER1):c.3726C>A (p.Tyr1242Ter) rs886037708
NM_177438.2(DICER1):c.3726C>G (p.Tyr1242Ter) rs886037708
NM_177438.2(DICER1):c.3777dupC (p.V1260Rfs*19) rs886037709
NM_177438.2(DICER1):c.3875_3878delCCAA (p.P1292Lfs*9) rs886037710
NM_177438.2(DICER1):c.3905_3906CT[1] (p.Leu1303fs) rs886037650
NM_177438.2(DICER1):c.3909_3910del (p.Ser1304fs)
NM_177438.2(DICER1):c.3957dup (p.Asp1320fs) rs1566766788
NM_177438.2(DICER1):c.3987_3988AT[1] (p.Tyr1330fs) rs1131691214
NM_177438.2(DICER1):c.4004dup (p.Tyr1335Ter) rs878855262
NM_177438.2(DICER1):c.4031C>G (p.Ser1344Ter) rs1566766572
NM_177438.2(DICER1):c.4044del (p.Ser1348fs) rs1131691224
NM_177438.2(DICER1):c.4050+1G>A rs875989783
NM_177438.2(DICER1):c.4071dup (p.Arg1358fs) rs1131691216
NM_177438.2(DICER1):c.4085dup (p.Lys1363fs) rs1131691195
NM_177438.2(DICER1):c.4130del (p.Pro1377fs) rs34678453
NM_177438.2(DICER1):c.4140G>A (p.Trp1380Ter) rs1131691205
NM_177438.2(DICER1):c.4190G>A (p.Trp1397Ter) rs886037711
NM_177438.2(DICER1):c.4206+1G>T rs765059994
NM_177438.2(DICER1):c.4212del (p.Asp1405fs) rs1555367927
NM_177438.2(DICER1):c.4264dup (p.Glu1422fs) rs1131691202
NM_177438.2(DICER1):c.4285del (p.Trp1429fs) rs1131691222
NM_177438.2(DICER1):c.4309_4312delGACT (p.D1437Mfs*16) rs886037712
NM_177438.2(DICER1):c.4401_4402CT[2] (p.Leu1469fs) rs1064795904
NM_177438.2(DICER1):c.4407_4408delTT (p.P1471Ffs*5) rs886037713
NM_177438.2(DICER1):c.4407_4410delTTCT (p.S1470Lfs*19) rs875989784
NM_177438.2(DICER1):c.4426_4427insT (p.Asp1476fs) rs886037714
NM_177438.2(DICER1):c.4458dup (p.Ser1487fs) rs1131691197
NM_177438.2(DICER1):c.4511delG (p.S1504Tfs*56) rs886037715
NM_177438.2(DICER1):c.4517G>A (p.Trp1506Ter) rs886037716
NM_177438.2(DICER1):c.4533T>A (p.Tyr1511Ter) rs1131691206
NM_177438.2(DICER1):c.4555del (p.Glu1519fs) rs1131691194
NM_177438.2(DICER1):c.459dup (p.Val154fs) rs1555375978
NM_177438.2(DICER1):c.4605_4606delTG (p.C1535Wfs*3) rs886037717
NM_177438.2(DICER1):c.4621A>T (p.Lys1541Ter) rs886037718
NM_177438.2(DICER1):c.4626delG (p.Q1542Hfs*18) rs886037719
NM_177438.2(DICER1):c.4633dup (p.Ser1545fs) rs875989781
NM_177438.2(DICER1):c.4637dup (p.Tyr1546Ter) rs1131691221
NM_177438.2(DICER1):c.4638C>A (p.Tyr1546Ter) rs773822569
NM_177438.2(DICER1):c.4654C>T (p.Gln1552Ter) rs1131691208
NM_177438.2(DICER1):c.4657dup (p.Cys1553fs) rs1131691229
NM_177438.2(DICER1):c.4748T>G (p.Leu1583Arg) rs137852976
NM_177438.2(DICER1):c.4754C>G (p.Ser1585Ter) rs875989779
NM_177438.2(DICER1):c.4762del (p.Gly1587_Leu1588insTer) rs1566754840
NM_177438.2(DICER1):c.4812C>A (p.Cys1604Ter) rs1131691201
