ClinVar Miner

List of variants in gene DICER1 reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1069
Download table as spreadsheet
HGVS dbSNP
NC_000014.9:g.(?_95086228)_(95133503_?)dup
NC_000014.9:g.(?_95111307)_(95133468_?)dup
NM_030621.4(DICER1):c.2997T>G (p.Leu999=) rs12018992
NM_030621.4(DICER1):c.3033G>A (p.Ala1011=) rs8019857
NM_030621.4(DICER1):c.3465G>T (p.Thr1155=) rs377272036
NM_030621.4(DICER1):c.4407T>C (p.Leu1469=) rs540502223
NM_030621.4(DICER1):c.4680G>A (p.Ala1560=) rs61729797
NM_177438.2(DICER1):c.*88T>A rs13078
NM_177438.2(DICER1):c.1004A>G (p.His335Arg) rs1060503602
NM_177438.2(DICER1):c.1005T>G (p.His335Gln)
NM_177438.2(DICER1):c.100C>T (p.Gln34Ter) rs1555376548
NM_177438.2(DICER1):c.1011A>C (p.Gln337His)
NM_177438.2(DICER1):c.1013A>C (p.Glu338Ala) rs587778232
NM_177438.2(DICER1):c.1015_1016delGAinsTT (p.Glu339Leu) rs1555374783
NM_177438.2(DICER1):c.1017G>A (p.Glu339=) rs755007541
NM_177438.2(DICER1):c.1017G>C (p.Glu339Asp) rs755007541
NM_177438.2(DICER1):c.1023C>T (p.His341=) rs766461716
NM_177438.2(DICER1):c.1029dup (p.Phe344Ilefs) rs1555374772
NM_177438.2(DICER1):c.102A>G (p.Gln34=)
NM_177438.2(DICER1):c.1032T>G (p.Phe344Leu) rs1161765608
NM_177438.2(DICER1):c.1038G>T (p.Leu346Phe)
NM_177438.2(DICER1):c.1042A>G (p.Thr348Ala) rs1555374767
NM_177438.2(DICER1):c.1068T>C (p.His356=) rs1555374759
NM_177438.2(DICER1):c.1069G>A (p.Ala357Thr)
NM_177438.2(DICER1):c.1070C>T (p.Ala357Val) rs1555374756
NM_177438.2(DICER1):c.1071A>C (p.Ala357=) rs1044861195
NM_177438.2(DICER1):c.1071A>G (p.Ala357=) rs1044861195
NM_177438.2(DICER1):c.1081G>A (p.Glu361Lys) rs878855238
NM_177438.2(DICER1):c.1085A>G (p.His362Arg) rs767729028
NM_177438.2(DICER1):c.1089C>T (p.Phe363=) rs878855239
NM_177438.2(DICER1):c.1091C>T (p.Ser364Leu) rs1555374748
NM_177438.2(DICER1):c.1094C>T (p.Pro365Leu) rs1060503598
NM_177438.2(DICER1):c.109A>T (p.Ile37Phe) rs772381832
NM_177438.2(DICER1):c.1102C>G (p.Leu368Val) rs1555374747
NM_177438.2(DICER1):c.1107C>A (p.Asp369Glu) rs1555374745
NM_177438.2(DICER1):c.1109T>C (p.Leu370Pro) rs878855240
NM_177438.2(DICER1):c.1117G>C (p.Val373Leu) rs369145814
NM_177438.2(DICER1):c.1124C>G (p.Pro375Arg) rs148758903
NM_177438.2(DICER1):c.1137delA (p.Lys379Asnfs) rs1555374734
NM_177438.2(DICER1):c.1140G>C (p.Leu380=) rs745464699
NM_177438.2(DICER1):c.1143C>T (p.Leu381=) rs372592852
NM_177438.2(DICER1):c.1153C>T (p.Arg385Cys)
NM_177438.2(DICER1):c.1157A>G (p.Lys386Arg) rs777556655
NM_177438.2(DICER1):c.1158A>G (p.Lys386=) rs1060504964
NM_177438.2(DICER1):c.1162A>G (p.Lys388Glu) rs1555374717
NM_177438.2(DICER1):c.1168T>C (p.Tyr390His) rs878855241
NM_177438.2(DICER1):c.1175G>A (p.Arg392Gln)
NM_177438.2(DICER1):c.1187A>G (p.Glu396Gly) rs1555374707
NM_177438.2(DICER1):c.1191C>T (p.Ser397=) rs780067844
NM_177438.2(DICER1):c.1192G>A (p.Val398Ile)
NM_177438.2(DICER1):c.1196A>C (p.Glu399Ala) rs1555374703
NM_177438.2(DICER1):c.1213A>C (p.Asn405His) rs551460901
NM_177438.2(DICER1):c.1231T>G (p.Ser411Ala)
NM_177438.2(DICER1):c.1233A>G (p.Ser411=) rs111595160
NM_177438.2(DICER1):c.1237A>C (p.Ser413Arg) rs1555374678
NM_177438.2(DICER1):c.1249G>A (p.Asp417Asn)
NM_177438.2(DICER1):c.1251T>G (p.Asp417Glu) rs899404083
NM_177438.2(DICER1):c.1254T>C (p.Asp418=) rs988056610
NM_177438.2(DICER1):c.1256A>G (p.Asp419Gly) rs1060503623
NM_177438.2(DICER1):c.1258G>A (p.Glu420Lys) rs1555374663
NM_177438.2(DICER1):c.1264G>A (p.Glu422Lys)
NM_177438.2(DICER1):c.1278A>G (p.Glu426=) rs878855242
NM_177438.2(DICER1):c.1288C>G (p.Pro430Ala) rs1060503601
NM_177438.2(DICER1):c.128C>T (p.Thr43Met) rs367797765
NM_177438.2(DICER1):c.1296A>G (p.Thr432=) rs1555374639
NM_177438.2(DICER1):c.129G>A (p.Thr43=) rs748819990
NM_177438.2(DICER1):c.129G>T (p.Thr43=) rs748819990
NM_177438.2(DICER1):c.1306T>C (p.Ser436Pro) rs1060503595
NM_177438.2(DICER1):c.1316C>G (p.Thr439Ser)
NM_177438.2(DICER1):c.1317C>G (p.Thr439=) rs528592903
NM_177438.2(DICER1):c.1320C>T (p.Asn440=) rs1555374631
NM_177438.2(DICER1):c.1329C>T (p.Cys443=) rs776143079
NM_177438.2(DICER1):c.1342G>A (p.Val448Met) rs1555374618
NM_177438.2(DICER1):c.1353A>G (p.Arg451=) rs1060503663
NM_177438.2(DICER1):c.136A>C (p.Lys46Gln)
NM_177438.2(DICER1):c.1375A>G (p.Arg459Gly)
NM_177438.2(DICER1):c.1376+1G>A
NM_177438.2(DICER1):c.1377-3T>C rs1555373265
NM_177438.2(DICER1):c.1377-4T>G rs192490028
NM_177438.2(DICER1):c.1377-5C>A rs1555373268
NM_177438.2(DICER1):c.1377-9T>C rs373746475
NM_177438.2(DICER1):c.1381A>G (p.Ile461Val) rs141163928
NM_177438.2(DICER1):c.1385A>G (p.Lys462Arg) rs1555373256
NM_177438.2(DICER1):c.1410G>C (p.Glu470Asp) rs774271782
NM_177438.2(DICER1):c.1413G>A (p.Leu471=) rs921899291
NM_177438.2(DICER1):c.1417delT (p.Tyr473Ilefs) rs1555373228
NM_177438.2(DICER1):c.1418A>C (p.Tyr473Ser) rs1314692347
NM_177438.2(DICER1):c.1419T>C (p.Tyr473=) rs879221429
NM_177438.2(DICER1):c.141T>C (p.Tyr47=) rs1313430297
NM_177438.2(DICER1):c.1420A>G (p.Ile474Val) rs1060503581
NM_177438.2(DICER1):c.1423A>T (p.Ser475Cys) rs1060503594
NM_177438.2(DICER1):c.1425T>C (p.Ser475=) rs1555373218
NM_177438.2(DICER1):c.1430A>G (p.Asn477Ser) rs1060503630
NM_177438.2(DICER1):c.1434C>T (p.Phe478=) rs1555373211
NM_177438.2(DICER1):c.144+10C>T rs200678453
NM_177438.2(DICER1):c.144+9G>A rs779375257
NM_177438.2(DICER1):c.1443A>G (p.Gly481=) rs1463188184
NM_177438.2(DICER1):c.1445A>G (p.His482Arg) rs749240414
NM_177438.2(DICER1):c.1449C>T (p.Gly483=) rs569346627
NM_177438.2(DICER1):c.145-10A>G rs1060504983
NM_177438.2(DICER1):c.145-9T>C rs763327342
NM_177438.2(DICER1):c.1453G>A (p.Gly485Arg) rs762155753
NM_177438.2(DICER1):c.1459A>T (p.Asn487Tyr) rs1060503590
NM_177438.2(DICER1):c.1466C>T (p.Pro489Leu) rs200866760
NM_177438.2(DICER1):c.1468C>A (p.Arg490Ser) rs777894117
NM_177438.2(DICER1):c.1468C>T (p.Arg490Cys) rs777894117
NM_177438.2(DICER1):c.1469G>A (p.Arg490His) rs1006363970
NM_177438.2(DICER1):c.146T>C (p.Val49Ala) rs1060503624
NM_177438.2(DICER1):c.1475A>G (p.Lys492Arg) rs758829946
NM_177438.2(DICER1):c.1480A>G (p.Met494Val) rs878855243
NM_177438.2(DICER1):c.1481T>C (p.Met494Thr) rs1269571329
NM_177438.2(DICER1):c.1506A>G (p.Glu502=) rs754334322
NM_177438.2(DICER1):c.1507G>C (p.Glu503Gln) rs137852977
NM_177438.2(DICER1):c.1507G>T (p.Glu503Ter) rs137852977
NM_177438.2(DICER1):c.1509+8A>C rs878855244
NM_177438.2(DICER1):c.1509+8A>T rs878855244
NM_177438.2(DICER1):c.1510-1G>A
NM_177438.2(DICER1):c.1510-4delT rs546524688
NM_177438.2(DICER1):c.1510-4dupT rs546524688
NM_177438.2(DICER1):c.1525C>T (p.R509*) rs886037672
NM_177438.2(DICER1):c.1533T>C (p.His511=) rs1555372906
NM_177438.2(DICER1):c.1535A>G (p.Glu512Gly) rs1555372903
NM_177438.2(DICER1):c.1543C>T (p.Leu515=) rs148218787
NM_177438.2(DICER1):c.1553C>G (p.Ala518Gly)
NM_177438.2(DICER1):c.1555A>G (p.Thr519Ala)
NM_177438.2(DICER1):c.1576G>A (p.Val526Ile) rs1060503660
NM_177438.2(DICER1):c.1583T>C (p.Ile528Thr) rs143099538
NM_177438.2(DICER1):c.1589A>G (p.Lys530Arg)
NM_177438.2(DICER1):c.1602G>T (p.Val534=) rs1555372885
NM_177438.2(DICER1):c.1625A>G (p.Glu542Gly) rs761391603
NM_177438.2(DICER1):c.162A>C (p.Ala54=) rs776085363
NM_177438.2(DICER1):c.1630C>T (p.Arg544Ter) rs137852979
NM_177438.2(DICER1):c.1631G>A (p.Arg544Gln) rs143533680
NM_177438.2(DICER1):c.163G>A (p.Ala55Thr) rs769164427
NM_177438.2(DICER1):c.1664C>T (p.Ala555Val)
