ClinVar Miner

List of variants in gene EP300 reported by Ambry Genetics

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 11
Download table as spreadsheet
NM_001429.3(EP300):c.1066C>T (p.Gln356Ter) rs1555907278
NM_001429.3(EP300):c.1508dup (p.Met503Ilefs) rs1555907749
NM_001429.3(EP300):c.272delC (p.Pro91Leufs) rs1555905780
NM_001429.3(EP300):c.4026-2A>G rs1555911098
NM_001429.3(EP300):c.4363C>T (p.Gln1455Ter) rs1555911313
NM_001429.3(EP300):c.4579_4589del11 (p.Arg1527Glyfs) rs1555911580
NM_001429.3(EP300):c.4783T>G (p.Phe1595Val) rs1057517732
NM_001429.3(EP300):c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC (p.Thr1724Alafs) rs1555912112
NM_001429.3(EP300):c.5556_5564delTGCCACTCC (p.Ala1853_Pro1855del) rs1555912151
NM_001429.3(EP300):c.6091C>T (p.Pro2031Ser) rs199650847
NM_001429.3(EP300):c.871A>G (p.Lys291Glu) rs1555907094

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.