ClinVar Miner

List of variants in gene FASN reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 331
Download table as spreadsheet
HGVS dbSNP
NM_004104.4(FASN):c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT rs1555669393
NM_004104.5(FASN):c.1005C>T (p.Ala335=) rs776934105
NM_004104.5(FASN):c.1018G>T (p.Ala340Ser) rs1469173192
NM_004104.5(FASN):c.1024G>T (p.Ala342Ser)
NM_004104.5(FASN):c.1045G>A (p.Glu349Lys)
NM_004104.5(FASN):c.106G>A (p.Asp36Asn) rs754942049
NM_004104.5(FASN):c.1104G>A (p.Ala368=) rs373141943
NM_004104.5(FASN):c.1114G>A (p.Gly372Arg) rs1555668921
NM_004104.5(FASN):c.1118G>A (p.Arg373Gln)
NM_004104.5(FASN):c.1126G>T (p.Val376Leu)
NM_004104.5(FASN):c.1147G>A (p.Val383Ile) rs764001564
NM_004104.5(FASN):c.1213A>G (p.Arg405Gly)
NM_004104.5(FASN):c.1227G>C (p.Gln409His) rs202158849
NM_004104.5(FASN):c.1229C>T (p.Pro410Leu)
NM_004104.5(FASN):c.1230G>A (p.Pro410=) rs376870564
NM_004104.5(FASN):c.1236C>T (p.Pro412=) rs558030339
NM_004104.5(FASN):c.1237G>A (p.Ala413Thr) rs373548684
NM_004104.5(FASN):c.1244C>T (p.Ala415Val)
NM_004104.5(FASN):c.1274G>A (p.Arg425Gln)
NM_004104.5(FASN):c.128_130delinsATT (p.Gly43_Leu44delinsAspPhe) rs1555669729
NM_004104.5(FASN):c.1291C>T (p.Pro431Ser)
NM_004104.5(FASN):c.1300G>A (p.Val434Met)
NM_004104.5(FASN):c.1321G>A (p.Gly441Ser) rs1332913108
NM_004104.5(FASN):c.1346C>G (p.Ala449Gly) rs1025708321
NM_004104.5(FASN):c.1372G>A (p.Ala458Thr) rs146838277
NM_004104.5(FASN):c.1374G>A (p.Ala458=) rs748235548
NM_004104.5(FASN):c.1384G>A (p.Ala462Thr) rs141275719
NM_004104.5(FASN):c.1402C>T (p.Arg468Cys) rs1033326712
NM_004104.5(FASN):c.1403G>A (p.Arg468His)
NM_004104.5(FASN):c.1411G>A (p.Ala471Thr)
NM_004104.5(FASN):c.1436G>T (p.Gly479Val) rs149982597
NM_004104.5(FASN):c.1455G>A (p.Val485=) rs190389710
NM_004104.5(FASN):c.1458C>T (p.Pro486=) rs750411778
NM_004104.5(FASN):c.145C>T (p.Arg49Trp) rs774656123
NM_004104.5(FASN):c.1465G>A (p.Glu489Lys) rs62642482
NM_004104.5(FASN):c.1468C>T (p.Arg490Cys) rs533081221
NM_004104.5(FASN):c.1485C>T (p.Ile495=) rs1192562552
NM_004104.5(FASN):c.1548C>T (p.Phe516=) rs145311183
NM_004104.5(FASN):c.1568C>T (p.Ser523Phe) rs1555668714
NM_004104.5(FASN):c.1570G>A (p.Asp524Asn) rs147394389
NM_004104.5(FASN):c.1577C>T (p.Ala526Val) rs1449518570
NM_004104.5(FASN):c.1579G>A (p.Val527Met)
NM_004104.5(FASN):c.1591G>A (p.Gly531Ser)
NM_004104.5(FASN):c.1604C>T (p.Ser535Leu)