NM_177438.2(DICER1):c.1665A>G (p.Ala555=) rs1555372863
NM_177438.2(DICER1):c.1669A>G (p.Ile557Val)
NM_177438.2(DICER1):c.1681A>G (p.Ile561Val) rs147493562
NM_177438.2(DICER1):c.1682T>C (p.Ile561Thr) rs1383145692
NM_177438.2(DICER1):c.1689A>G (p.Leu563=) rs759530753
NM_177438.2(DICER1):c.1691C>G (p.Ala564Gly) rs201298288
NM_177438.2(DICER1):c.1691C>T (p.Ala564Val) rs201298288
NM_177438.2(DICER1):c.1692G>A (p.Ala564=) rs143117334
NM_177438.2(DICER1):c.1694delA (p.Asp565Valfs) rs1555372851
NM_177438.2(DICER1):c.1703A>G (p.Lys568Arg)
NM_177438.2(DICER1):c.1706T>C (p.Ile569Thr) rs1555372847
NM_177438.2(DICER1):c.1706_1710delTAAAA (p.Ile569Lysfs) rs1060503665
NM_177438.2(DICER1):c.1707A>G (p.Ile569Met) rs774765473
NM_177438.2(DICER1):c.1707A>T (p.Ile569=) rs774765473
NM_177438.2(DICER1):c.1722_1724delAGA (p.Glu574del)
NM_177438.2(DICER1):c.1725C>A (p.Asp575Glu) rs1060503652
NM_177438.2(DICER1):c.172C>G (p.His58Asp) rs1555376409
NM_177438.2(DICER1):c.1733C>G (p.Thr578Ser) rs1060503586
NM_177438.2(DICER1):c.1736A>G (p.Tyr579Cys) rs769034924
NM_177438.2(DICER1):c.1738A>G (p.Lys580Glu) rs1555372824
NM_177438.2(DICER1):c.1742C>G (p.Ala581Gly) rs1555372822
NM_177438.2(DICER1):c.1747delG (p.Glu583Lysfs) rs1060503633
NM_177438.2(DICER1):c.1752+10A>G rs1555372809
NM_177438.2(DICER1):c.1752+6A>C rs1207343810
NM_177438.2(DICER1):c.1752+8C>A rs1555372812
NM_177438.2(DICER1):c.1753-5T>A rs373334516
NM_177438.2(DICER1):c.1753-6G>A rs200569366
NM_177438.2(DICER1):c.1758G>A (p.Leu586=) rs368558276
NM_177438.2(DICER1):c.1764C>A (p.Asn588Lys) rs1555372652
NM_177438.2(DICER1):c.1767G>A (p.Lys589=) rs967583633
NM_177438.2(DICER1):c.1767delG (p.Lys589Asnfs) rs1060503662
NM_177438.2(DICER1):c.1769G>T (p.Cys590Phe) rs1555372646
NM_177438.2(DICER1):c.1770T>C (p.Cys590=) rs777355058
NM_177438.2(DICER1):c.1772C>T (p.Ser591Phe) rs1555372631
NM_177438.2(DICER1):c.1779G>A (p.Ser593=) rs531307350
NM_177438.2(DICER1):c.1784A>G (p.Asp595Gly) rs1060503611
NM_177438.2(DICER1):c.1787C>A (p.Thr596Asn) rs754852266
NM_177438.2(DICER1):c.1789G>A (p.Gly597Ser) rs1277436466
NM_177438.2(DICER1):c.1795A>G (p.Thr599Ala) rs766492523
NM_177438.2(DICER1):c.1797T>C (p.Thr599=) rs761971773
NM_177438.2(DICER1):c.179C>T (p.Thr60Ile) rs587778228
NM_177438.2(DICER1):c.1800C>T (p.Asp600=) rs199995391
NM_177438.2(DICER1):c.1801A>G (p.Ile601Val) rs564224919
NM_177438.2(DICER1):c.1802T>C (p.Ile601Thr) rs760966585
NM_177438.2(DICER1):c.1803T>C (p.Ile601=) rs1060504962
NM_177438.2(DICER1):c.1803T>G (p.Ile601Met)
NM_177438.2(DICER1):c.1807C>A (p.Pro603Thr) rs1060503614
NM_177438.2(DICER1):c.180C>T (p.Thr60=) rs569451472
NM_177438.2(DICER1):c.1813A>G (p.Met605Val) rs759958601
NM_177438.2(DICER1):c.1814T>C (p.Met605Thr) rs1249693564
NM_177438.2(DICER1):c.181A>G (p.Ile61Val) rs1060503646
NM_177438.2(DICER1):c.1823A>G (p.Asp608Gly) rs1270338113
NM_177438.2(DICER1):c.1823A>T (p.Asp608Val)
NM_177438.2(DICER1):c.1824_1826delTGA (p.Asp609del) rs1555372586
NM_177438.2(DICER1):c.1825G>T (p.Asp609Tyr) rs114947750
NM_177438.2(DICER1):c.1827C>T (p.Asp609=) rs150087634
NM_177438.2(DICER1):c.1828G>A (p.Val610Ile) rs1336108562
NM_177438.2(DICER1):c.1828G>C (p.Val610Leu) rs1336108562
NM_177438.2(DICER1):c.1837C>T (p.Pro613Ser) rs201553563
NM_177438.2(DICER1):c.1839A>G (p.Pro613=) rs147754242
NM_177438.2(DICER1):c.183C>T (p.Ile61=) rs932113852
NM_177438.2(DICER1):c.1847T>A (p.Leu616Ter)
NM_177438.2(DICER1):c.184G>A (p.Val62Ile) rs746671039
NM_177438.2(DICER1):c.1853C>G (p.Pro618Arg) rs1555372566
NM_177438.2(DICER1):c.1854T>G (p.Pro618=) rs1555372565
NM_177438.2(DICER1):c.1857C>T (p.Asp619=) rs747735065
NM_177438.2(DICER1):c.1862G>A (p.Gly621Asp)
NM_177438.2(DICER1):c.1864G>A (p.Gly622Ser) rs1555372556
NM_177438.2(DICER1):c.1864_1866delGGT (p.Gly622del)
NM_177438.2(DICER1):c.1867C>T (p.Pro623Ser) rs778668024
NM_177438.2(DICER1):c.1870C>T (p.R624*) rs754818927
NM_177438.2(DICER1):c.1871G>A (p.Arg624Gln)
NM_177438.2(DICER1):c.1877C>A (p.Thr626Lys) rs375579739
NM_177438.2(DICER1):c.1883A>G (p.Asn628Ser) rs756051157
NM_177438.2(DICER1):c.1886C>T (p.Thr629Met) rs750410087
NM_177438.2(DICER1):c.1887G>A (p.Thr629=) rs141651702
NM_177438.2(DICER1):c.1890C>T (p.Ala630=) rs1170276996
NM_177438.2(DICER1):c.1891A>G (p.Ile631Val) rs878855245
NM_177438.2(DICER1):c.189T>C (p.Cys63=) rs1555376403
NM_177438.2(DICER1):c.1904A>G (p.Asn635Ser) rs765551529
NM_177438.2(DICER1):c.1907+3A>G
NM_177438.2(DICER1):c.1908-4A>G rs112284114
NM_177438.2(DICER1):c.1908-7T>C rs981303167
NM_177438.2(DICER1):c.1908A>G (p.Arg636=) rs1060503647
NM_177438.2(DICER1):c.1918A>G (p.Arg640Gly) rs1555372107
NM_177438.2(DICER1):c.192A>T (p.Leu64Phe) rs1231822339
NM_177438.2(DICER1):c.1934C>T (p.Pro645Leu) rs781253567
NM_177438.2(DICER1):c.1935G>A (p.Pro645=) rs61751177
NM_177438.2(DICER1):c.1953T>C (p.Pro651=) rs199678028
NM_177438.2(DICER1):c.1955A>C (p.Lys652Thr) rs755150419
NM_177438.2(DICER1):c.1960A>G (p.Arg654Gly) rs1555372083
NM_177438.2(DICER1):c.1967G>A (p.Arg656Gln) rs766707302
NM_177438.2(DICER1):c.196A>G (p.Thr66Ala) rs1555376402
NM_177438.2(DICER1):c.1972T>C (p.Leu658=) rs761068637
NM_177438.2(DICER1):c.1977T>C (p.Pro659=) rs1060504974
NM_177438.2(DICER1):c.1979A>G (p.Asp660Gly) rs151272381
NM_177438.2(DICER1):c.1983T>G (p.Gly661=) rs1359370774
NM_177438.2(DICER1):c.1986A>T (p.Thr662=) rs762241036
NM_177438.2(DICER1):c.1991A>G (p.Tyr664Cys) rs1555372066
NM_177438.2(DICER1):c.1998T>C (p.Thr666=) rs1555372061
NM_177438.2(DICER1):c.2002T>G (p.Tyr668Asp) rs1555372059
NM_177438.2(DICER1):c.2011A>G (p.Ile671Val) rs768315203
NM_177438.2(DICER1):c.2023C>G (p.Leu675Val)
NM_177438.2(DICER1):c.2026C>T (p.Arg676Ter) rs878855246
NM_177438.2(DICER1):c.2027G>C (p.Arg676Pro) rs892971080
NM_177438.2(DICER1):c.2029G>A (p.Ala677Thr) rs1555372041
NM_177438.2(DICER1):c.2032T>G (p.Ser678Ala) rs377269341
NM_177438.2(DICER1):c.2033C>T (p.Ser678Phe) rs544623004
NM_177438.2(DICER1):c.2034C>A (p.Ser678=) rs1292602527
NM_177438.2(DICER1):c.2038G>A (p.Val680Ile) rs201883449
NM_177438.2(DICER1):c.2041-8A>G rs1555371866
NM_177438.2(DICER1):c.2043T>C (p.Gly681=) rs1555371860
NM_177438.2(DICER1):c.2045C>A (p.Pro682Gln) rs752621393
NM_177438.2(DICER1):c.2048C>G (p.Pro683Arg) rs373914672
NM_177438.2(DICER1):c.2050A>G (p.Met684Val)
NM_177438.2(DICER1):c.2062C>T (p.R688*) rs886037684
NM_177438.2(DICER1):c.2063G>A (p.Arg688Gln) rs542398644
NM_177438.2(DICER1):c.2064A>G (p.Arg688=)
NM_177438.2(DICER1):c.2075G>A (p.Arg692Lys) rs1555371838
NM_177438.2(DICER1):c.2099A>G (p.Glu700Gly) rs376691754
NM_177438.2(DICER1):c.20A>G (p.Gln7Arg) rs117358479
NM_177438.2(DICER1):c.2104C>G (p.Leu702Val) rs1555371818
NM_177438.2(DICER1):c.2111A>G (p.Lys704Arg) rs749428279
NM_177438.2(DICER1):c.2115T>C (p.Ile705=) rs140087741
NM_177438.2(DICER1):c.2116+6G>A rs1053776810
NM_177438.2(DICER1):c.2116+7A>G rs563163879
NM_177438.2(DICER1):c.2117-9A>G rs878855247
NM_177438.2(DICER1):c.2118C>T (p.Gly706=) rs191755360
NM_177438.2(DICER1):c.2133T>C (p.His711=) rs878855248
NM_177438.2(DICER1):c.2148G>A (p.Gly716=) rs771939746
NM_177438.2(DICER1):c.2154G>C (p.Glu718Asp) rs1555371628
NM_177438.2(DICER1):c.2186A>G (p.His729Arg) rs748084431
NM_177438.2(DICER1):c.2191G>A (p.Glu731Lys) rs869025262
NM_177438.2(DICER1):c.2195A>G (p.Glu732Gly) rs1555371605
NM_177438.2(DICER1):c.2199G>A (p.Glu733=) rs201668559
