ClinVar Miner

List of variants in gene FASN reported as likely benign by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 83
Download table as spreadsheet
HGVS dbSNP
NM_004104.4(FASN):c.1005C>T (p.Ala335=) rs776934105
NM_004104.4(FASN):c.1104G>A (p.Ala368=) rs373141943
NM_004104.4(FASN):c.1374G>A (p.Ala458=) rs748235548
NM_004104.4(FASN):c.1458C>T (p.Pro486=) rs750411778
NM_004104.4(FASN):c.1485C>T (p.Ile495=) rs1192562552
NM_004104.4(FASN):c.1548C>T (p.Phe516=) rs145311183
NM_004104.4(FASN):c.1680+10A>C rs767604997
NM_004104.4(FASN):c.1701G>A (p.Leu567=) rs547573052
NM_004104.4(FASN):c.1850C>T (p.Pro617Leu) rs45444391
NM_004104.4(FASN):c.1854C>T (p.Gly618=) rs901518038
NM_004104.4(FASN):c.2022G>A (p.Glu674=) rs1336316361
NM_004104.4(FASN):c.2100+10T>C rs1555668292
NM_004104.4(FASN):c.2361G>A (p.Lys787=) rs763379489
NM_004104.4(FASN):c.2400C>T (p.Ile800=) rs747222387
NM_004104.4(FASN):c.249G>A (p.Leu83=) rs147764458
NM_004104.4(FASN):c.2594-4G>A rs761310825
NM_004104.4(FASN):c.2661C>T (p.Pro887=) rs564814781
NM_004104.4(FASN):c.2778C>G (p.Pro926=) rs369562322
NM_004104.4(FASN):c.2832C>T (p.Phe944=) rs755643560
NM_004104.4(FASN):c.2899A>C (p.Arg967=) rs936284030
NM_004104.4(FASN):c.3006C>T (p.Gly1002=) rs1366161093
NM_004104.4(FASN):c.3033C>T (p.Ala1011=) rs149933063
NM_004104.4(FASN):c.3232G>A (p.Val1078Met) rs146146551
NM_004104.4(FASN):c.3309G>A (p.Pro1103=) rs555372336
NM_004104.4(FASN):c.3337A>G (p.Ile1113Val) rs201182683
NM_004104.4(FASN):c.3549G>A (p.Ser1183=) rs72863336
NM_004104.4(FASN):c.3557G>T (p.Cys1186Phe) rs199670165
NM_004104.4(FASN):c.3578A>G (p.Asn1193Ser) rs139346033
NM_004104.4(FASN):c.3708C>T (p.Pro1236=) rs773577585
NM_004104.4(FASN):c.3738G>T (p.Leu1246=) rs769818274
NM_004104.4(FASN):c.3747C>T (p.His1249=) rs62642477
NM_004104.4(FASN):c.3975G>A (p.Pro1325=) rs374185580
NM_004104.4(FASN):c.4045C>T (p.Arg1349Trp) rs760506156
NM_004104.4(FASN):c.4059C>T (p.Leu1353=) rs761723139
NM_004104.4(FASN):c.4108G>A (p.Gly1370Ser) rs372089187
NM_004104.4(FASN):c.4123-10G>A rs573497934
NM_004104.4(FASN):c.4224G>A (p.Pro1408=) rs778737573
NM_004104.4(FASN):c.4443C>T (p.Ser1481=) rs371374591
NM_004104.4(FASN):c.4524C>T (p.Asp1508=) rs529962341
NM_004104.4(FASN):c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT rs1555669393
NM_004104.4(FASN):c.4581G>A (p.Pro1527=) rs373700033
NM_004104.4(FASN):c.4632C>T (p.Ile1544=) rs751028218
NM_004104.4(FASN):c.4650G>A (p.Ser1550=) rs779703690
NM_004104.4(FASN):c.4956C>T (p.Tyr1652=) rs776323721
NM_004104.4(FASN):c.5067C>T (p.Leu1689=) rs1555666767
NM_004104.4(FASN):c.5082C>T (p.Arg1694=) rs186001146
NM_004104.4(FASN):c.5094C>T (p.Thr1698=) rs576100145
NM_004104.4(FASN):c.5145C>T (p.Leu1715=) rs369836055
NM_004104.4(FASN):c.5184C>T (p.Phe1728=) rs140573172
NM_004104.4(FASN):c.5220C>T (p.Gly1740=) rs202024354
NM_004104.4(FASN):c.5319C>T (p.Asp1773=) rs759805514
NM_004104.4(FASN):c.5470C>T (p.Arg1824Trp) rs144212251
NM_004104.4(FASN):c.5574G>A (p.Ala1858=) rs145542725
NM_004104.4(FASN):c.5670T>C (p.Ala1890=) rs150604140
NM_004104.4(FASN):c.5703G>A (p.Ala1901=) rs776274688
NM_004104.4(FASN):c.5767+8G>A rs369401110
NM_004104.4(FASN):c.5792G>A (p.Arg1931Gln) rs148840593
NM_004104.4(FASN):c.5902G>A (p.Val1968Ile) rs148731010
NM_004104.4(FASN):c.5904C>G (p.Val1968=) rs1555666235
NM_004104.4(FASN):c.6011+10G>A rs200646707
NM_004104.4(FASN):c.6030C>T (p.Cys2010=) rs373268994
NM_004104.4(FASN):c.6090A>G (p.Gly2030=) rs755581631
NM_004104.4(FASN):c.6163+8C>G rs368725295
NM_004104.4(FASN):c.6189C>T (p.Ile2063=) rs776553835
NM_004104.4(FASN):c.6318G>A (p.Leu2106=) rs146934927
NM_004104.4(FASN):c.6373C>T (p.Arg2125Trp) rs141141382
NM_004104.4(FASN):c.6390C>T (p.Ala2130=) rs200241722
NM_004104.4(FASN):c.6525C>T (p.Ser2175=) rs747955678
NM_004104.4(FASN):c.6530G>A (p.Arg2177His) rs9890362
NM_004104.4(FASN):c.6894C>T (p.Pro2298=) rs765729117
NM_004104.4(FASN):c.6903C>T (p.Pro2301=) rs1328155628
NM_004104.4(FASN):c.6936C>T (p.Cys2312=) rs929436144
NM_004104.4(FASN):c.7197C>T (p.Ala2399=) rs146918693
NM_004104.4(FASN):c.729C>T (p.Tyr243=) rs142734133
NM_004104.4(FASN):c.7398+4C>T rs369516022
NM_004104.4(FASN):c.7407C>T (p.Asp2469=) rs144413151
NM_004104.4(FASN):c.7491C>A (p.Ile2497=) rs146832319
NM_004104.4(FASN):c.7497C>T (p.Ser2499=) rs149770125
NM_004104.4(FASN):c.780C>T (p.Gly260=) rs758785292
NM_004104.4(FASN):c.870C>T (p.Ile290=) rs151114755
NM_004104.4(FASN):c.879C>T (p.His293=) rs540008681
NM_004104.4(FASN):c.894+10C>G rs748481213
NM_004104.4(FASN):c.894+10C>T rs748481213

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.