ClinVar Miner

List of variants in gene EHMT1 reported as likely pathogenic for Chromosome 9q deletion syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 6
Download table as spreadsheet
HGVS dbSNP
NM_024757.4(EHMT1):c.13_21+153delGATGCCGAGGTGAGCAGCGGGGCCGGCGGGGGGCGGCGCGGGGGCGGCGGGCAGCGGCGGAGGCGGCGCGGGGGCGAAGAACCGGGCGGGGCGGCGGCAGGCGGCCGGCGGGCGGGCGGGGCCCCGGGTCCCCCCGCCGCCGCCGCCGCCGCTGCCGCCGCC
NM_024757.4(EHMT1):c.2516G>T (p.Gly839Val) rs1554888939
NM_024757.4(EHMT1):c.3310G>A (p.Glu1104Lys) rs886041093
NM_024757.4(EHMT1):c.3583_3594del (p.Val1195_Phe1198del) rs1554908290
NM_024757.4(EHMT1):c.3589C>T (p.Arg1197Trp) rs137852727
NM_024757.5(EHMT1):c.1249-2A>G

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.