NM_177438.2(DICER1):c.2199_2200dup (p.Thr734Argfs) rs1555371596
NM_177438.2(DICER1):c.21A>G (p.Gln7=) rs754489130
NM_177438.2(DICER1):c.2201C>G (p.Thr734Ser) rs781312991
NM_177438.2(DICER1):c.2209C>T (p.Pro737Ser)
NM_177438.2(DICER1):c.220_221delGCinsTT (p.Ala74Leu)
NM_177438.2(DICER1):c.2228C>T (p.Thr743Met) rs758932000
NM_177438.2(DICER1):c.2229G>A (p.Thr743=) rs753276132
NM_177438.2(DICER1):c.2233C>T (p.Arg745Ter) rs1060503584
NM_177438.2(DICER1):c.2245_2248dup (p.Pro750Leufs) rs1555371565
NM_177438.2(DICER1):c.2246A>T (p.Tyr749Phe) rs1309961626
NM_177438.2(DICER1):c.2249C>G (p.Pro750Arg) rs878855249
NM_177438.2(DICER1):c.2250A>C (p.Pro750=) rs1555371563
NM_177438.2(DICER1):c.2256+10G>C rs1555371560
NM_177438.2(DICER1):c.2256+6T>A rs1555371562
NM_177438.2(DICER1):c.225A>G (p.Val75=) rs750568225
NM_177438.2(DICER1):c.2262A>G (p.Pro754=) rs751563281
NM_177438.2(DICER1):c.2269T>G (p.Leu757Val) rs1555370956
NM_177438.2(DICER1):c.2279G>A (p.Ser760Asn) rs1060503621
NM_177438.2(DICER1):c.2288G>C (p.Arg763Thr) rs774344152
NM_177438.2(DICER1):c.2316G>A (p.Val772=) rs878855250
NM_177438.2(DICER1):c.2322A>G (p.Gly774=) rs771154371
NM_177438.2(DICER1):c.2327T>G (p.Val776Gly) rs1060503618
NM_177438.2(DICER1):c.232A>G (p.Thr78Ala)
NM_177438.2(DICER1):c.2334T>G (p.Thr778=) rs1555370932
NM_177438.2(DICER1):c.2335A>G (p.Thr779Ala) rs1555370931
NM_177438.2(DICER1):c.2337A>G (p.Thr779=) rs747210633
NM_177438.2(DICER1):c.2349T>C (p.Asp783=) rs764003983
NM_177438.2(DICER1):c.2361T>C (p.Phe787=) rs367950170
NM_177438.2(DICER1):c.2366G>A (p.Arg789Lys)
NM_177438.2(DICER1):c.2370G>A (p.Arg790=) rs112712209
NM_177438.2(DICER1):c.2370_2373dup (p.Leu792Glufs) rs1555370915
NM_177438.2(DICER1):c.2378A>G (p.Tyr793Cys) rs527568726
NM_177438.2(DICER1):c.2380C>T (p.Pro794Ser) rs1060503620
NM_177438.2(DICER1):c.2390A>G (p.Asp797Gly) rs755375348
NM_177438.2(DICER1):c.2400A>G (p.Arg800=) rs1555370902
NM_177438.2(DICER1):c.2401T>G (p.Cys801Gly) rs1060503599
NM_177438.2(DICER1):c.2417C>T (p.Thr806Met) rs749834289
NM_177438.2(DICER1):c.2433T>G (p.Pro811=) rs1060504958
NM_177438.2(DICER1):c.2435A>G (p.Gln812Arg) rs750049051
NM_177438.2(DICER1):c.2436+3A>G rs1555370879
NM_177438.2(DICER1):c.2436+4_2436+7delGGTA rs777823741
NM_177438.2(DICER1):c.2437-2A>G rs1060503640
NM_177438.2(DICER1):c.2437-4T>C rs1060503632
NM_177438.2(DICER1):c.243G>A (p.Leu81=) rs761966110
NM_177438.2(DICER1):c.2478C>A (p.Thr826=) rs543843695
NM_177438.2(DICER1):c.2485A>G (p.Ile829Val) rs1038939677
NM_177438.2(DICER1):c.2486T>C (p.Ile829Thr) rs1555370828
NM_177438.2(DICER1):c.248A>G (p.Tyr83Cys) rs373646414
NM_177438.2(DICER1):c.2491T>C (p.Leu831=) rs1357970974
NM_177438.2(DICER1):c.2494A>G (p.Lys832Glu) rs1060503613
NM_177438.2(DICER1):c.2497_2499delAAG (p.Lys833del)
NM_177438.2(DICER1):c.2506T>G (p.Phe836Val)
NM_177438.2(DICER1):c.2507_2508delTC (p.Phe836Tyrfs) rs1060503628
NM_177438.2(DICER1):c.2522A>G (p.Gln841Arg)
NM_177438.2(DICER1):c.2533T>C (p.Leu845=) rs1182299033
NM_177438.2(DICER1):c.2533T>G (p.Leu845Val) rs1182299033
NM_177438.2(DICER1):c.2536A>G (p.Ile846Val) rs201212908
NM_177438.2(DICER1):c.2539A>G (p.Thr847Ala) rs1060503641
NM_177438.2(DICER1):c.2553G>A (p.Gln851=) rs373715574
NM_177438.2(DICER1):c.2557A>G (p.Ile853Val) rs61729795
NM_177438.2(DICER1):c.2559A>T (p.Ile853=) rs1555370795
NM_177438.2(DICER1):c.255C>G (p.Ile85Met) rs763422772
NM_177438.2(DICER1):c.2562C>A (p.Phe854Leu) rs1555370794
NM_177438.2(DICER1):c.2565A>G (p.Ser855=) rs752565186
NM_177438.2(DICER1):c.256delA (p.Arg86Glyfs) rs1555376375
NM_177438.2(DICER1):c.2575C>T (p.Arg859Trp) rs144649926
NM_177438.2(DICER1):c.2576G>A (p.Arg859Gln)
NM_177438.2(DICER1):c.2577G>C (p.Arg859=) rs1010614154
NM_177438.2(DICER1):c.2577G>T (p.Arg859=) rs1010614154
NM_177438.2(DICER1):c.25C>T (p.Leu9Phe) rs1482976224
NM_177438.2(DICER1):c.2608A>G (p.Thr870Ala)
NM_177438.2(DICER1):c.2612A>T (p.Asp871Val) rs1555370776
NM_177438.2(DICER1):c.2613C>T (p.Asp871=) rs759827733
NM_177438.2(DICER1):c.2614G>A (p.Ala872Thr) rs149242330
NM_177438.2(DICER1):c.2617G>C (p.Asp873His) rs774672421
NM_177438.2(DICER1):c.2618A>G (p.Asp873Gly) rs1555370765
NM_177438.2(DICER1):c.2619T>G (p.Asp873Glu)
NM_177438.2(DICER1):c.2623G>T (p.Ala875Ser) rs1555370761
NM_177438.2(DICER1):c.2625A>G (p.Ala875=) rs1555370754
NM_177438.2(DICER1):c.263A>T (p.Asp88Val) rs775828379
NM_177438.2(DICER1):c.2644A>G (p.Asn882Asp)
NM_177438.2(DICER1):c.2646T>C (p.Asn882=) rs1060504965
NM_177438.2(DICER1):c.2647G>A (p.Val883Ile) rs1407338094
NM_177438.2(DICER1):c.2649T>C (p.Val883=)
NM_177438.2(DICER1):c.2650+5G>A rs1168700780
NM_177438.2(DICER1):c.2651-2A>G rs1060503596
NM_177438.2(DICER1):c.2651-4T>G rs377667473
NM_177438.2(DICER1):c.2658C>T (p.Asp886=) rs771049445
NM_177438.2(DICER1):c.2659T>C (p.Ser887Pro) rs878855251
NM_177438.2(DICER1):c.2660C>A (p.Ser887Tyr) rs139441077
NM_177438.2(DICER1):c.2660C>T (p.Ser887Phe) rs139441077
NM_177438.2(DICER1):c.2682T>G (p.Phe894Leu) rs760009604
NM_177438.2(DICER1):c.2689A>G (p.Met897Val) rs373729361
NM_177438.2(DICER1):c.2716C>T (p.Arg906Cys) rs770335698
NM_177438.2(DICER1):c.2717G>A (p.Arg906His) rs150510758
NM_177438.2(DICER1):c.2717G>T (p.Arg906Leu) rs150510758
NM_177438.2(DICER1):c.2718C>T (p.Arg906=) rs370692165
NM_177438.2(DICER1):c.2720T>C (p.Ile907Thr) rs200408568
NM_177438.2(DICER1):c.2725A>G (p.Ile909Val)
NM_177438.2(DICER1):c.272G>A (p.Arg91Lys) rs878855252
NM_177438.2(DICER1):c.2732G>A (p.Ser911Asn) rs771697618
NM_177438.2(DICER1):c.2738A>C (p.Lys913Thr) rs1060503649
NM_177438.2(DICER1):c.2741A>G (p.Tyr914Cys)
NM_177438.2(DICER1):c.2743A>G (p.Thr915Ala) rs1179517249
NM_177438.2(DICER1):c.2752A>T (p.Thr918Ser) rs377326167
NM_177438.2(DICER1):c.276T>C (p.Asn92=) rs370551656
NM_177438.2(DICER1):c.2776G>A (p.Asp926Asn)
NM_177438.2(DICER1):c.2776G>C (p.Asp926His) rs1060503645
NM_177438.2(DICER1):c.2781C>T (p.Tyr927=) rs1060504985
NM_177438.2(DICER1):c.278G>A (p.Gly93Glu) rs776219930
NM_177438.2(DICER1):c.2790C>T (p.Ala930=) rs780094393
NM_177438.2(DICER1):c.2796C>A (p.Ile932=) rs1060504967
NM_177438.2(DICER1):c.2796C>T (p.Ile932=) rs1060504967
NM_177438.2(DICER1):c.2804+3_2804+4insACC rs1240430173
NM_177438.2(DICER1):c.2805-5T>A
NM_177438.2(DICER1):c.2805-9C>T rs774194760
NM_177438.2(DICER1):c.2821C>G (p.Gln941Glu) rs1060503588
NM_177438.2(DICER1):c.282_283dup (p.Arg95Lysfs) rs1555376368
NM_177438.2(DICER1):c.2831G>A (p.Arg944Gln) rs1555370340
NM_177438.2(DICER1):c.2854A>G (p.Thr952Ala) rs1060503636
NM_177438.2(DICER1):c.2867_2869delCACinsAA (p.P956Qfs*25) rs886037694
NM_177438.2(DICER1):c.2869C>T (p.Leu957Phe) rs1060503634
NM_177438.2(DICER1):c.2871C>A (p.Leu957=) rs758526739
NM_177438.2(DICER1):c.2872A>G (p.Ser958Gly) rs752905540
NM_177438.2(DICER1):c.2888C>T (p.Pro963Leu)
NM_177438.2(DICER1):c.2898A>G (p.Glu966=) rs375772460
NM_177438.2(DICER1):c.2904T>C (p.Phe968=) rs755199154
NM_177438.2(DICER1):c.2906C>T (p.Ala969Val) rs878855253
NM_177438.2(DICER1):c.290T>C (p.Val97Ala) rs1060503582
NM_177438.2(DICER1):c.2919A>C (p.Lys973Asn) rs1555370297
NM_177438.2(DICER1):c.291G>A (p.Val97=) rs1555376366
NM_177438.2(DICER1):c.2937C>T (p.Asp979=) rs1555370289
NM_177438.2(DICER1):c.2945A>G (p.Asn982Ser)
NM_177438.2(DICER1):c.2946T>A (p.Asn982Lys) rs1060503631
NM_177438.2(DICER1):c.2951A>G (p.Asn984Ser) rs750932552