NM_004104.5(FASN):c.1627G>A (p.Glu543Lys) rs202040392
NM_004104.5(FASN):c.1631G>A (p.Ser544Asn)
NM_004104.5(FASN):c.1669A>T (p.Thr557Ser)
NM_004104.5(FASN):c.1680+10A>C rs767604997
NM_004104.5(FASN):c.1701G>A (p.Leu567=) rs547573052
NM_004104.5(FASN):c.1712G>A (p.Gly571Glu)
NM_004104.5(FASN):c.1789G>A (p.Glu597Lys)
NM_004104.5(FASN):c.1798G>A (p.Val600Ile)
NM_004104.5(FASN):c.1850C>T (p.Pro617Leu) rs45444391
NM_004104.5(FASN):c.1854C>T (p.Gly618=) rs901518038
NM_004104.5(FASN):c.1907C>T (p.Pro636Leu)
NM_004104.5(FASN):c.1968C>T (p.Ala656=) rs45540245
NM_004104.5(FASN):c.2022G>A (p.Glu674=) rs1336316361
NM_004104.5(FASN):c.2026C>T (p.Arg676Trp) rs759454700
NM_004104.5(FASN):c.2034C>T (p.Gly678=) rs148923081
NM_004104.5(FASN):c.2064G>A (p.Glu688=) rs372165257
NM_004104.5(FASN):c.2100+10T>C rs1555668292
NM_004104.5(FASN):c.2101G>C (p.Val701Leu) rs201027447
NM_004104.5(FASN):c.2107C>T (p.Arg703Trp) rs768238548
NM_004104.5(FASN):c.2155G>A (p.Glu719Lys) rs12946178
NM_004104.5(FASN):c.2187G>A (p.Thr729=) rs17848930
NM_004104.5(FASN):c.2189C>T (p.Ser730Phe)
NM_004104.5(FASN):c.221C>T (p.Thr74Met)
NM_004104.5(FASN):c.2269G>A (p.Val757Met) rs1555668215
NM_004104.5(FASN):c.2304+3A>G rs1568113090
NM_004104.5(FASN):c.2311C>A (p.Leu771Met) rs202206277
NM_004104.5(FASN):c.2361G>A (p.Lys787=) rs763379489
NM_004104.5(FASN):c.2400C>T (p.Ile800=) rs747222387
NM_004104.5(FASN):c.2428G>A (p.Ala810Thr)
NM_004104.5(FASN):c.2449C>T (p.Pro817Ser)
NM_004104.5(FASN):c.2453C>G (p.Pro818Arg) rs774528608
NM_004104.5(FASN):c.249G>A (p.Leu83=) rs147764458
NM_004104.5(FASN):c.2539G>A (p.Ala847Thr) rs762057164
NM_004104.5(FASN):c.2555A>G (p.Asn852Ser)
NM_004104.5(FASN):c.2593G>A (p.Asp865Asn) rs199546508
NM_004104.5(FASN):c.2594-4G>A rs761310825
NM_004104.5(FASN):c.2605G>A (p.Glu869Lys)
NM_004104.5(FASN):c.2650G>A (p.Val884Ile) rs750385551
NM_004104.5(FASN):c.2661C>T (p.Pro887=) rs564814781
NM_004104.5(FASN):c.2704G>A (p.Ala902Thr) rs376556250
NM_004104.5(FASN):c.2721C>T (p.Val907=) rs140477777
NM_004104.5(FASN):c.2722G>A (p.Glu908Lys)
NM_004104.5(FASN):c.2722G>C (p.Glu908Gln)
NM_004104.5(FASN):c.2757G>A (p.Leu919=) rs147904451
NM_004104.5(FASN):c.2778C>G (p.Pro926=) rs369562322
NM_004104.5(FASN):c.2815G>A (p.Glu939Lys) rs142371324
NM_004104.5(FASN):c.2825G>T (p.Arg942Leu)
NM_004104.5(FASN):c.2832C>T (p.Phe944=) rs755643560
NM_004104.5(FASN):c.2833G>A (p.Glu945Lys) rs1568112060