NM_177438.2(DICER1):c.4853C>A (p.Ser1618Ter) rs377205344
NM_177438.2(DICER1):c.489C>G (p.Tyr163Ter) rs864622626
NM_177438.2(DICER1):c.4923_4926del (p.Gly1640_Cys1641insTer) rs1131691200
NM_177438.2(DICER1):c.4960_4961dupGA (p.D1654Efs*7) rs886037720
NM_177438.2(DICER1):c.4984del (p.Ile1663fs) rs1131691196
NM_177438.2(DICER1):c.4999G>T (p.Glu1667Ter) rs1555367522
NM_177438.2(DICER1):c.5053C>T (p.Gln1685Ter) rs886037721
NM_177438.2(DICER1):c.5095+1G>C rs886037722
NM_177438.2(DICER1):c.5096-498_5364+356del
NM_177438.2(DICER1):c.5103C>A (p.Tyr1701Ter) rs875989780
NM_177438.2(DICER1):c.5103C>G (p.Tyr1701Ter) rs875989780
NM_177438.2(DICER1):c.5104C>T (p.Gln1702Ter) rs886037723
NM_177438.2(DICER1):c.5123G>A (p.Gly1708Glu) rs886037724
NM_177438.2(DICER1):c.5194dupC (p.L1732Pfs*33) rs886037725
NM_177438.2(DICER1):c.5235del (p.Phe1745fs) rs1131691199
NM_177438.2(DICER1):c.5251_5255delAAGTA (p.K1751Rfs*12) rs886037726
NM_177438.2(DICER1):c.5261_5364+79delACCACAAGTACTTCAAAGCTGTCTCTCCTGAGCTCTTCCATGTCATTGATGACTTTGTGCAGTTTCAGCTTGAGAAGAATGAAATGCAAGGAATGGATTCTGAGGTTAGTGCTGTTCAAAACGATGTTGAAAAAAGTGGTCTAACTAGGAGTCTCTGTAGTTTCAGAGTTCTGACGGCATAGT rs1566749829
NM_177438.2(DICER1):c.5299delC (p.H1767Mfs*71) rs886037727
NM_177438.2(DICER1):c.5315_5316delTT (p.F1772Cfs*6) rs878855274
NM_177438.2(DICER1):c.535del (p.Ala180fs) rs1555375946
NM_177438.2(DICER1):c.5394delA (p.E1799Kfs*39) rs886037728
NM_177438.2(DICER1):c.5424_5432dup (p.Met1808_Asp1810dup) rs1131691223
NM_177438.2(DICER1):c.5441C>T (p.Ser1814Leu) rs1060503625
NM_177438.2(DICER1):c.5465A>T (p.Asp1822Val) rs886037729
NM_177438.2(DICER1):c.5479del (p.Leu1827fs) rs1555366197
NM_177438.2(DICER1):c.5494C>T (p.Gln1832Ter) rs1060503583
NM_177438.2(DICER1):c.5504_5507del (p.Tyr1835fs) rs1566746106
NM_177438.2(DICER1):c.559C>T (p.Arg187Ter) rs763801533
NM_177438.2(DICER1):c.629T>G (p.Leu210Ter) rs886037730
NM_177438.2(DICER1):c.735-1_741delGGTATACTinsA rs886037731
NM_177438.2(DICER1):c.745C>T (p.Gln249Ter) rs886037732
NM_177438.2(DICER1):c.757dup (p.Ile253fs) rs1555375356
NM_177438.2(DICER1):c.823G>T (p.Glu275Ter) rs1555375333
NM_177438.2(DICER1):c.832C>T (p.Leu278Phe) rs768248216
NM_177438.2(DICER1):c.877del (p.Arg293fs) rs1131691198
NM_177438.2(DICER1):c.878_881delGAGA (p.R293Ifs*4) rs886037733
NM_177438.2(DICER1):c.901C>T (p.Gln301Ter) rs781144010
NM_177438.2(DICER1):c.937dup (p.Leu313fs) rs1131691212
NM_177438.2(DICER1):c.947G>A (p.Trp316Ter) rs1555374839
NM_177438.2(DICER1):c.948_961del (p.Trp316fs) rs1555374817
NM_177438.2(DICER1):c.996C>A (p.Tyr332Ter) rs757094384

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.