NM_177438.2(DICER1):c.2953delC (p.Gln985Serfs) rs1060503627
NM_177438.2(DICER1):c.2955delGinsTT (p.Gln985Hisfs) rs1555370268
NM_177438.2(DICER1):c.2958A>G (p.Pro986=) rs767029582
NM_177438.2(DICER1):c.2987+1G>A rs1555370248
NM_177438.2(DICER1):c.2987+7G>C rs1555370245
NM_177438.2(DICER1):c.2988-1G>T rs1131691192
NM_177438.2(DICER1):c.2T>C (p.Met1Thr) rs878855254
NM_177438.2(DICER1):c.3007C>T (p.Arg1003Ter) rs1060503605
NM_177438.2(DICER1):c.3032C>T (p.Ala1011Val) rs772243498
NM_177438.2(DICER1):c.3042A>G (p.Leu1014=) rs1555370186
NM_177438.2(DICER1):c.3047G>A (p.Ser1016Asn)
NM_177438.2(DICER1):c.3057G>A (p.Lys1019=) rs1166878247
NM_177438.2(DICER1):c.3060G>A (p.Arg1020=) rs1060504973
NM_177438.2(DICER1):c.3074A>G (p.Glu1025Gly) rs1191384264
NM_177438.2(DICER1):c.3076A>G (p.Ser1026Gly)
NM_177438.2(DICER1):c.3087T>C (p.Asn1029=) rs1555370168
NM_177438.2(DICER1):c.3093+3A>G rs775057339
NM_177438.2(DICER1):c.3093+4A>G
NM_177438.2(DICER1):c.3094-5T>G rs1555370056
NM_177438.2(DICER1):c.3094-8_3094-5delACTT rs770904411
NM_177438.2(DICER1):c.3099G>C (p.Leu1033=) rs768709390
NM_177438.2(DICER1):c.3099G>T (p.Leu1033=) rs768709390
NM_177438.2(DICER1):c.3118A>G (p.Ile1040Val) rs1555370052
NM_177438.2(DICER1):c.3127A>G (p.Ile1043Val) rs1060503592
NM_177438.2(DICER1):c.3133G>C (p.Ala1045Pro) rs878855255
NM_177438.2(DICER1):c.3161T>C (p.Leu1054Pro)
NM_177438.2(DICER1):c.3162C>T (p.Leu1054=) rs1060504987
NM_177438.2(DICER1):c.3172C>A (p.Leu1058Ile) rs1555370024
NM_177438.2(DICER1):c.3179G>T (p.Arg1060Leu)
NM_177438.2(DICER1):c.3186C>T (p.His1062=) rs951581708
NM_177438.2(DICER1):c.3198T>C (p.Thr1066=) rs114964211
NM_177438.2(DICER1):c.320C>T (p.Ala107Val) rs1060503655
NM_177438.2(DICER1):c.3210A>G (p.Leu1070=) rs547156371
NM_177438.2(DICER1):c.3213A>G (p.Arg1071=) rs148959399
NM_177438.2(DICER1):c.3221C>T (p.Thr1074Ile) rs1060503653
NM_177438.2(DICER1):c.3227G>A (p.Ser1076Asn) rs778494781
NM_177438.2(DICER1):c.3228C>T (p.Ser1076=) rs867768809
NM_177438.2(DICER1):c.3229G>A (p.Asp1077Asn) rs373412959
NM_177438.2(DICER1):c.3234T>C (p.Ala1078=) rs148166836
NM_177438.2(DICER1):c.3237C>T (p.Gly1079=) rs764827361
NM_177438.2(DICER1):c.323A>G (p.Gln108Arg)
NM_177438.2(DICER1):c.3248G>C (p.Arg1083Thr) rs1060503616
NM_177438.2(DICER1):c.3249A>T (p.Arg1083Ser) rs1291112028
NM_177438.2(DICER1):c.3260C>A (p.Ala1087Glu) rs180918578
NM_177438.2(DICER1):c.3260C>G (p.Ala1087Gly) rs180918578
NM_177438.2(DICER1):c.3260C>T (p.Ala1087Val) rs180918578
NM_177438.2(DICER1):c.3261G>A (p.Ala1087=) rs369869162
NM_177438.2(DICER1):c.3269+7C>T rs1060504984
NM_177438.2(DICER1):c.3270-10G>A rs878855256
NM_177438.2(DICER1):c.3270A>G (p.Arg1090=)
NM_177438.2(DICER1):c.3272A>T (p.Tyr1091Phe) rs1442769827
NM_177438.2(DICER1):c.3273C>T (p.Tyr1091=) rs886037698
NM_177438.2(DICER1):c.3276T>A (p.Pro1092=) rs1422876107
NM_177438.2(DICER1):c.3279C>T (p.Asn1093=) rs1555369761
NM_177438.2(DICER1):c.3285C>T (p.Asp1095=) rs753475946
NM_177438.2(DICER1):c.3288C>T (p.Phe1096=) rs761973752
NM_177438.2(DICER1):c.328G>A (p.Val110Met) rs1555376190
NM_177438.2(DICER1):c.3290G>T (p.Gly1097Val)
NM_177438.2(DICER1):c.3291G>A (p.Gly1097=) rs774991525
NM_177438.2(DICER1):c.3295A>G (p.Lys1099Glu)
NM_177438.2(DICER1):c.3296A>G (p.Lys1099Arg)
NM_177438.2(DICER1):c.3302C>G (p.Ser1101Cys) rs779748717
NM_177438.2(DICER1):c.3303T>C (p.Ser1101=) rs755766860
NM_177438.2(DICER1):c.3308A>T (p.Asp1103Val)
NM_177438.2(DICER1):c.3312C>G (p.Ser1104Arg) rs1555369738
NM_177438.2(DICER1):c.3324C>T (p.Ile1108=) rs765205680
NM_177438.2(DICER1):c.3328A>G (p.Ile1110Val)
NM_177438.2(DICER1):c.3329T>G (p.Ile1110Ser) rs759760077
NM_177438.2(DICER1):c.3334A>G (p.Asn1112Asp) rs587778229
NM_177438.2(DICER1):c.3338C>A (p.Ser1113Tyr) rs143841809
NM_177438.2(DICER1):c.333A>G (p.Ser111=) rs878855257
NM_177438.2(DICER1):c.3341C>G (p.Ser1114Cys)
NM_177438.2(DICER1):c.3349G>T (p.Glu1117Ter) rs1060503617
NM_177438.2(DICER1):c.3353A>G (p.Asn1118Ser) rs773410751
NM_177438.2(DICER1):c.3359A>G (p.Asn1120Ser) rs1555369701
NM_177438.2(DICER1):c.335C>T (p.Ala112Val) rs1555376185
NM_177438.2(DICER1):c.3364T>C (p.Cys1122Arg) rs1555369696
NM_177438.2(DICER1):c.3371A>C (p.His1124Pro)
NM_177438.2(DICER1):c.3374G>A (p.Ser1125Asn) rs748581847
NM_177438.2(DICER1):c.3379A>G (p.Ile1127Val) rs779530679
NM_177438.2(DICER1):c.3380T>G (p.Ile1127Ser) rs567895583
NM_177438.2(DICER1):c.3388G>A (p.Glu1130Lys) rs1555369685
NM_177438.2(DICER1):c.3389A>G (p.Glu1130Gly)
NM_177438.2(DICER1):c.3392A>G (p.Asn1131Ser) rs200651335
NM_177438.2(DICER1):c.3396T>C (p.Ala1132=) rs1060504968
NM_177438.2(DICER1):c.3403C>A (p.Gln1135Lys) rs755711684
NM_177438.2(DICER1):c.3403C>G (p.Gln1135Glu)
NM_177438.2(DICER1):c.3414T>C (p.Asn1138=) rs1248977051
NM_177438.2(DICER1):c.3416_3418delGAA (p.Arg1139del)
NM_177438.2(DICER1):c.3417A>T (p.Arg1139Ser) rs750104632
NM_177438.2(DICER1):c.3422C>T (p.Ser1141Phe) rs780815020
NM_177438.2(DICER1):c.3424T>C (p.Ser1142Pro)
NM_177438.2(DICER1):c.3428T>C (p.Leu1143Pro) rs139786661
NM_177438.2(DICER1):c.3437A>G (p.His1146Arg)
NM_177438.2(DICER1):c.3447G>C (p.Met1149Ile) rs1304695583
NM_177438.2(DICER1):c.3449C>T (p.Ser1150Phe)
NM_177438.2(DICER1):c.3457T>G (p.Cys1153Gly) rs1060503607
NM_177438.2(DICER1):c.3458G>T (p.Cys1153Phe) rs762999390
NM_177438.2(DICER1):c.3459C>T (p.Cys1153=) rs1300692476
NM_177438.2(DICER1):c.3461G>T (p.Arg1154Ile) rs1555369626
NM_177438.2(DICER1):c.3462A>C (p.Arg1154Ser) rs192822778
NM_177438.2(DICER1):c.3465G>A (p.Thr1155=) rs377272036
NM_177438.2(DICER1):c.3466T>G (p.Leu1156Val) rs760950917
NM_177438.2(DICER1):c.3472A>T (p.Ser1158Cys) rs949633145
NM_177438.2(DICER1):c.3474C>T (p.Ser1158=) rs368984998
NM_177438.2(DICER1):c.3475G>A (p.Glu1159Lys) rs145693584
NM_177438.2(DICER1):c.3475G>C (p.Glu1159Gln)
NM_177438.2(DICER1):c.3479C>A (p.Ser1160Tyr) rs774583162
NM_177438.2(DICER1):c.3495C>T (p.His1165=) rs372581591
NM_177438.2(DICER1):c.3496G>A (p.Val1166Ile) rs368588781
NM_177438.2(DICER1):c.3499G>A (p.Glu1167Lys) rs1456267980
NM_177438.2(DICER1):c.3501A>G (p.Glu1167=) rs878855258
NM_177438.2(DICER1):c.3501A>T (p.Glu1167Asp) rs878855258
NM_177438.2(DICER1):c.3508G>A (p.Ala1170Thr)
NM_177438.2(DICER1):c.3518C>T (p.Thr1173Ile) rs769329149
NM_177438.2(DICER1):c.3519A>G (p.Thr1173=) rs745483867
NM_177438.2(DICER1):c.3522A>T (p.Ala1174=) rs1555369587
NM_177438.2(DICER1):c.3527A>G (p.Asn1176Ser) rs1555369577
NM_177438.2(DICER1):c.3532C>T (p.Leu1178Phe) rs780952666
NM_177438.2(DICER1):c.3536C>G (p.Ser1179Cys) rs1060503585
NM_177438.2(DICER1):c.3546A>G (p.Gln1182=)
NM_177438.2(DICER1):c.354T>C (p.Asp118=) rs538838304
NM_177438.2(DICER1):c.3552C>A (p.Leu1184=) rs375535900
NM_177438.2(DICER1):c.3553G>A (p.Ala1185Thr) rs150514959
NM_177438.2(DICER1):c.3553G>C (p.Ala1185Pro)
NM_177438.2(DICER1):c.3557A>G (p.Asn1186Ser) rs201523588
NM_177438.2(DICER1):c.355C>T (p.Leu119Phe) rs1060503661
NM_177438.2(DICER1):c.3561C>T (p.Gly1187=)
NM_177438.2(DICER1):c.3567T>C (p.Tyr1189=) rs141288912
NM_177438.2(DICER1):c.3578A>G (p.Asn1193Ser)
NM_177438.2(DICER1):c.3591C>A (p.Cys1197Ter)
NM_177438.2(DICER1):c.359A>T (p.Lys120Met) rs1060503608
NM_177438.2(DICER1):c.3601C>G (p.Gln1201Glu)
NM_177438.2(DICER1):c.3628C>T (p.Pro1210Ser) rs200925349
NM_177438.2(DICER1):c.3630C>T (p.Pro1210=) rs774727760
NM_177438.2(DICER1):c.3631G>A (p.Val1211Met) rs764470378