NM_004104.5(FASN):c.2899A>C (p.Arg967=) rs936284030
NM_004104.5(FASN):c.2916G>A (p.Pro972=)
NM_004104.5(FASN):c.2937C>T (p.Pro979=) rs62642479
NM_004104.5(FASN):c.2945C>T (p.Pro982Leu)
NM_004104.5(FASN):c.2957C>T (p.Ala986Val) rs750638732
NM_004104.5(FASN):c.2984G>A (p.Arg995His) rs376650647
NM_004104.5(FASN):c.3006C>T (p.Gly1002=) rs1366161093
NM_004104.5(FASN):c.3033C>T (p.Ala1011=) rs149933063
NM_004104.5(FASN):c.3116T>C (p.Leu1039Pro)
NM_004104.5(FASN):c.3133G>A (p.Gly1045Ser)
NM_004104.5(FASN):c.3186C>T (p.His1062=) rs45493497
NM_004104.5(FASN):c.3232G>A (p.Val1078Met) rs146146551
NM_004104.5(FASN):c.3241A>G (p.Ser1081Gly)
NM_004104.5(FASN):c.329G>C (p.Gly110Ala) rs1401029858
NM_004104.5(FASN):c.3306C>G (p.Ala1102=) rs34179714
NM_004104.5(FASN):c.3309G>A (p.Pro1103=) rs555372336
NM_004104.5(FASN):c.3330G>C (p.Gln1110His) rs755685212
NM_004104.5(FASN):c.3337A>G (p.Ile1113Val) rs201182683
NM_004104.5(FASN):c.3345G>C (p.Glu1115Asp) rs1481274971
NM_004104.5(FASN):c.3361C>T (p.Pro1121Ser)
NM_004104.5(FASN):c.3427+8C>T rs565758653
NM_004104.5(FASN):c.3511C>T (p.Arg1171Trp) rs754866865
NM_004104.5(FASN):c.3523C>A (p.Gln1175Lys)
NM_004104.5(FASN):c.3539G>A (p.Arg1180Gln)
NM_004104.5(FASN):c.3548C>T (p.Ser1183Leu)
NM_004104.5(FASN):c.3549G>A (p.Ser1183=) rs72863336
NM_004104.5(FASN):c.3557G>T (p.Cys1186Phe) rs199670165
NM_004104.5(FASN):c.3578A>G (p.Asn1193Ser) rs139346033
NM_004104.5(FASN):c.3596C>T (p.Ala1199Val)
NM_004104.5(FASN):c.3597_3608del (p.Val1201_Gln1204del) rs1555667489
NM_004104.5(FASN):c.3623A>G (p.Lys1208Arg) rs761471160
NM_004104.5(FASN):c.3636C>T (p.Asp1212=) rs144326994
NM_004104.5(FASN):c.3665C>G (p.Pro1222Arg)
NM_004104.5(FASN):c.3669A>C (p.Ala1223=) rs45444299
NM_004104.5(FASN):c.3682C>T (p.Leu1228=) rs146800506
NM_004104.5(FASN):c.3708C>T (p.Pro1236=) rs773577585
NM_004104.5(FASN):c.3738G>T (p.Leu1246=) rs769818274
NM_004104.5(FASN):c.3747C>T (p.His1249=) rs62642477
NM_004104.5(FASN):c.3748G>A (p.Gly1250Ser)
NM_004104.5(FASN):c.3764G>A (p.Arg1255His) rs376976258
NM_004104.5(FASN):c.3794T>G (p.Leu1265Arg) rs1568110115
NM_004104.5(FASN):c.3829C>G (p.Pro1277Ala) rs764159372
NM_004104.5(FASN):c.382G>A (p.Val128Met) rs146811868
NM_004104.5(FASN):c.3888G>T (p.Gln1296His) rs778370442
NM_004104.5(FASN):c.3898G>A (p.Ala1300Thr) rs746365737
NM_004104.5(FASN):c.3974C>T (p.Pro1325Leu) rs150915750
NM_004104.5(FASN):c.3975G>A (p.Pro1325=) rs374185580
