ClinVar Miner

List of variants in gene EP300 reported as uncertain significance

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 140
Download table as spreadsheet
HGVS dbSNP
NM_001429.3(EP300):c.*40_*44delCTCTT rs751376755
NM_001429.3(EP300):c.*552G>A rs886057574
NM_001429.3(EP300):c.*559A>G rs886057575
NM_001429.3(EP300):c.*591_*592dupAA rs60283061
NM_001429.3(EP300):c.*592delA rs60283061
NM_001429.3(EP300):c.*592dupA rs60283061
NM_001429.3(EP300):c.*745delG rs532524940
NM_001429.3(EP300):c.*753T>C rs886057576
NM_001429.3(EP300):c.*785_*786delTT rs886057577
NM_001429.3(EP300):c.*844G>A rs532999218
NM_001429.3(EP300):c.*921dupC rs1161532977
NM_001429.3(EP300):c.*922A>C rs146984033
NM_001429.3(EP300):c.*922_*930delACTCACACAinsC rs1555912614
NM_001429.3(EP300):c.*922_*930delACTCACACAinsCCC rs1555912614
NM_001429.3(EP300):c.*922_*932delACTCACACACAinsC rs886057580
NM_001429.3(EP300):c.*922_*932delACTCACACACAinsCCC rs886057580
NM_001429.3(EP300):c.*922_*938del17insC rs886057581
NM_001429.3(EP300):c.*922_*942del21insC rs1555912616
NM_001429.3(EP300):c.*922_*942del21insCC rs1555912616
NM_001429.3(EP300):c.*924T>A rs149250603
NM_001429.3(EP300):c.*924T>C rs149250603
NM_001429.3(EP300):c.*926A>C rs140429533
NM_001429.3(EP300):c.*928A>C rs142198417
NM_001429.3(EP300):c.*930A>C rs879634387
NM_001429.3(EP300):c.*932A>C rs886057585
NM_001429.3(EP300):c.*938A>C rs886057586
NM_001429.3(EP300):c.*942A>C rs754018515
NM_001429.3(EP300):c.*962_*967delACACAC rs59721178
NM_001429.3(EP300):c.*964_*967dupACAC rs59721178
NM_001429.3(EP300):c.*966_*967delAC rs59721178
NM_001429.3(EP300):c.*966_*967dupAC rs59721178
NM_001429.3(EP300):c.*968T>A rs3210590
NM_001429.3(EP300):c.-139A>G rs886057554
NM_001429.3(EP300):c.-149G>A rs553861147
NM_001429.3(EP300):c.-192C>T rs763177046
NM_001429.3(EP300):c.-212C>T rs886057553
NM_001429.3(EP300):c.-237C>T rs886057552
NM_001429.3(EP300):c.-238T>C rs886057551
NM_001429.3(EP300):c.-363A>C rs886057550
NM_001429.3(EP300):c.102C>G (p.Gly34=) rs750031887
NM_001429.3(EP300):c.103T>G (p.Ser35Ala) rs546292445
NM_001429.3(EP300):c.1302C>T (p.Pro434=) rs199901345
NM_001429.3(EP300):c.1316A>G (p.Asn439Ser)
NM_001429.3(EP300):c.1442C>T (p.Pro481Leu)
NM_001429.3(EP300):c.1453C>A (p.Gln485Lys)
NM_001429.3(EP300):c.1516A>G (p.Met506Val) rs886057556
NM_001429.3(EP300):c.1529-8T>C rs587783621
NM_001429.3(EP300):c.1540A>G (p.Met514Val) rs765266179
NM_001429.3(EP300):c.1572G>A (p.Thr524=) rs746398873
NM_001429.3(EP300):c.1573C>T (p.Pro525Ser) rs886042427
NM_001429.3(EP300):c.157T>C (p.Leu53=) rs147566983
NM_001429.3(EP300):c.1627A>G (p.Met543Val)
NM_001429.3(EP300):c.1710G>A (p.Gln570=) rs886043092
NM_001429.3(EP300):c.1784C>T (p.Pro595Leu) rs886057557
NM_001429.3(EP300):c.1989C>T (p.Gly663=)
NM_001429.3(EP300):c.2005A>G (p.Met669Val) rs749541256
NM_001429.3(EP300):c.2019T>C (p.Pro673=) rs2230110
NM_001429.3(EP300):c.2027G>C (p.Gly676Ala) rs1555908795
NM_001429.3(EP300):c.2053+4A>T rs1057518889
NM_001429.3(EP300):c.2131+13A>T rs886057558
NM_001429.3(EP300):c.2174T>C (p.Ile725Thr) rs375822328
NM_001429.3(EP300):c.2242-6_2242-4delTTT rs747710183
NM_001429.3(EP300):c.2252A>G (p.Tyr751Cys)
NM_001429.3(EP300):c.2348C>T (p.Ala783Val) rs755619355
NM_001429.3(EP300):c.2393G>A (p.Ser798Asn) rs781326261
NM_001429.3(EP300):c.2419A>G (p.Ile807Val) rs201054979
NM_001429.3(EP300):c.2536C>T (p.Pro846Ser) rs886057560
NM_001429.3(EP300):c.2580A>G (p.Pro860=) rs752536439
NM_001429.3(EP300):c.2629G>A (p.Ala877Thr) rs772289466
NM_001429.3(EP300):c.2787A>G (p.Ala929=) rs143690368
NM_001429.3(EP300):c.2931G>C (p.Lys977Asn) rs749225428
NM_001429.3(EP300):c.2998-12G>A rs115849119