NM_177438.2(DICER1):c.3631G>C (p.Val1211Leu) rs764470378
NM_177438.2(DICER1):c.3635A>C (p.Gln1212Pro) rs763415569
NM_177438.2(DICER1):c.3637C>G (p.Pro1213Ala) rs965289045
NM_177438.2(DICER1):c.3640A>G (p.Thr1214Ala) rs776023608
NM_177438.2(DICER1):c.3641C>T (p.Thr1214Ile) rs769277842
NM_177438.2(DICER1):c.3653C>A (p.Ser1218Tyr)
NM_177438.2(DICER1):c.3653C>G (p.Ser1218Cys) rs1197755223
NM_177438.2(DICER1):c.3659A>C (p.Gln1220Pro) rs776020604
NM_177438.2(DICER1):c.3660G>A (p.Gln1220=) rs878855259
NM_177438.2(DICER1):c.3667T>C (p.Tyr1223His) rs1006671935
NM_177438.2(DICER1):c.366G>A (p.Gly122=) rs368741914
NM_177438.2(DICER1):c.3671G>A (p.Ser1224Asn) rs1555369495
NM_177438.2(DICER1):c.3674A>G (p.Tyr1225Cys) rs146584765
NM_177438.2(DICER1):c.3676G>A (p.Glu1226Lys) rs748087536
NM_177438.2(DICER1):c.3681C>A (p.Asn1227Lys) rs750457254
NM_177438.2(DICER1):c.3688C>T (p.Gln1230Ter)
NM_177438.2(DICER1):c.3690G>A (p.Gln1230=) rs1555369473
NM_177438.2(DICER1):c.3695G>A (p.Ser1232Asn) rs1060503597
NM_177438.2(DICER1):c.3696C>T (p.Ser1232=) rs767516330
NM_177438.2(DICER1):c.3697G>A (p.Asp1233Asn) rs1454503348
NM_177438.2(DICER1):c.3713T>C (p.Leu1238Pro) rs1060503603
NM_177438.2(DICER1):c.3722A>G (p.Lys1241Arg) rs764415288
NM_177438.2(DICER1):c.3728T>C (p.Leu1243Pro) rs561584807
NM_177438.2(DICER1):c.372C>T (p.Tyr124=) rs1555376174
NM_177438.2(DICER1):c.3741T>C (p.Ala1247=) rs765677895
NM_177438.2(DICER1):c.3746A>G (p.Lys1249Arg) rs527872690
NM_177438.2(DICER1):c.374C>T (p.Ser125Leu) rs377669634
NM_177438.2(DICER1):c.3773T>C (p.Met1258Thr) rs144095207
NM_177438.2(DICER1):c.3777C>G (p.Ala1259=) rs770390974
NM_177438.2(DICER1):c.3777C>T (p.Ala1259=) rs770390974
NM_177438.2(DICER1):c.3777dupC (p.V1260Rfs*19) rs886037709
NM_177438.2(DICER1):c.3778G>A (p.Val1260Ile) rs763425076
NM_177438.2(DICER1):c.377A>G (p.Asn126Ser) rs1060503593
NM_177438.2(DICER1):c.3789T>C (p.Gly1263=) rs1555369412
NM_177438.2(DICER1):c.3791C>T (p.Thr1264Met) rs139346443
NM_177438.2(DICER1):c.3792G>A (p.Thr1264=) rs778862635
NM_177438.2(DICER1):c.3796G>C (p.Asp1266His) rs1060503654
NM_177438.2(DICER1):c.3797A>C (p.Asp1266Ala)
NM_177438.2(DICER1):c.3798C>G (p.Asp1266Glu)
NM_177438.2(DICER1):c.379C>G (p.Leu127Val) rs560739585
NM_177438.2(DICER1):c.3808G>A (p.Val1270Met)
NM_177438.2(DICER1):c.3811C>T (p.Leu1271Phe)
NM_177438.2(DICER1):c.3815A>G (p.Lys1272Arg) rs151197809
NM_177438.2(DICER1):c.3816G>C (p.Lys1272Asn)
NM_177438.2(DICER1):c.3820A>C (p.Arg1274=) rs142193936
NM_177438.2(DICER1):c.3823A>G (p.Met1275Val) rs751764482
NM_177438.2(DICER1):c.3827A>G (p.Asp1276Gly) rs758636143
NM_177438.2(DICER1):c.3838A>T (p.Ser1280Cys) rs148696745
NM_177438.2(DICER1):c.383A>C (p.Glu128Ala)
NM_177438.2(DICER1):c.3842C>T (p.Pro1281Leu) rs1306948597
NM_177438.2(DICER1):c.3847A>G (p.Ile1283Val) rs548255758
NM_177438.2(DICER1):c.3848T>C (p.Ile1283Thr) rs754352488
NM_177438.2(DICER1):c.3851G>C (p.Gly1284Ala) rs563395930
NM_177438.2(DICER1):c.3857C>T (p.Ser1286Phe)
NM_177438.2(DICER1):c.3861A>G (p.Ser1287=) rs1060504970
NM_177438.2(DICER1):c.3868C>T (p.Leu1290Phe) rs1060503650
NM_177438.2(DICER1):c.3878A>G (p.Asn1293Ser) rs772855134
NM_177438.2(DICER1):c.3890T>C (p.Ile1297Thr) rs761578934
NM_177438.2(DICER1):c.3898G>A (p.Ala1300Thr) rs878855260
NM_177438.2(DICER1):c.38G>A (p.Gly13Asp) rs1060503610
NM_177438.2(DICER1):c.3903G>A (p.Leu1301=) rs1060504982
NM_177438.2(DICER1):c.3915C>T (p.Asn1305=) rs768375445
NM_177438.2(DICER1):c.3918T>C (p.Ala1306=) rs1555369319
NM_177438.2(DICER1):c.3939G>A (p.Glu1313=) rs191567701
NM_177438.2(DICER1):c.393A>G (p.Ala131=) rs1314163773
NM_177438.2(DICER1):c.3943C>T (p.Leu1315Phe)
NM_177438.2(DICER1):c.3952C>T (p.Leu1318Phe) rs1555369315
NM_177438.2(DICER1):c.3957C>T (p.Gly1319=) rs747021489
NM_177438.2(DICER1):c.3957dup (p.Asp1320Argfs)
NM_177438.2(DICER1):c.3972G>A (p.Lys1324=) rs45562437
NM_177438.2(DICER1):c.3986C>G (p.Thr1329Arg) rs878855261
NM_177438.2(DICER1):c.3987A>G (p.Thr1329=) rs373810197
NM_177438.2(DICER1):c.3990T>C (p.Tyr1330=) rs202227142
NM_177438.2(DICER1):c.3993A>G (p.Leu1331=) rs779318741
NM_177438.2(DICER1):c.4001C>T (p.Thr1334Ile) rs1555369296
NM_177438.2(DICER1):c.4004dupA (p.Tyr1335Terfs) rs878855262
NM_177438.2(DICER1):c.4008T>G (p.Pro1336=) rs754366233
NM_177438.2(DICER1):c.4013C>T (p.Ala1338Val) rs766732310
NM_177438.2(DICER1):c.4014G>A (p.Ala1338=) rs143454689
NM_177438.2(DICER1):c.4024C>T (p.Arg1342Cys) rs776854466
NM_177438.2(DICER1):c.402A>G (p.Thr134=) rs1555376170
NM_177438.2(DICER1):c.4031C>G (p.Ser1344Ter)
NM_177438.2(DICER1):c.4036A>G (p.Met1346Val)
NM_177438.2(DICER1):c.4050+8A>G rs746668314
NM_177438.2(DICER1):c.4051-4A>G rs755235399
NM_177438.2(DICER1):c.4051-7G>C rs1463004828
NM_177438.2(DICER1):c.4060T>A (p.Cys1354Ser) rs749559682
NM_177438.2(DICER1):c.4066C>T (p.Leu1356=) rs1555368640
NM_177438.2(DICER1):c.4068G>A (p.Leu1356=) rs1060504959
NM_177438.2(DICER1):c.406G>C (p.Glu136Gln)
NM_177438.2(DICER1):c.4073G>A (p.Arg1358His) rs780488568
NM_177438.2(DICER1):c.4074C>A (p.Arg1358=) rs1060504986
NM_177438.2(DICER1):c.407A>C (p.Glu136Ala) rs1037879170
NM_177438.2(DICER1):c.4082A>G (p.Lys1361Arg) rs1555368619
NM_177438.2(DICER1):c.4083A>G (p.Lys1361=) rs1555368612
NM_177438.2(DICER1):c.4091G>C (p.Gly1364Ala) rs1467554488
NM_177438.2(DICER1):c.4093C>A (p.Leu1365Ile) rs1250570322
NM_177438.2(DICER1):c.4101C>T (p.Ser1367=) rs370897400
NM_177438.2(DICER1):c.4102C>T (p.Arg1368Cys) rs752740048
NM_177438.2(DICER1):c.4103G>A (p.Arg1368His) rs767112987
NM_177438.2(DICER1):c.4104C>A (p.Arg1368=) rs779443466
NM_177438.2(DICER1):c.4130delC (p.Pro1377Leufs) rs34678453
NM_177438.2(DICER1):c.4135A>T (p.Asn1379Tyr) rs1555368579
NM_177438.2(DICER1):c.4144C>T (p.Pro1382Ser)
NM_177438.2(DICER1):c.4151G>T (p.Gly1384Val) rs1060503664
NM_177438.2(DICER1):c.4175G>A (p.Ser1392Asn) rs751216539
NM_177438.2(DICER1):c.4178_4180dupACA (p.Asn1393_Thr1394insAsn) rs878855263
NM_177438.2(DICER1):c.4189T>C (p.Trp1397Arg) rs762677393
NM_177438.2(DICER1):c.4199A>G (p.Asp1400Gly) rs139536688
NM_177438.2(DICER1):c.4200T>A (p.Asp1400Glu) rs941973586
NM_177438.2(DICER1):c.4201G>A (p.Glu1401Lys)
NM_177438.2(DICER1):c.4206+11delG rs58202892
NM_177438.2(DICER1):c.4206+7_4206+8dupTT rs1555368535
NM_177438.2(DICER1):c.4206+8_4206+9insTTGT rs763704682
NM_177438.2(DICER1):c.4206+8_4206+9insTTGTGT rs763704682
NM_177438.2(DICER1):c.4206+8_4206+9insTTGTGTGT rs763704682
NM_177438.2(DICER1):c.4206+8_4206+9insTTGTGTGTGT rs763704682
NM_177438.2(DICER1):c.4206+8_4206+9insTTGTGTGTGTGT rs763704682
NM_177438.2(DICER1):c.4206+8_4206+9insTTGTGTGTGTGTGT rs763704682
NM_177438.2(DICER1):c.4206+8_4206+9insTTGTGTGTGTGTGTGT rs763704682
NM_177438.2(DICER1):c.4206+8_4206+9insTTTTGTGT rs763704682
NM_177438.2(DICER1):c.4206+8_4206+9insTTTTGTGTGT rs763704682
NM_177438.2(DICER1):c.4206+8_4206+9insTTTTTT rs1555368535
NM_177438.2(DICER1):c.4206+9G>T rs1778057
NM_177438.2(DICER1):c.4206+9_4206+13delGTGTG rs745445238
NM_177438.2(DICER1):c.4206+9_4206+15delGTGTGTG rs199508452
NM_177438.2(DICER1):c.4206+9_4206+17delGTGTGTGTG rs772457274
NM_177438.2(DICER1):c.4206+9_4206+19delGTGTGTGTGTG rs748368348
NM_177438.2(DICER1):c.4206+9_4206+21delGTGTGTGTGTGTG rs746597527
NM_177438.2(DICER1):c.4206+9_4206+23delGTGTGTGTGTGTGTG rs766236360
