ClinVar Miner

List of variants in gene EHMT1 reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 204
Download table as spreadsheet
HGVS dbSNP
NC_000009.11:g.(?_140605399)_(140652483_?)dup
NC_000009.11:g.(?_140695312)_(140729425_?)dup
NC_000009.11:g.(?_140728781)_(140729425_?)dup
NM_024757.4(EHMT1):c.13_21+153delGATGCCGAGGTGAGCAGCGGGGCCGGCGGGGGGCGGCGCGGGGGCGGCGGGCAGCGGCGGAGGCGGCGCGGGGGCGAAGAACCGGGCGGGGCGGCGGCAGGCGGCCGGCGGGCGGGCGGGGCCCCGGGTCCCCCCGCCGCCGCCGCCGCCGCTGCCGCCGCC rs1564509503
NM_024757.5(EHMT1):c.100G>A (p.Ala34Thr)
NM_024757.5(EHMT1):c.102C>T (p.Ala34=) rs202208554
NM_024757.5(EHMT1):c.1081G>A (p.Gly361Ser) rs143891279
NM_024757.5(EHMT1):c.1089_1090inv (p.Ala364Thr)
NM_024757.5(EHMT1):c.1100C>T (p.Ala367Val)
NM_024757.5(EHMT1):c.1133C>T (p.Ser378Phe) rs780462689
NM_024757.5(EHMT1):c.1140G>C (p.Glu380Asp) rs368995503
NM_024757.5(EHMT1):c.1160G>A (p.Arg387His) rs776502547
NM_024757.5(EHMT1):c.1162G>A (p.Ala388Thr) rs11137198
NM_024757.5(EHMT1):c.1176C>T (p.Asp392=) rs373083497
NM_024757.5(EHMT1):c.1177G>T (p.Gly393Trp) rs772187480
NM_024757.5(EHMT1):c.1202C>A (p.Ser401Tyr) rs1554863573
NM_024757.5(EHMT1):c.1222G>C (p.Glu408Gln) rs1564693239
NM_024757.5(EHMT1):c.1249-9G>T rs73669157
NM_024757.5(EHMT1):c.1265T>G (p.Ile422Ser) rs1564697100
NM_024757.5(EHMT1):c.128C>T (p.Ala43Val)
NM_024757.5(EHMT1):c.128_129delinsGT (p.Ala43Gly) rs386739686
NM_024757.5(EHMT1):c.129A>T (p.Ala43=) rs76684726
NM_024757.5(EHMT1):c.1337G>A (p.Arg446Gln) rs745964626
NM_024757.5(EHMT1):c.1360G>A (p.Gly454Ser) rs774046148
NM_024757.5(EHMT1):c.1369+9C>T rs146125583
NM_024757.5(EHMT1):c.1382A>G (p.Tyr461Cys) rs576338391
NM_024757.5(EHMT1):c.1402G>A (p.Ala468Thr) rs202097707
NM_024757.5(EHMT1):c.1412C>T (p.Thr471Met)
NM_024757.5(EHMT1):c.1414G>A (p.Ala472Thr)
NM_024757.5(EHMT1):c.1433G>A (p.Gly478Glu) rs376787713
NM_024757.5(EHMT1):c.1456_1457delinsAA (p.Ser486Asn) rs1564704339
NM_024757.5(EHMT1):c.145G>T (p.Ala49Ser) rs1372403007
NM_024757.5(EHMT1):c.148G>A (p.Ala50Thr) rs78104547
NM_024757.5(EHMT1):c.149C>T (p.Ala50Val)
NM_024757.5(EHMT1):c.154G>A (p.Gly52Ser)
NM_024757.5(EHMT1):c.1583A>G (p.Lys528Arg)
NM_024757.5(EHMT1):c.159G>T (p.Glu53Asp) rs202066668
NM_024757.5(EHMT1):c.1613A>G (p.Asn538Ser)
NM_024757.5(EHMT1):c.1655G>A (p.Arg552Gln) rs747623277
NM_024757.5(EHMT1):c.1661C>A (p.Thr554Lys)
NM_024757.5(EHMT1):c.1743C>T (p.Arg581=) rs144513373
NM_024757.5(EHMT1):c.176A>G (p.Glu59Gly) rs1422691901
NM_024757.5(EHMT1):c.1792-9C>A rs1554878665
NM_024757.5(EHMT1):c.1814C>T (p.Pro605Leu)
NM_024757.5(EHMT1):c.184G>A (p.Asp62Asn)
NM_024757.5(EHMT1):c.1865A>G (p.Asn622Ser) rs184814386