NM_001429.3(EP300):c.307G>A (p.Val103Ile)
NM_001429.3(EP300):c.3105C>T (p.Thr1035=) rs150498069
NM_001429.3(EP300):c.3143-4delT rs757931697
NM_001429.3(EP300):c.3143-7T>G rs778277906
NM_001429.3(EP300):c.3330G>T (p.Gln1110His) rs374163115
NM_001429.3(EP300):c.3591-6C>T rs368437789
NM_001429.3(EP300):c.359G>A (p.Ser120Asn)
NM_001429.3(EP300):c.3665C>A (p.Pro1222His) rs7285319
NM_001429.3(EP300):c.3750C>G (p.Cys1250Trp)
NM_001429.3(EP300):c.3866C>T (p.Ser1289Phe) rs1555910822
NM_001429.3(EP300):c.3913C>T (p.Arg1305Cys) rs1555911073
NM_001429.3(EP300):c.4214G>A (p.Arg1405His) rs138855106
NM_001429.3(EP300):c.4331A>G (p.Asp1444Gly)
NM_001429.3(EP300):c.4347T>C (p.His1449=) rs137986257
NM_001429.3(EP300):c.444G>C (p.Thr148=) rs376779611
NM_001429.3(EP300):c.4505C>T (p.Pro1502Leu) rs1555911573
NM_001429.3(EP300):c.4529C>G (p.Pro1510Arg)
NM_001429.3(EP300):c.4598C>A (p.Thr1533Asn) rs886057561
NM_001429.3(EP300):c.471A>G (p.Pro157=)
NM_001429.3(EP300):c.4724A>G (p.Asn1575Ser) rs144547088
NM_001429.3(EP300):c.4783T>G (p.Phe1595Val) rs1057517732
NM_001429.3(EP300):c.4908C>T (p.Asp1636=) rs886057562
NM_001429.3(EP300):c.495G>T (p.Met165Ile) rs1343346566
NM_001429.3(EP300):c.5028T>C (p.His1676=) rs747152661
NM_001429.3(EP300):c.5061+10G>A rs78432056
NM_001429.3(EP300):c.5061+7A>G rs886057563
NM_001429.3(EP300):c.513G>A (p.Ala171=) rs146041458
NM_001429.3(EP300):c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC (p.Thr1724Alafs) rs1555912112
NM_001429.3(EP300):c.5172C>A (p.Thr1724=) rs142330184
NM_001429.3(EP300):c.5179C>T (p.Pro1727Ser) rs886057564
NM_001429.3(EP300):c.5262A>G (p.Ser1754=) rs886057565
NM_001429.3(EP300):c.536C>G (p.Ala179Gly) rs1064797288
NM_001429.3(EP300):c.5422A>C (p.Asn1808His)
NM_001429.3(EP300):c.5556_5564delTGCCACTCC (p.Ala1853_Pro1855del) rs1555912151
NM_001429.3(EP300):c.5572C>G (p.Pro1858Ala) rs398123610
NM_001429.3(EP300):c.5604G>A (p.Thr1868=) rs200795114
NM_001429.3(EP300):c.5644A>G (p.Ser1882Gly) rs769796204
NM_001429.3(EP300):c.5683C>T (p.Pro1895Ser)
NM_001429.3(EP300):c.569A>G (p.Gln190Arg)
NM_001429.3(EP300):c.5711A>C (p.Gln1904Pro) rs140187237
NM_001429.3(EP300):c.574A>T (p.Met192Leu) rs771650739
NM_001429.3(EP300):c.586A>G (p.Ile196Val) rs148693910
NM_001429.3(EP300):c.5889C>T (p.Ala1963=) rs886057566
NM_001429.3(EP300):c.5957C>T (p.Pro1986Leu) rs144626200
NM_001429.3(EP300):c.6091C>T (p.Pro2031Ser) rs199650847
NM_001429.3(EP300):c.615G>A (p.Met205Ile) rs766306644
NM_001429.3(EP300):c.6289C>G (p.Pro2097Ala) rs200189212
NM_001429.3(EP300):c.6315C>T (p.Gly2105=) rs528866215
NM_001429.3(EP300):c.6358G>T (p.Gly2120Cys) rs886057567
NM_001429.3(EP300):c.6374A>G (p.His2125Arg) rs886057568
NM_001429.3(EP300):c.6395A>T (p.Asn2132Ile) rs886057569
NM_001429.3(EP300):c.6437C>A (p.Pro2146His) rs745528077
NM_001429.3(EP300):c.6516C>A (p.His2172Gln) rs139382344
NM_001429.3(EP300):c.6526C>T (p.Pro2176Ser) rs779543207
NM_001429.3(EP300):c.667C>G (p.Leu223Val) rs746720991
NM_001429.3(EP300):c.6713A>G (p.Asn2238Ser) rs767335677
NM_001429.3(EP300):c.684C>G (p.Pro228=) rs749187279
NM_001429.3(EP300):c.7017C>T (p.His2339=) rs759571982
NM_001429.3(EP300):c.7136A>G (p.Asn2379Ser) rs886057571
NM_001429.3(EP300):c.7221A>G (p.Ser2407=) rs964396023
NM_001429.3(EP300):c.726T>A (p.Leu242=) rs886057555
NM_001429.3(EP300):c.739A>G (p.Met247Val) rs147583157
NM_001429.3(EP300):c.781C>T (p.Pro261Ser) rs753462821
NM_001429.3(EP300):c.871A>G (p.Lys291Glu) rs1555907094
NM_001429.4(EP300):c.2503G>A (p.Val835Ile)
NM_001429.4(EP300):c.363G>C (p.Met121Ile)
NM_001429.4(EP300):c.5966T>G (p.Met1989Arg)
NM_001429.4(EP300):c.7072C>G (p.Pro2358Ala)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.