NM_177438.2(DICER1):c.4206+9_4206+25delGTGTGTGTGTGTGTGTG rs773144954
NM_177438.2(DICER1):c.4206+9_4206+27delGTGTGTGTGTGTGTGTGTG rs775736832
NM_177438.2(DICER1):c.4206G>A (p.Met1402Ile) rs866519895
NM_177438.2(DICER1):c.4207-3C>T rs376041812
NM_177438.2(DICER1):c.4207-7G>A rs561542587
NM_177438.2(DICER1):c.4207-8C>T rs763694414
NM_177438.2(DICER1):c.4212A>G (p.Lys1404=) rs1555367926
NM_177438.2(DICER1):c.4212delA (p.Asp1405Thrfs) rs1555367927
NM_177438.2(DICER1):c.4220T>G (p.Met1407Arg) rs1555367920
NM_177438.2(DICER1):c.4221G>T (p.Met1407Ile) rs1060503589
NM_177438.2(DICER1):c.4222C>T (p.Leu1408=) rs1015236844
NM_177438.2(DICER1):c.4226C>A (p.Ala1409Glu)
NM_177438.2(DICER1):c.4227G>A (p.Ala1409=) rs766248937
NM_177438.2(DICER1):c.4230T>C (p.Asn1410=) rs1060504963
NM_177438.2(DICER1):c.4245G>A (p.Glu1415=) rs373735840
NM_177438.2(DICER1):c.4248T>C (p.Asp1416=) rs1456189877
NM_177438.2(DICER1):c.4251C>T (p.Tyr1417=) rs763063055
NM_177438.2(DICER1):c.4256A>T (p.Glu1419Val)
NM_177438.2(DICER1):c.4260_4262delGGA (p.Glu1420del) rs544960260
NM_177438.2(DICER1):c.4263_4274delTGAGGAGGAGGA (p.Asp1421_Glu1424del)
NM_177438.2(DICER1):c.4266G>T (p.Glu1422Asp) rs746164022
NM_177438.2(DICER1):c.4272G>A (p.Glu1424=) rs1208041583
NM_177438.2(DICER1):c.4277G>A (p.Ser1426Asn) rs1060503648
NM_177438.2(DICER1):c.427A>G (p.Thr143Ala) rs1060503612
NM_177438.2(DICER1):c.4281G>A (p.Leu1427=) rs143985382
NM_177438.2(DICER1):c.4281G>T (p.Leu1427=) rs143985382
NM_177438.2(DICER1):c.4283T>A (p.Met1428Lys) rs996633792
NM_177438.2(DICER1):c.4288A>G (p.Arg1430Gly) rs771513798
NM_177438.2(DICER1):c.4293T>C (p.Ala1431=) rs1555367866
NM_177438.2(DICER1):c.4295C>T (p.Pro1432Leu) rs747593690
NM_177438.2(DICER1):c.4296G>A (p.Pro1432=) rs146679273
NM_177438.2(DICER1):c.4305G>T (p.Glu1435Asp)
NM_177438.2(DICER1):c.4307C>A (p.Ala1436Asp) rs777127946
NM_177438.2(DICER1):c.4309_4312delGACT (p.D1437Mfs*16) rs886037712
NM_177438.2(DICER1):c.4311C>T (p.Asp1437=) rs1060504980
NM_177438.2(DICER1):c.4312T>A (p.Tyr1438Asn) rs878855264
NM_177438.2(DICER1):c.431A>T (p.Lys144Met) rs1060503629
NM_177438.2(DICER1):c.4327C>T (p.Leu1443=) rs1060504978
NM_177438.2(DICER1):c.432G>C (p.Lys144Asn) rs370784723
NM_177438.2(DICER1):c.4363A>G (p.Asn1455Asp)
NM_177438.2(DICER1):c.4364A>C (p.Asn1455Thr) rs878855265
NM_177438.2(DICER1):c.4376G>A (p.Gly1459Glu) rs1043584252
NM_177438.2(DICER1):c.438+6A>C rs1555376154
NM_177438.2(DICER1):c.4385C>T (p.Ala1462Val) rs1555367829
NM_177438.2(DICER1):c.4386T>C (p.Ala1462=) rs878855266
NM_177438.2(DICER1):c.439-7A>T rs376762569
NM_177438.2(DICER1):c.439-9T>C rs774024734
NM_177438.2(DICER1):c.4390G>T (p.Val1464Leu)
NM_177438.2(DICER1):c.439G>T (p.Val147Phe)
NM_177438.2(DICER1):c.4401C>T (p.Ile1467=) rs530896743
NM_177438.2(DICER1):c.4403C>G (p.Ser1468Cys) rs753582860
NM_177438.2(DICER1):c.4405C>A (p.Leu1469Ile) rs766194200
NM_177438.2(DICER1):c.4405_4406delCT (p.Leu1469Phefs) rs1064795904
NM_177438.2(DICER1):c.4406T>C (p.Leu1469Pro) rs200890670
NM_177438.2(DICER1):c.4407_4410delTTCT (p.Ser1470Leufs) rs875989784
NM_177438.2(DICER1):c.4411C>T (p.Pro1471Ser) rs764066711
NM_177438.2(DICER1):c.4412C>T (p.Pro1471Leu) rs1060503657
NM_177438.2(DICER1):c.4416T>C (p.Phe1472=) rs775712479
NM_177438.2(DICER1):c.4423A>G (p.Thr1475Ala) rs150883389
NM_177438.2(DICER1):c.4430C>T (p.Ser1477Phe) rs1463264407
NM_177438.2(DICER1):c.4436A>G (p.Tyr1479Cys) rs1218181729
NM_177438.2(DICER1):c.4449G>A (p.Met1483Ile)
NM_177438.2(DICER1):c.444C>T (p.Leu148=) rs749119946
NM_177438.2(DICER1):c.4458A>G (p.Lys1486=) rs1060504971
NM_177438.2(DICER1):c.446T>C (p.Ile149Thr) rs549001286
NM_177438.2(DICER1):c.4470T>A (p.Gly1490=) rs1060504975
NM_177438.2(DICER1):c.4472G>T (p.Ser1491Ile) rs878855267
NM_177438.2(DICER1):c.4474A>G (p.Met1492Val) rs756830706
NM_177438.2(DICER1):c.4475T>C (p.Met1492Thr) rs370947079
NM_177438.2(DICER1):c.4479A>T (p.Pro1493=) rs778417701
NM_177438.2(DICER1):c.4484C>T (p.Ser1495Leu) rs753527258
NM_177438.2(DICER1):c.4489G>A (p.Asp1497Asn) rs878855268
NM_177438.2(DICER1):c.4494T>G (p.Phe1498Leu)
NM_177438.2(DICER1):c.44A>G (p.Gln15Arg) rs1555376589
NM_177438.2(DICER1):c.4509C>T (p.Tyr1503=) rs755994757
NM_177438.2(DICER1):c.4515T>C (p.Ser1505=) rs141308332
NM_177438.2(DICER1):c.4533T>C (p.Tyr1511=) rs1131691206
NM_177438.2(DICER1):c.4554T>A (p.Val1518=) rs752773026
NM_177438.2(DICER1):c.4556A>T (p.Glu1519Val) rs1060503622
NM_177438.2(DICER1):c.458A>C (p.Tyr153Ser)
NM_177438.2(DICER1):c.459dup (p.Val154Cysfs) rs1555375978
NM_177438.2(DICER1):c.4616C>A (p.Thr1539Lys) rs747901058
NM_177438.2(DICER1):c.4616C>T (p.Thr1539Met) rs747901058
NM_177438.2(DICER1):c.4617G>A (p.Thr1539=) rs772583811
NM_177438.2(DICER1):c.462C>T (p.Val154=) rs199737359
NM_177438.2(DICER1):c.4638C>A (p.Tyr1546Ter) rs773822569
NM_177438.2(DICER1):c.4638C>T (p.Tyr1546=) rs773822569
NM_177438.2(DICER1):c.463G>A (p.Ala155Thr) rs745802492
NM_177438.2(DICER1):c.4644G>C (p.Leu1548Phe) rs1060503619
NM_177438.2(DICER1):c.4647C>T (p.His1549=) rs201415999
NM_177438.2(DICER1):c.4665T>C (p.Ala1555=) rs748924713
NM_177438.2(DICER1):c.4683C>T (p.Asp1561=) rs899603485
NM_177438.2(DICER1):c.4686T>C (p.Cys1562=) rs1555367687
NM_177438.2(DICER1):c.4695C>G (p.Ala1565=) rs780868309
NM_177438.2(DICER1):c.4707C>T (p.Cys1569=) rs878855269
NM_177438.2(DICER1):c.4709A>G (p.Tyr1570Cys) rs765396989
NM_177438.2(DICER1):c.4718G>C (p.Ser1573Thr) rs1555367674
NM_177438.2(DICER1):c.4723G>C (p.Gly1575Arg) rs1060503609
NM_177438.2(DICER1):c.4737T>C (p.Ala1579=) rs1060504989
NM_177438.2(DICER1):c.4740G>T (p.Gln1580His) rs369465519
NM_177438.2(DICER1):c.4749C>A (p.Leu1583=) rs767814647
NM_177438.2(DICER1):c.4749C>G (p.Leu1583=) rs767814647
NM_177438.2(DICER1):c.474T>G (p.Val158=) rs878855270
NM_177438.2(DICER1):c.4755A>G (p.Ser1585=) rs555975437
NM_177438.2(DICER1):c.4755A>T (p.Ser1585=) rs555975437
NM_177438.2(DICER1):c.4762delC (p.Leu1588Terfs)
NM_177438.2(DICER1):c.4773C>G (p.Leu1591=) rs138308365
NM_177438.2(DICER1):c.4773C>T (p.Leu1591=) rs138308365
NM_177438.2(DICER1):c.4776G>A (p.Pro1592=) rs781007779
NM_177438.2(DICER1):c.4777G>C (p.Val1593Leu) rs1060503644
NM_177438.2(DICER1):c.4795C>G (p.Arg1599Gly) rs587778230
NM_177438.2(DICER1):c.4796G>A (p.Arg1599Gln) rs569615549
NM_177438.2(DICER1):c.4796G>T (p.Arg1599Leu) rs569615549
NM_177438.2(DICER1):c.4802A>T (p.Lys1601Met) rs181018393
NM_177438.2(DICER1):c.4804G>A (p.Ala1602Thr) rs145669719
NM_177438.2(DICER1):c.4805C>G (p.Ala1602Gly) rs148955573
NM_177438.2(DICER1):c.4807C>T (p.Leu1603=) rs201320420
NM_177438.2(DICER1):c.480A>G (p.Lys160=) rs758436019
NM_177438.2(DICER1):c.4815T>C (p.Pro1605=) rs1060504976
NM_177438.2(DICER1):c.4819C>T (p.Arg1607Trp) rs189119295
NM_177438.2(DICER1):c.4820G>A (p.Arg1607Gln) rs368963384
NM_177438.2(DICER1):c.4826A>G (p.Asn1609Ser) rs1228069910
NM_177438.2(DICER1):c.4832A>C (p.Asn1611Thr)
NM_177438.2(DICER1):c.4838A>G (p.Gln1613Arg)
NM_177438.2(DICER1):c.4841A>G (p.Gln1614Arg) rs769225805
NM_177438.2(DICER1):c.4847A>G (p.Asn1616Ser) rs1257498722
NM_177438.2(DICER1):c.4850T>C (p.Leu1617Pro) rs1555367614
NM_177438.2(DICER1):c.4853C>T (p.Ser1618Leu) rs377205344
NM_177438.2(DICER1):c.4859G>A (p.Ser1620Asn) rs1555367601
NM_177438.2(DICER1):c.485G>A (p.Gly162Asp) rs142815547
NM_177438.2(DICER1):c.4864G>A (p.Ala1622Thr)
NM_177438.2(DICER1):c.4870G>C (p.Ala1624Pro) rs372967646