NM_004104.5(FASN):c.4045C>T (p.Arg1349Trp) rs760506156
NM_004104.5(FASN):c.4046G>A (p.Arg1349Gln)
NM_004104.5(FASN):c.4059C>T (p.Leu1353=) rs761723139
NM_004104.5(FASN):c.4108G>A (p.Gly1370Ser) rs372089187
NM_004104.5(FASN):c.4122+5G>A rs750312479
NM_004104.5(FASN):c.4123-10G>A rs573497934
NM_004104.5(FASN):c.4128G>A (p.Ala1376=) rs201599707
NM_004104.5(FASN):c.4138C>T (p.Leu1380Phe) rs769124217
NM_004104.5(FASN):c.4175A>G (p.Lys1392Arg)
NM_004104.5(FASN):c.4188C>T (p.Tyr1396=) rs45506801
NM_004104.5(FASN):c.4196C>T (p.Thr1399Met)
NM_004104.5(FASN):c.4223C>T (p.Pro1408Leu) rs1438367361
NM_004104.5(FASN):c.4224G>A (p.Pro1408=) rs778737573
NM_004104.5(FASN):c.4303G>A (p.Glu1435Lys)
NM_004104.5(FASN):c.4308_4309CT[1] (p.Ser1437fs) rs1555667112
NM_004104.5(FASN):c.4337_4339del (p.Ile1446del) rs750351947
NM_004104.5(FASN):c.4343G>C (p.Cys1448Ser) rs1421575793
NM_004104.5(FASN):c.4382G>A (p.Arg1461His)
NM_004104.5(FASN):c.4385G>A (p.Arg1462Gln)
NM_004104.5(FASN):c.4393G>A (p.Gly1465Ser)
NM_004104.5(FASN):c.4429C>T (p.Leu1477Phe)
NM_004104.5(FASN):c.4443C>T (p.Ser1481=) rs371374591
NM_004104.5(FASN):c.4455G>A (p.Glu1485=) rs181585755
NM_004104.5(FASN):c.4466G>A (p.Gly1489Asp) rs368486805
NM_004104.5(FASN):c.4477C>G (p.Leu1493Val) rs1451796502
NM_004104.5(FASN):c.4522G>A (p.Asp1508Asn) rs375080347
NM_004104.5(FASN):c.4524C>T (p.Asp1508=) rs529962341
NM_004104.5(FASN):c.4525G>A (p.Gly1509Arg)
NM_004104.5(FASN):c.4565-3_4565-1dup rs764277201
NM_004104.5(FASN):c.4578G>A (p.Glu1526=) rs45483502
NM_004104.5(FASN):c.4581G>A (p.Pro1527=) rs373700033
NM_004104.5(FASN):c.4606C>G (p.Leu1536Val)
NM_004104.5(FASN):c.4617G>C (p.Gly1539=) rs143566258
NM_004104.5(FASN):c.4632C>T (p.Ile1544=) rs751028218
NM_004104.5(FASN):c.463A>G (p.Ile155Val) rs548430047
NM_004104.5(FASN):c.4650G>A (p.Ser1550=) rs779703690
NM_004104.5(FASN):c.4694C>T (p.Thr1565Met) rs1294023345
NM_004104.5(FASN):c.4933G>T (p.Ala1645Ser) rs1568108097
NM_004104.5(FASN):c.4956C>T (p.Tyr1652=) rs776323721
NM_004104.5(FASN):c.4981G>A (p.Val1661Met)
NM_004104.5(FASN):c.4993G>T (p.Val1665Leu) rs1270962378
NM_004104.5(FASN):c.4996C>T (p.Arg1666Cys) rs377037839
NM_004104.5(FASN):c.4997G>A (p.Arg1666His) rs571435935
NM_004104.5(FASN):c.4999C>T (p.Pro1667Ser) rs45557233
NM_004104.5(FASN):c.5009C>T (p.Thr1670Met)
NM_004104.5(FASN):c.5031G>A (p.Ser1677=) rs373883359