NM_024757.5(EHMT1):c.1869C>T (p.Asn623=) rs7868455
NM_024757.5(EHMT1):c.188C>T (p.Ala63Val) rs138292762
NM_024757.5(EHMT1):c.193_198dup (p.Ser65_His66dup) rs756643740
NM_024757.5(EHMT1):c.1947G>A (p.Ser649=) rs139206060
NM_024757.5(EHMT1):c.1950C>T (p.Thr650=) rs199839806
NM_024757.5(EHMT1):c.1983G>A (p.Ser661=) rs143204067
NM_024757.5(EHMT1):c.2015G>A (p.Gly672Asp)
NM_024757.5(EHMT1):c.2026G>A (p.Gly676Arg) rs757416132
NM_024757.5(EHMT1):c.2040G>A (p.Ser680=) rs150451099
NM_024757.5(EHMT1):c.204T>C (p.Asn68=) rs3812496
NM_024757.5(EHMT1):c.2096C>T (p.Thr699Met)
NM_024757.5(EHMT1):c.21+10G>C rs1040872282
NM_024757.5(EHMT1):c.217A>G (p.Thr73Ala)
NM_024757.5(EHMT1):c.2181C>T (p.Leu727=) rs377163037
NM_024757.5(EHMT1):c.2186C>T (p.Ser729Leu) rs398124404
NM_024757.5(EHMT1):c.220C>G (p.Gln74Glu)
NM_024757.5(EHMT1):c.224A>G (p.Asp75Gly)
NM_024757.5(EHMT1):c.2280C>T (p.Asp760=) rs372779658
NM_024757.5(EHMT1):c.2347G>T (p.Ala783Ser) rs1564751310
NM_024757.5(EHMT1):c.234G>C (p.Arg78Ser)
NM_024757.5(EHMT1):c.2382+5G>A
NM_024757.5(EHMT1):c.23C>T (p.Ala8Val) rs375391530
NM_024757.5(EHMT1):c.240C>T (p.Asn80=) rs752561133
NM_024757.5(EHMT1):c.2420G>A (p.Arg807Lys) rs1064796750
NM_024757.5(EHMT1):c.248A>G (p.Asp83Gly) rs770735510
NM_024757.5(EHMT1):c.251G>A (p.Gly84Asp) rs142887098
NM_024757.5(EHMT1):c.2595C>T (p.Asp865=) rs780742937
NM_024757.5(EHMT1):c.2596G>A (p.Val866Ile) rs749645029
NM_024757.5(EHMT1):c.2608-3C>T rs1231552364
NM_024757.5(EHMT1):c.2616A>G (p.Gly872=) rs779277999
NM_024757.5(EHMT1):c.2642C>T (p.Thr881Ile) rs797045554
NM_024757.5(EHMT1):c.268C>T (p.Arg90Trp)
NM_024757.5(EHMT1):c.2695A>G (p.Ile899Val) rs144085805
NM_024757.5(EHMT1):c.2712C>T (p.Asn904=)
NM_024757.5(EHMT1):c.271A>T (p.Ile91Leu) rs144949902
NM_024757.5(EHMT1):c.2739G>A (p.Ala913=) rs764507326
NM_024757.5(EHMT1):c.276G>A (p.Ala92=) rs376810828
NM_024757.5(EHMT1):c.2779G>A (p.Ala927Thr)
NM_024757.5(EHMT1):c.2799C>T (p.His933=) rs573774002
NM_024757.5(EHMT1):c.2808C>T (p.Asn936=) rs553009659
NM_024757.5(EHMT1):c.2864T>C (p.Val955Ala)
NM_024757.5(EHMT1):c.2865C>T (p.Val955=) rs749354858
NM_024757.5(EHMT1):c.2873_2876TTCT[1] (p.Ser960fs) rs786205129
NM_024757.5(EHMT1):c.290C>T (p.Ser97Leu)
NM_024757.5(EHMT1):c.2921C>T (p.Thr974Met)
NM_024757.5(EHMT1):c.2922G>A (p.Thr974=) rs748716122
NM_024757.5(EHMT1):c.2927T>G (p.Leu976Arg)
NM_024757.5(EHMT1):c.2937G>A (p.Ala979=) rs564664932
NM_024757.5(EHMT1):c.2948C>A (p.Ser983Tyr)
NM_024757.5(EHMT1):c.2962G>A (p.Ala988Thr)
NM_024757.5(EHMT1):c.2963C>T (p.Ala988Val) rs1554896118
NM_024757.5(EHMT1):c.2970G>T (p.Gln990His) rs143669310
NM_024757.5(EHMT1):c.298G>A (p.Asp100Asn) rs540121859