NM_177438.2(DICER1):c.4873T>C (p.Ser1625Pro) rs529131866
NM_177438.2(DICER1):c.4874C>A (p.Ser1625Tyr) rs864622653
NM_177438.2(DICER1):c.4874C>G (p.Ser1625Cys) rs864622653
NM_177438.2(DICER1):c.4874C>T (p.Ser1625Phe) rs864622653
NM_177438.2(DICER1):c.4888C>T (p.Arg1630Cys) rs549532374
NM_177438.2(DICER1):c.4889G>A (p.Arg1630His) rs368343829
NM_177438.2(DICER1):c.4891T>C (p.Ser1631Pro)
NM_177438.2(DICER1):c.4891T>G (p.Ser1631Ala) rs145551486
NM_177438.2(DICER1):c.4894T>C (p.Ser1632Pro) rs545392797
NM_177438.2(DICER1):c.4896T>C (p.Ser1632=) rs376515225
NM_177438.2(DICER1):c.4897G>A (p.Val1633Ile) rs1060503643
NM_177438.2(DICER1):c.4899A>G (p.Val1633=) rs878855271
NM_177438.2(DICER1):c.489C>G (p.Tyr163Ter) rs864622626
NM_177438.2(DICER1):c.4901T>C (p.Leu1634Ser) rs149723645
NM_177438.2(DICER1):c.4905A>C (p.Lys1635Asn)
NM_177438.2(DICER1):c.4910C>T (p.Ser1637Leu) rs140875148
NM_177438.2(DICER1):c.4921T>G (p.Cys1641Gly)
NM_177438.2(DICER1):c.4923T>G (p.Cys1641Trp) rs587778231
NM_177438.2(DICER1):c.4932T>A (p.Ile1644=) rs1060504966
NM_177438.2(DICER1):c.493T>C (p.Ser165Pro) rs894664317
NM_177438.2(DICER1):c.4945A>G (p.Met1649Val) rs146715213
NM_177438.2(DICER1):c.4947G>A (p.Met1649Ile) rs1274381410
NM_177438.2(DICER1):c.4949T>G (p.Phe1650Cys) rs760439905
NM_177438.2(DICER1):c.4954C>T (p.His1652Tyr) rs1372597986
NM_177438.2(DICER1):c.495A>C (p.Ser165=) rs754324569
NM_177438.2(DICER1):c.4970A>C (p.Lys1657Thr) rs778780063
NM_177438.2(DICER1):c.4974A>G (p.Thr1658=) rs1555367533
NM_177438.2(DICER1):c.4986T>C (p.Leu1662=) rs371564184
NM_177438.2(DICER1):c.4987A>G (p.Ile1663Val) rs1555367530
NM_177438.2(DICER1):c.4991C>T (p.Ser1664Leu) rs988095775
NM_177438.2(DICER1):c.4993G>A (p.Gly1665Arg) rs1555367528
NM_177438.2(DICER1):c.4995G>A (p.Gly1665=) rs757430396
NM_177438.2(DICER1):c.4999G>T (p.Glu1667Ter) rs1555367522
NM_177438.2(DICER1):c.49A>C (p.Met17Leu) rs1555376587
NM_177438.2(DICER1):c.5013G>C (p.Lys1671Asn) rs751819396
NM_177438.2(DICER1):c.5016A>T (p.Lys1672Asn) rs1438773814
NM_177438.2(DICER1):c.5020A>G (p.Asn1674Asp) rs1555367519
NM_177438.2(DICER1):c.5021A>C (p.Asn1674Thr)
NM_177438.2(DICER1):c.5023T>C (p.Tyr1675His) rs1555367518
NM_177438.2(DICER1):c.5025C>T (p.Tyr1675=) rs1555367516
NM_177438.2(DICER1):c.5027G>C (p.Arg1676Thr) rs375465466
NM_177438.2(DICER1):c.5028A>T (p.Arg1676Ser) rs1555367513
NM_177438.2(DICER1):c.5038A>G (p.Lys1680Glu) rs1060503639
NM_177438.2(DICER1):c.5043T>C (p.Ala1681=) rs1356467328
NM_177438.2(DICER1):c.5052C>G (p.Leu1684=) rs145027662
NM_177438.2(DICER1):c.5057C>T (p.Ala1686Val) rs1555367498
NM_177438.2(DICER1):c.5063C>A (p.Thr1688Lys) rs1555367495
NM_177438.2(DICER1):c.5064A>G (p.Thr1688=) rs1335341959
NM_177438.2(DICER1):c.5082C>T (p.Tyr1694=) rs1555367486
NM_177438.2(DICER1):c.5089A>G (p.Ile1697Val) rs1457257809
NM_177438.2(DICER1):c.5095+6G>A rs760384855
NM_177438.2(DICER1):c.5095+6G>C
NM_177438.2(DICER1):c.5095+9C>T rs1555367476
NM_177438.2(DICER1):c.5096-12G>A
NM_177438.2(DICER1):c.5096-6C>G rs1060503658
NM_177438.2(DICER1):c.5096-8C>A
NM_177438.2(DICER1):c.5103C>G (p.Tyr1701Ter) rs875989780
NM_177438.2(DICER1):c.5104C>T (p.Q1702*) rs886037723
NM_177438.2(DICER1):c.5107C>T (p.Arg1703Cys) rs878855272
NM_177438.2(DICER1):c.5112A>G (p.Leu1704=) rs1388170795
NM_177438.2(DICER1):c.5118C>A (p.Phe1706Leu) rs1060503635
NM_177438.2(DICER1):c.5126A>G (p.Asp1709Gly) rs1555366979
NM_177438.2(DICER1):c.5130G>A (p.Ala1710=) rs769974404
NM_177438.2(DICER1):c.5139C>T (p.Asp1713=) rs1555366964
NM_177438.2(DICER1):c.5145C>T (p.Leu1715=) rs139500905
NM_177438.2(DICER1):c.514T>C (p.Leu172=) rs1060504972
NM_177438.2(DICER1):c.5151C>A (p.Thr1717=) rs878855273
NM_177438.2(DICER1):c.5160T>C (p.Leu1720=) rs1555366933
NM_177438.2(DICER1):c.5169C>G (p.Asp1723Glu) rs1555366914
NM_177438.2(DICER1):c.5171C>A (p.Pro1724Gln) rs749900564
NM_177438.2(DICER1):c.5177A>T (p.Gln1726Leu) rs1555366877
NM_177438.2(DICER1):c.5180A>G (p.His1727Arg)
NM_177438.2(DICER1):c.5184C>T (p.Ser1728=) rs202004554
NM_177438.2(DICER1):c.5187G>A (p.Pro1729=) rs765113010
NM_177438.2(DICER1):c.5190G>A (p.Gly1730=) rs371759757
NM_177438.2(DICER1):c.5191G>C (p.Val1731Leu) rs1555366846
NM_177438.2(DICER1):c.5203C>T (p.Leu1735=) rs188609628
NM_177438.2(DICER1):c.5208G>A (p.Arg1736=) rs1060504969
NM_177438.2(DICER1):c.5238A>G (p.Ala1746=) rs1432708141
NM_177438.2(DICER1):c.5241G>A (p.Ser1747=) rs114861074
NM_177438.2(DICER1):c.5244G>A (p.Leu1748=) rs1060503606
NM_177438.2(DICER1):c.5248G>A (p.Val1750Ile) rs1184678913
NM_177438.2(DICER1):c.5256C>T (p.Tyr1752=) rs373750374
NM_177438.2(DICER1):c.5257G>A (p.Asp1753Asn) rs1460430963
NM_177438.2(DICER1):c.5259C>G (p.Asp1753Glu) rs1165221864
NM_177438.2(DICER1):c.5261_5364+79delACCACAAGTACTTCAAAGCTGTCTCTCCTGAGCTCTTCCATGTCATTGATGACTTTGTGCAGTTTCAGCTTGAGAAGAATGAAATGCAAGGAATGGATTCTGAGGTTAGTGCTGTTCAAAACGATGTTGAAAAAAGTGGTCTAACTAGGAGTCTCTGTAGTTTCAGAGTTCTGACGGCATAGT
NM_177438.2(DICER1):c.5262C>T (p.Tyr1754=) rs1555366752
NM_177438.2(DICER1):c.5276A>G (p.Lys1759Arg) rs144259142
NM_177438.2(DICER1):c.527A>T (p.Glu176Val) rs756586319
NM_177438.2(DICER1):c.5281G>A (p.Val1761Ile) rs1555366740
NM_177438.2(DICER1):c.5283C>T (p.Val1761=) rs1060504979
NM_177438.2(DICER1):c.5291A>C (p.Glu1764Ala) rs1060503637
NM_177438.2(DICER1):c.5301T>G (p.His1767Gln) rs1060503656
NM_177438.2(DICER1):c.5304C>G (p.Val1768=) rs1479781558
NM_177438.2(DICER1):c.5315_5316delTT (p.Phe1772Cysfs) rs878855274
NM_177438.2(DICER1):c.5316T>C (p.Phe1772=) rs1555366698
NM_177438.2(DICER1):c.5329C>T (p.Leu1777Phe) rs183879938
NM_177438.2(DICER1):c.5330T>A (p.Leu1777His)
NM_177438.2(DICER1):c.5335A>G (p.Lys1779Glu) rs1555366685
NM_177438.2(DICER1):c.5337G>A (p.Lys1779=) rs111630745
NM_177438.2(DICER1):c.5346G>A (p.Met1782Ile) rs1555366679
NM_177438.2(DICER1):c.535delC (p.Ala180Glnfs) rs1555375946
NM_177438.2(DICER1):c.5364+10G>C rs1555366668
NM_177438.2(DICER1):c.5364+7G>A rs751165743
NM_177438.2(DICER1):c.5365-3T>C
NM_177438.2(DICER1):c.5365-7_5365-6delGT rs767777044
NM_177438.2(DICER1):c.5369G>A (p.Arg1790Lys)
NM_177438.2(DICER1):c.5373A>G (p.Arg1791=)
NM_177438.2(DICER1):c.5374T>C (p.Ser1792Pro) rs1060503651
NM_177438.2(DICER1):c.5388A>G (p.Glu1796=) rs756025825
NM_177438.2(DICER1):c.5409A>G (p.Glu1803=) rs1060504977
NM_177438.2(DICER1):c.5422A>G (p.Met1808Val) rs763241498
NM_177438.2(DICER1):c.5427G>T (p.Gly1809=) rs1060504981
NM_177438.2(DICER1):c.5441C>T (p.Ser1814Leu) rs1060503625
NM_177438.2(DICER1):c.5442G>A (p.Ser1814=) rs759875628
NM_177438.2(DICER1):c.5461A>C (p.Met1821Leu) rs1060503604
NM_177438.2(DICER1):c.5461A>G (p.Met1821Val) rs1060503604
NM_177438.2(DICER1):c.5470G>C (p.Gly1824Arg) rs752411788
NM_177438.2(DICER1):c.5471G>T (p.Gly1824Val) rs377685186
NM_177438.2(DICER1):c.5479delC (p.Leu1827Trpfs) rs1555366197
NM_177438.2(DICER1):c.5486C>T (p.Thr1829Ile) rs1555366196
NM_177438.2(DICER1):c.5494C>T (p.Gln1832Ter) rs1060503583
NM_177438.2(DICER1):c.5495A>G (p.Gln1832Arg)
NM_177438.2(DICER1):c.549C>A (p.Asp183Glu)
NM_177438.2(DICER1):c.549C>G (p.Asp183Glu) rs1060503587
NM_177438.2(DICER1):c.5504A>C (p.Tyr1835Ser) rs747510783
NM_177438.2(DICER1):c.5504A>G (p.Tyr1835Cys) rs747510783
NM_177438.2(DICER1):c.5504_5507delATCC (p.Tyr1835Serfs)
NM_177438.2(DICER1):c.5515C>T (p.Arg1839Trp) rs1447120867