NM_004104.5(FASN):c.5056G>A (p.Ala1686Thr) rs778912716
NM_004104.5(FASN):c.5062G>A (p.Ala1688Thr) rs368428251
NM_004104.5(FASN):c.5067C>T (p.Leu1689=) rs1555666767
NM_004104.5(FASN):c.5075G>A (p.Gly1692Asp)
NM_004104.5(FASN):c.5082C>T (p.Arg1694=) rs186001146
NM_004104.5(FASN):c.5083G>A (p.Val1695Ile) rs111918281
NM_004104.5(FASN):c.5094C>T (p.Thr1698=) rs576100145
NM_004104.5(FASN):c.5095G>C (p.Val1699Leu)
NM_004104.5(FASN):c.5103G>A (p.Ser1701=) rs752285807
NM_004104.5(FASN):c.5104G>C (p.Ala1702Pro)
NM_004104.5(FASN):c.5113C>T (p.Arg1705Trp)
NM_004104.5(FASN):c.5114G>A (p.Arg1705Gln) rs534878599
NM_004104.5(FASN):c.5117C>T (p.Ala1706Val)
NM_004104.5(FASN):c.5140C>G (p.Gln1714Glu)
NM_004104.5(FASN):c.5145C>T (p.Leu1715=) rs369836055
NM_004104.5(FASN):c.5177C>T (p.Thr1726Ile) rs1206712630
NM_004104.5(FASN):c.5184C>T (p.Phe1728=) rs140573172
NM_004104.5(FASN):c.5220C>T (p.Gly1740=) rs202024354
NM_004104.5(FASN):c.5259G>A (p.Leu1753=) rs75603975
NM_004104.5(FASN):c.5269G>A (p.Val1757Met)
NM_004104.5(FASN):c.5319C>T (p.Asp1773=) rs759805514
NM_004104.5(FASN):c.5335C>G (p.Pro1779Ala) rs753834341
NM_004104.5(FASN):c.5336C>T (p.Pro1779Leu) rs2229426
NM_004104.5(FASN):c.5337G>A (p.Pro1779=) rs115708196
NM_004104.5(FASN):c.5341G>A (p.Gly1781Ser) rs373722639
NM_004104.5(FASN):c.53A>G (p.Asn18Ser) rs1555669844
NM_004104.5(FASN):c.5404G>A (p.Glu1802Lys) rs764921764
NM_004104.5(FASN):c.5412T>A (p.Ser1804Arg) rs140221463
NM_004104.5(FASN):c.5417A>G (p.Asp1806Gly)
NM_004104.5(FASN):c.5456G>A (p.Arg1819Gln)
NM_004104.5(FASN):c.5456G>T (p.Arg1819Leu) rs200377258
NM_004104.5(FASN):c.5470C>T (p.Arg1824Trp) rs144212251
NM_004104.5(FASN):c.5495A>G (p.His1832Arg) rs559153593
NM_004104.5(FASN):c.5527A>G (p.Met1843Val)
NM_004104.5(FASN):c.552C>T (p.Ile184=) rs143728093
NM_004104.5(FASN):c.5535A>G (p.Gln1845=) rs2229421
NM_004104.5(FASN):c.555G>A (p.Val185=) rs556347422
NM_004104.5(FASN):c.5573C>A (p.Ala1858Glu)
NM_004104.5(FASN):c.5573C>T (p.Ala1858Val) rs376946680
NM_004104.5(FASN):c.5574G>A (p.Ala1858=) rs145542725
NM_004104.5(FASN):c.5576A>G (p.Glu1859Gly)
NM_004104.5(FASN):c.5591T>C (p.Val1864Ala)
NM_004104.5(FASN):c.5648C>T (p.Ala1883Val)
NM_004104.5(FASN):c.5662A>G (p.Ile1888Val) rs2228307
NM_004104.5(FASN):c.5668G>A (p.Ala1890Thr)
NM_004104.5(FASN):c.5670T>C (p.Ala1890=) rs150604140
NM_004104.5(FASN):c.5703G>A (p.Ala1901=) rs776274688
NM_004104.5(FASN):c.5767+8G>A rs369401110