NM_024757.5(EHMT1):c.2994G>C (p.Ser998=) rs778296046
NM_024757.5(EHMT1):c.3000C>T (p.Pro1000=) rs35943616
NM_024757.5(EHMT1):c.3011G>A (p.Ser1004Asn) rs138283222
NM_024757.5(EHMT1):c.3011G>T (p.Ser1004Ile)
NM_024757.5(EHMT1):c.3016G>A (p.Val1006Met) rs33999936
NM_024757.5(EHMT1):c.3028G>A (p.Val1010Met) rs200237137
NM_024757.5(EHMT1):c.3035+3G>A rs765407306
NM_024757.5(EHMT1):c.3046C>T (p.Arg1016Ter) rs1429360126
NM_024757.5(EHMT1):c.3059G>A (p.Arg1020His) rs376628665
NM_024757.5(EHMT1):c.3082G>A (p.Ala1028Thr)
NM_024757.5(EHMT1):c.3087G>A (p.Val1029=) rs11137244
NM_024757.5(EHMT1):c.311C>T (p.Ala104Val) rs142199482
NM_024757.5(EHMT1):c.3123C>G (p.Val1041=) rs141527497
NM_024757.5(EHMT1):c.3148A>G (p.Met1050Val) rs1564811053
NM_024757.5(EHMT1):c.316C>G (p.Gln106Glu) rs144603232
NM_024757.5(EHMT1):c.3180+10G>A rs113676865
NM_024757.5(EHMT1):c.3180+10G>T rs113676865
NM_024757.5(EHMT1):c.3181-8C>T rs1554896993
NM_024757.5(EHMT1):c.3183C>T (p.Tyr1061=) rs1554896995
NM_024757.5(EHMT1):c.3186C>T (p.Cys1062=)
NM_024757.5(EHMT1):c.3226G>A (p.Gly1076Ser)
NM_024757.5(EHMT1):c.3253G>A (p.Asp1085Asn)
NM_024757.5(EHMT1):c.3294G>T (p.Glu1098Asp)
NM_024757.5(EHMT1):c.32C>T (p.Ala11Val) rs200636818
NM_024757.5(EHMT1):c.3304A>G (p.Ile1102Val) rs752508274
NM_024757.5(EHMT1):c.3321C>T (p.His1107=) rs781426172
NM_024757.5(EHMT1):c.3322G>A (p.Ala1108Thr) rs199780189
NM_024757.5(EHMT1):c.3355G>A (p.Val1119Ile)
NM_024757.5(EHMT1):c.3356T>C (p.Val1119Ala)
NM_024757.5(EHMT1):c.336C>G (p.Asp112Glu) rs757250849
NM_024757.5(EHMT1):c.3374+3G>A
NM_024757.5(EHMT1):c.3375-9A>C rs73578877
NM_024757.5(EHMT1):c.3375G>C (p.Arg1125Ser)
NM_024757.5(EHMT1):c.3377C>T (p.Ala1126Val) rs560251933
NM_024757.5(EHMT1):c.3392A>G (p.Tyr1131Cys)
NM_024757.5(EHMT1):c.33G>A (p.Ala11=) rs754740754
NM_024757.5(EHMT1):c.3400C>T (p.Arg1134Trp)
NM_024757.5(EHMT1):c.3401G>A (p.Arg1134Gln) rs373174786
NM_024757.5(EHMT1):c.3417C>T (p.Gly1139=)
NM_024757.5(EHMT1):c.342T>C (p.Phe114=) rs1554846429
NM_024757.5(EHMT1):c.349A>G (p.Thr117Ala)
NM_024757.5(EHMT1):c.3522C>T (p.Leu1174=) rs748135858
NM_024757.5(EHMT1):c.354T>G (p.Ser118=) rs142271310
NM_024757.5(EHMT1):c.3562G>A (p.Asp1188Asn)
NM_024757.5(EHMT1):c.35G>C (p.Arg12Thr) rs777999570
NM_024757.5(EHMT1):c.35G>T (p.Arg12Met) rs777999570
NM_024757.5(EHMT1):c.3611A>T (p.Glu1204Val) rs759840211
NM_024757.5(EHMT1):c.363C>T (p.Gly121=) rs144352877
NM_024757.5(EHMT1):c.3687C>T (p.Thr1229=) rs201655114
NM_024757.5(EHMT1):c.3688C>T (p.Arg1230Cys)
NM_024757.5(EHMT1):c.3716+4C>T rs375271697
NM_024757.5(EHMT1):c.3716+9C>T rs777993644
NM_024757.5(EHMT1):c.3726T>C (p.Tyr1242=) rs1160822224
NM_024757.5(EHMT1):c.3732G>C (p.Glu1244Asp)