NM_177438.2(DICER1):c.5516G>A (p.Arg1839Gln) rs587778233
NM_177438.2(DICER1):c.5520A>G (p.Pro1840=) rs878855275
NM_177438.2(DICER1):c.5521C>T (p.Leu1841=) rs1555366154
NM_177438.2(DICER1):c.5524A>G (p.Ile1842Val) rs749059266
NM_177438.2(DICER1):c.5527+10G>T rs764254400
NM_177438.2(DICER1):c.5527+7T>A rs375239471
NM_177438.2(DICER1):c.5528-6T>C rs773875981
NM_177438.2(DICER1):c.5528-8G>C rs1555366116
NM_177438.2(DICER1):c.5529A>G (p.Glu1843=) rs768311617
NM_177438.2(DICER1):c.5556C>A (p.Ser1852=) rs745795376
NM_177438.2(DICER1):c.5562G>A (p.Val1854=) rs1226666951
NM_177438.2(DICER1):c.559C>A (p.Arg187=) rs763801533
NM_177438.2(DICER1):c.559C>G (p.Arg187Gly) rs763801533
NM_177438.2(DICER1):c.559C>T (p.Arg187Ter) rs763801533
NM_177438.2(DICER1):c.55C>A (p.Pro19Thr) rs1060503638
NM_177438.2(DICER1):c.5606C>T (p.Pro1869Leu) rs1459884777
NM_177438.2(DICER1):c.5607G>A (p.Pro1869=) rs762650757
NM_177438.2(DICER1):c.5608G>T (p.Ala1870Ser) rs1555366012
NM_177438.2(DICER1):c.560G>A (p.Arg187Gln) rs775207591
NM_177438.2(DICER1):c.5610T>G (p.Ala1870=) rs1060504961
NM_177438.2(DICER1):c.5622C>T (p.Tyr1874=) rs769490774
NM_177438.2(DICER1):c.5623G>A (p.Asp1875Asn) rs745601023
NM_177438.2(DICER1):c.5623G>T (p.Asp1875Tyr) rs745601023
NM_177438.2(DICER1):c.5625C>T (p.Asp1875=) rs781156066
NM_177438.2(DICER1):c.5626G>A (p.Gly1876Arg) rs770962059
NM_177438.2(DICER1):c.5643T>C (p.Thr1881=) rs199574382
NM_177438.2(DICER1):c.5652A>G (p.Val1884=) rs780084290
NM_177438.2(DICER1):c.5655A>G (p.Val1885=) rs1361058486
NM_177438.2(DICER1):c.5656G>C (p.Gly1886Arg)
NM_177438.2(DICER1):c.5664G>T (p.Gly1888=) rs1555365997
NM_177438.2(DICER1):c.5691C>T (p.Tyr1897=) rs1044532710
NM_177438.2(DICER1):c.5706T>C (p.Ser1902=) rs1555365987
NM_177438.2(DICER1):c.5729G>C (p.Arg1910Pro) rs1555365979
NM_177438.2(DICER1):c.573+5G>A
NM_177438.2(DICER1):c.5736C>G (p.Leu1912=) rs995276380
NM_177438.2(DICER1):c.5738A>G (p.Lys1913Arg) rs752116341
NM_177438.2(DICER1):c.574-5G>A rs368253792
NM_177438.2(DICER1):c.574-5G>T rs368253792
NM_177438.2(DICER1):c.574-6T>C rs1555375852
NM_177438.2(DICER1):c.574-7_574-5delATG rs753080447
NM_177438.2(DICER1):c.5746C>T (p.Gln1916Ter) rs1253131536
NM_177438.2(DICER1):c.5748A>G (p.Gln1916=) rs763651908
NM_177438.2(DICER1):c.5761A>G (p.Asn1921Asp)
NM_177438.2(DICER1):c.5762A>G (p.Asn1921Ser) rs764747360
NM_177438.2(DICER1):c.576C>T (p.Leu192=) rs1555375845
NM_177438.2(DICER1):c.583A>C (p.Asn195His) rs770842365
NM_177438.2(DICER1):c.589C>T (p.Pro197Ser) rs375689793
NM_177438.2(DICER1):c.58G>A (p.Ala20Thr) rs1555376579
NM_177438.2(DICER1):c.590C>T (p.Pro197Leu) rs1060503642
NM_177438.2(DICER1):c.594A>G (p.Ser198=) rs761971627
NM_177438.2(DICER1):c.59C>T (p.Ala20Val) rs147660793
NM_177438.2(DICER1):c.601C>T (p.Arg201Cys) rs774514314
NM_177438.2(DICER1):c.639A>G (p.Lys213=) rs370474705
NM_177438.2(DICER1):c.648A>G (p.Pro216=) rs878855276
NM_177438.2(DICER1):c.650A>T (p.Glu217Val)
NM_177438.2(DICER1):c.652G>A (p.Glu218Lys) rs747514493
NM_177438.2(DICER1):c.655T>C (p.Leu219=) rs777225197
NM_177438.2(DICER1):c.65C>T (p.Ser22Leu) rs1060503626
NM_177438.2(DICER1):c.660A>C (p.Glu220Asp) rs1555375819
NM_177438.2(DICER1):c.663A>G (p.Glu221=) rs1555375817
NM_177438.2(DICER1):c.671A>T (p.Gln224Leu) rs1555375816
NM_177438.2(DICER1):c.67C>T (p.Pro23Ser) rs1555376567
NM_177438.2(DICER1):c.683A>G (p.Lys228Arg) rs1060503659
NM_177438.2(DICER1):c.70A>G (p.Met24Val) rs754439528
NM_177438.2(DICER1):c.716A>G (p.Asp239Gly) rs1555375788
NM_177438.2(DICER1):c.718C>G (p.Leu240Val) rs1060503615
NM_177438.2(DICER1):c.729A>G (p.Leu243=) rs1380622608
NM_177438.2(DICER1):c.734+4T>C rs866993296
NM_177438.2(DICER1):c.734+6C>T rs200212137
NM_177438.2(DICER1):c.734+8C>T rs1060504988
NM_177438.2(DICER1):c.735G>A (p.Arg245=)
NM_177438.2(DICER1):c.735G>T (p.Arg245Ser) rs767605412
NM_177438.2(DICER1):c.737A>G (p.Tyr246Cys) rs775370673
NM_177438.2(DICER1):c.738T>C (p.Tyr246=) rs1310433898
NM_177438.2(DICER1):c.739A>G (p.Thr247Ala) rs369189695
NM_177438.2(DICER1):c.742T>A (p.Ser248Thr) rs759633210
NM_177438.2(DICER1):c.747G>A (p.Gln249=) rs376070315
NM_177438.2(DICER1):c.750A>G (p.Pro250=) rs1347073178
NM_177438.2(DICER1):c.751T>C (p.Cys251Arg) rs1353008772
NM_177438.2(DICER1):c.757dup (p.Ile253Asnfs) rs1555375356
NM_177438.2(DICER1):c.773G>T (p.Gly258Val) rs188327838
NM_177438.2(DICER1):c.774A>G (p.Gly258=) rs1425525083
NM_177438.2(DICER1):c.776C>T (p.Pro259Leu) rs566464225
NM_177438.2(DICER1):c.77C>T (p.Pro26Leu) rs201358110
NM_177438.2(DICER1):c.783T>C (p.Thr261=) rs1555375347
NM_177438.2(DICER1):c.78T>C (p.Pro26=) rs759653160
NM_177438.2(DICER1):c.796C>T (p.Leu266Phe)
NM_177438.2(DICER1):c.801T>C (p.Tyr267=) rs748703376
NM_177438.2(DICER1):c.803A>G (p.Glu268Gly) rs774554682
NM_177438.2(DICER1):c.816G>C (p.Met272Ile)
NM_177438.2(DICER1):c.818A>C (p.Glu273Ala)
NM_177438.2(DICER1):c.81C>G (p.Phe27Leu) rs1555376563
NM_177438.2(DICER1):c.820T>G (p.Leu274Val) rs778219828
NM_177438.2(DICER1):c.823G>T (p.Glu275Ter) rs1555375333
NM_177438.2(DICER1):c.828A>G (p.Glu276=) rs1555375329
NM_177438.2(DICER1):c.830C>T (p.Ala277Val) rs986916694
NM_177438.2(DICER1):c.835A>T (p.Asn279Tyr)
NM_177438.2(DICER1):c.83T>C (p.Phe28Ser) rs61729796
NM_177438.2(DICER1):c.848A>T (p.Asp283Val)
NM_177438.2(DICER1):c.84T>C (p.Phe28=) rs1184817036
NM_177438.2(DICER1):c.851G>A (p.Cys284Tyr)
NM_177438.2(DICER1):c.860C>G (p.Ser287Cys) rs1060503600
NM_177438.2(DICER1):c.861T>C (p.Ser287=) rs1555375306
NM_177438.2(DICER1):c.862G>A (p.Val288Ile) rs1555375302
NM_177438.2(DICER1):c.870A>G (p.Ser290=) rs1060504960
NM_177438.2(DICER1):c.877A>G (p.Arg293Gly) rs878855277
NM_177438.2(DICER1):c.87A>T (p.Gly29=) rs1555376553
NM_177438.2(DICER1):c.884C>G (p.Ser295Cys) rs548231008
NM_177438.2(DICER1):c.896C>T (p.Ser299Leu) rs755944755
NM_177438.2(DICER1):c.897G>A (p.Ser299=) rs201842071
NM_177438.2(DICER1):c.901C>T (p.Gln301Ter) rs781144010
NM_177438.2(DICER1):c.904-1G>C
NM_177438.2(DICER1):c.904-5T>C rs1379402448
NM_177438.2(DICER1):c.904-5delT rs769549511
NM_177438.2(DICER1):c.904-5dupT rs769549511
NM_177438.2(DICER1):c.904A>C (p.Ile302Leu) rs1555374864
NM_177438.2(DICER1):c.907C>T (p.Leu303=) rs1060504957
NM_177438.2(DICER1):c.909A>C (p.Leu303=) rs773509809
NM_177438.2(DICER1):c.909A>G (p.Leu303=) rs773509809
NM_177438.2(DICER1):c.918T>C (p.Cys306=) rs886943453
NM_177438.2(DICER1):c.919C>T (p.Arg307Cys) rs772431718
NM_177438.2(DICER1):c.920G>A (p.Arg307His) rs149718671
NM_177438.2(DICER1):c.924C>T (p.Ala308=) rs142397473
NM_177438.2(DICER1):c.925G>A (p.Val309Ile) rs1181141404
NM_177438.2(DICER1):c.947G>A (p.Trp316Ter) rs1555374839
NM_177438.2(DICER1):c.959A>G (p.Lys320Arg) rs779851333
NM_177438.2(DICER1):c.968G>A (p.Gly323Glu)
NM_177438.2(DICER1):c.968G>T (p.Gly323Val) rs906299601
NM_177438.2(DICER1):c.972G>A (p.Met324Ile) rs1555374806
NM_177438.2(DICER1):c.973A>G (p.Met325Val) rs1555374801
NM_177438.2(DICER1):c.976G>A (p.Val326Ile) rs1555374798
NM_177438.2(DICER1):c.976G>C (p.Val326Leu) rs1555374798
NM_177438.2(DICER1):c.978A>G (p.Val326=) rs781090715
NM_177438.2(DICER1):c.979A>G (p.Arg327Gly) rs1555374797
NM_177438.2(DICER1):c.996C>T (p.Tyr332=) rs757094384
NM_177438.2(DICER1):c.99A>G (p.Gln33=) rs773456851
NM_177438.2(DICER1):c.9C>T (p.Ser3=) rs1555376609

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.