NM_004104.5(FASN):c.5767+9G>A rs140072817
NM_004104.5(FASN):c.5768-4G>A rs369059351
NM_004104.5(FASN):c.5789G>A (p.Arg1930His)
NM_004104.5(FASN):c.5791C>T (p.Arg1931Trp)
NM_004104.5(FASN):c.5792G>A (p.Arg1931Gln) rs148840593
NM_004104.5(FASN):c.5801G>A (p.Arg1934His) rs200897153
NM_004104.5(FASN):c.5809G>A (p.Val1937Ile) rs17848945
NM_004104.5(FASN):c.5858G>A (p.Arg1953Gln) rs17848946
NM_004104.5(FASN):c.5872G>A (p.Glu1958Lys) rs145688025
NM_004104.5(FASN):c.5902G>A (p.Val1968Ile) rs148731010
NM_004104.5(FASN):c.5904C>G (p.Val1968=) rs1555666235
NM_004104.5(FASN):c.591C>T (p.Ser197=) rs141843553
NM_004104.5(FASN):c.592G>A (p.Val198Met)
NM_004104.5(FASN):c.5953C>T (p.Pro1985Ser)
NM_004104.5(FASN):c.6011+10G>A rs200646707
NM_004104.5(FASN):c.6012-10G>A rs45491595
NM_004104.5(FASN):c.6014T>C (p.Val2005Ala) rs2228306
NM_004104.5(FASN):c.6030C>T (p.Cys2010=) rs373268994
NM_004104.5(FASN):c.605G>T (p.Arg202Met)
NM_004104.5(FASN):c.6086C>T (p.Ala2029Val) rs139545909
NM_004104.5(FASN):c.6090A>G (p.Gly2030=) rs755581631
NM_004104.5(FASN):c.6118G>A (p.Ala2040Thr) rs150748779
NM_004104.5(FASN):c.6118G>T (p.Ala2040Ser) rs150748779
NM_004104.5(FASN):c.6145C>T (p.Arg2049Trp)
NM_004104.5(FASN):c.6155G>C (p.Gly2052Ala)
NM_004104.5(FASN):c.6163+8C>G rs368725295
NM_004104.5(FASN):c.6164-8C>G rs76966965
NM_004104.5(FASN):c.6172G>A (p.Val2058Met) rs752767411
NM_004104.5(FASN):c.6189C>T (p.Ile2063=) rs776553835
NM_004104.5(FASN):c.6218T>C (p.Met2073Thr)
NM_004104.5(FASN):c.6229G>A (p.Asp2077Asn) rs141935205
NM_004104.5(FASN):c.6238G>A (p.Val2080Ile) rs766446511
NM_004104.5(FASN):c.624C>T (p.Pro208=) rs45624241
NM_004104.5(FASN):c.625G>C (p.Glu209Gln) rs1231782441
NM_004104.5(FASN):c.6307C>T (p.His2103Tyr) rs200347376
NM_004104.5(FASN):c.6318G>A (p.Leu2106=) rs146934927
NM_004104.5(FASN):c.6373C>T (p.Arg2125Trp) rs141141382
NM_004104.5(FASN):c.6374G>A (p.Arg2125Gln) rs145866788
NM_004104.5(FASN):c.6390C>T (p.Ala2130=) rs200241722
NM_004104.5(FASN):c.6477C>T (p.Ser2159=) rs146570982
NM_004104.5(FASN):c.6492G>C (p.Gln2164His) rs1568104948
NM_004104.5(FASN):c.6494C>T (p.Thr2165Met)
NM_004104.5(FASN):c.6525C>T (p.Ser2175=) rs747955678
NM_004104.5(FASN):c.6530G>A (p.Arg2177His) rs9890362
NM_004104.5(FASN):c.6534G>A (p.Glu2178=)
NM_004104.5(FASN):c.6539G>A (p.Arg2180Gln)
NM_004104.5(FASN):c.654G>A (p.Ala218=)
NM_004104.5(FASN):c.655+3G>T rs767012490
NM_004104.5(FASN):c.6553C>T (p.Arg2185Trp)