NM_024757.5(EHMT1):c.3735C>T (p.Arg1245=) rs141797498
NM_024757.5(EHMT1):c.3747C>T (p.Ile1249=) rs1554908854
NM_024757.5(EHMT1):c.3758T>C (p.Leu1253Pro)
NM_024757.5(EHMT1):c.376A>G (p.Ile126Val) rs773781896
NM_024757.5(EHMT1):c.3774C>T (p.Cys1258=) rs371136319
NM_024757.5(EHMT1):c.3791G>A (p.Arg1264Gln)
NM_024757.5(EHMT1):c.37G>A (p.Gly13Arg)
NM_024757.5(EHMT1):c.3818G>A (p.Arg1273His) rs1564847357
NM_024757.5(EHMT1):c.3833_3841CCCAGGAGG[3] (p.1278_1280AQE[3])
NM_024757.5(EHMT1):c.3848A>C (p.Glu1283Ala) rs398124408
NM_024757.5(EHMT1):c.3883G>T (p.Ala1295Ser)
NM_024757.5(EHMT1):c.3884C>T (p.Ala1295Val) rs1225363386
NM_024757.5(EHMT1):c.3894A>G (p.Leu1298=) rs886063743
NM_024757.5(EHMT1):c.38G>A (p.Gly13Glu) rs925532395
NM_024757.5(EHMT1):c.390G>T (p.Pro130=) rs144323841
NM_024757.5(EHMT1):c.396_397delinsTG (p.Gln133Glu) rs1554846569
NM_024757.5(EHMT1):c.405G>T (p.Gln135His) rs200982880
NM_024757.5(EHMT1):c.432C>T (p.Ala144=) rs139461232
NM_024757.5(EHMT1):c.437C>T (p.Ser146Leu) rs142652443
NM_024757.5(EHMT1):c.438G>A (p.Ser146=) rs151008340
NM_024757.5(EHMT1):c.444_445inv (p.Gly149Ser)
NM_024757.5(EHMT1):c.470G>A (p.Gly157Glu) rs1554846686
NM_024757.5(EHMT1):c.480C>T (p.Gly160=) rs150135875
NM_024757.5(EHMT1):c.498C>T (p.Ser166=) rs146037252
NM_024757.5(EHMT1):c.499G>A (p.Ala167Thr) rs141282876
NM_024757.5(EHMT1):c.500C>A (p.Ala167Asp)
NM_024757.5(EHMT1):c.512C>T (p.Thr171Met)
NM_024757.5(EHMT1):c.514C>T (p.Pro172Ser)
NM_024757.5(EHMT1):c.526C>G (p.Pro176Ala)
NM_024757.5(EHMT1):c.526C>T (p.Pro176Ser) rs34704821
NM_024757.5(EHMT1):c.538G>T (p.Gly180Trp)
NM_024757.5(EHMT1):c.546G>T (p.Gly182=) rs767742300
NM_024757.5(EHMT1):c.576G>A (p.Pro192=) rs574514175
NM_024757.5(EHMT1):c.581C>T (p.Pro194Leu) rs35570782
NM_024757.5(EHMT1):c.586G>A (p.Ala196Thr)
NM_024757.5(EHMT1):c.610C>T (p.Arg204Cys) rs773281923
NM_024757.5(EHMT1):c.624G>A (p.Pro208=) rs759629407
NM_024757.5(EHMT1):c.674G>A (p.Arg225Gln)
NM_024757.5(EHMT1):c.676G>A (p.Glu226Lys) rs1554852591
NM_024757.5(EHMT1):c.70G>A (p.Glu24Lys) rs373269573
NM_024757.5(EHMT1):c.737G>A (p.Arg246Gln) rs144871446
NM_024757.5(EHMT1):c.737G>C (p.Arg246Pro)
NM_024757.5(EHMT1):c.755C>G (p.Pro252Arg)
NM_024757.5(EHMT1):c.770A>G (p.His257Arg)
NM_024757.5(EHMT1):c.85+9G>A rs566701810
NM_024757.5(EHMT1):c.900T>C (p.Pro300=) rs1554858785
NM_024757.5(EHMT1):c.905A>G (p.Lys302Arg) rs565065320
NM_024757.5(EHMT1):c.92C>T (p.Pro31Leu)
NM_024757.5(EHMT1):c.932C>T (p.Thr311Met) rs142727972
NM_024757.5(EHMT1):c.95T>C (p.Met32Thr) rs1564627371
NM_024757.5(EHMT1):c.985G>C (p.Glu329Gln) rs538516467

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.