NM_004104.5(FASN):c.6554G>A (p.Arg2185Gln) rs45507397
NM_004104.5(FASN):c.6563A>G (p.Gln2188Arg)
NM_004104.5(FASN):c.6595+4C>T
NM_004104.5(FASN):c.6638A>G (p.Gln2213Arg)
NM_004104.5(FASN):c.6662C>T (p.Ser2221Phe)
NM_004104.5(FASN):c.6678G>A (p.Pro2226=)
NM_004104.5(FASN):c.6765C>T (p.Thr2255=) rs148481729
NM_004104.5(FASN):c.6788G>A (p.Arg2263Gln)
NM_004104.5(FASN):c.6824G>A (p.Arg2275Gln) rs758520407
NM_004104.5(FASN):c.6894C>T (p.Pro2298=) rs765729117
NM_004104.5(FASN):c.6903C>T (p.Pro2301=) rs1328155628
NM_004104.5(FASN):c.6936C>T (p.Cys2312=) rs929436144
NM_004104.5(FASN):c.694C>T (p.Leu232=) rs143618212
NM_004104.5(FASN):c.6977G>A (p.Ser2326Asn) rs1555665608
NM_004104.5(FASN):c.7167G>A (p.Pro2389=) rs143485066
NM_004104.5(FASN):c.7169T>G (p.Leu2390Arg) rs138021210
NM_004104.5(FASN):c.7192G>T (p.Ala2398Ser) rs200842352
NM_004104.5(FASN):c.7197C>T (p.Ala2399=) rs146918693
NM_004104.5(FASN):c.7229G>A (p.Gly2410Asp)
NM_004104.5(FASN):c.729C>T (p.Tyr243=) rs142734133
NM_004104.5(FASN):c.7349C>T (p.Thr2450Met)
NM_004104.5(FASN):c.7357G>A (p.Ala2453Thr) rs148372886
NM_004104.5(FASN):c.7378G>A (p.Ala2460Thr) rs149224679
NM_004104.5(FASN):c.7398+4C>G
NM_004104.5(FASN):c.7398+4C>T rs369516022
NM_004104.5(FASN):c.7399G>A (p.Val2467Ile)
NM_004104.5(FASN):c.7407C>T (p.Asp2469=) rs144413151
NM_004104.5(FASN):c.7432G>A (p.Glu2478Lys) rs747059037
NM_004104.5(FASN):c.747C>T (p.Ala249=) rs115212667
NM_004104.5(FASN):c.7491C>A (p.Ile2497=) rs146832319
NM_004104.5(FASN):c.7497C>T (p.Ser2499=) rs149770125
NM_004104.5(FASN):c.778+6C>T rs747631706
NM_004104.5(FASN):c.780C>T (p.Gly260=) rs758785292
NM_004104.5(FASN):c.820C>T (p.Arg274Cys) rs562846615
NM_004104.5(FASN):c.832C>A (p.Gln278Lys)
NM_004104.5(FASN):c.836C>T (p.Ser279Leu)
NM_004104.5(FASN):c.841G>A (p.Gly281Arg) rs748571162
NM_004104.5(FASN):c.856T>A (p.Ser286Thr) rs749367001
NM_004104.5(FASN):c.870C>T (p.Ile290=) rs151114755
NM_004104.5(FASN):c.879C>T (p.His293=) rs540008681
NM_004104.5(FASN):c.882C>T (p.Gly294=) rs1249647390
NM_004104.5(FASN):c.894+10C>G rs748481213
NM_004104.5(FASN):c.894+10C>T rs748481213
NM_004104.5(FASN):c.894+8C>A rs759051221
NM_004104.5(FASN):c.895-6C>G
NM_004104.5(FASN):c.902A>G (p.Asp301Gly) rs1568116566
NM_004104.5(FASN):c.94A>G (p.Met32Val) rs771149670
NM_004104.5(FASN):c.966C>T (p.Ile322=) rs200366210

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.