ClinVar Miner

List of variants in gene FH

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 493
Download table as spreadsheet
HGVS dbSNP
FH, DEL
NC_000001.11:g.(?_241497557)_(241504245_?)del
NC_000001.11:g.(?_241497557)_(241519785_?)del
NC_000001.11:g.(?_241497818)_(241519732_?)dup
NC_000001.11:g.(?_241497822)_(241519728_?)dup
NC_000001.11:g.(?_241505993)_(241506178_?)del
NC_000001.11:g.(?_241505997)_(241506174_?)del
NC_000001.11:g.(?_241519585)_(241519728_?)del
NM_000143.3(FH):c.*102T>C rs200093224
NM_000143.3(FH):c.*221_*222delTT rs112946286
NM_000143.3(FH):c.*266A>G rs113667027
NM_000143.3(FH):c.*92G>T rs202167168
NM_000143.3(FH):c.-10C>T rs998842505
NM_000143.3(FH):c.-11C>T rs200942733
NM_000143.3(FH):c.-17C>T rs202081538
NM_000143.3(FH):c.-3A>G rs202145941
NM_000143.3(FH):c.-48G>T rs886046320
NM_000143.3(FH):c.1000A>C (p.Ser334Arg) rs587782216
NM_000143.3(FH):c.1003C>T (p.Leu335=) rs1203364199
NM_000143.3(FH):c.1007T>G (p.Met336Arg) rs863223972
NM_000143.3(FH):c.1013T>C (p.Ile338Thr) rs201975537
NM_000143.3(FH):c.1020T>A (p.Asn340Lys) rs398123159
NM_000143.3(FH):c.1021G>A (p.Asp341Asn) rs11545655
NM_000143.3(FH):c.1022A>G (p.Asp341Gly) rs1060499640
NM_000143.3(FH):c.1023T>C (p.Asp341=) rs863223973
NM_000143.3(FH):c.1023T>G (p.Asp341Glu) rs863223973
NM_000143.3(FH):c.1025T>C (p.Ile342Thr) rs201383596
NM_000143.3(FH):c.1027C>T (p.Arg343Ter) rs121913122
NM_000143.3(FH):c.1028delG (p.Arg343Hisfs) rs1553341026
NM_000143.3(FH):c.1035G>A (p.Leu345=)
NM_000143.3(FH):c.1036G>A (p.Gly346Ser) rs1553341024
NM_000143.3(FH):c.1041delT (p.Gly348Valfs) rs1060499641
NM_000143.3(FH):c.1045C>G (p.Pro349Ala) rs1254962869
NM_000143.3(FH):c.1046C>G (p.Pro349Arg) rs1553341017
NM_000143.3(FH):c.1048C>T (p.Arg350Trp) rs755436052
NM_000143.3(FH):c.1049G>A (p.Arg350Gln) rs749316923
NM_000143.3(FH):c.1052C>A (p.Ser351Ter) rs1060500896
NM_000143.3(FH):c.1052C>G (p.Ser351Ter) rs1060500896
NM_000143.3(FH):c.1056dupT (p.Leu353Serfs) rs863224016
NM_000143.3(FH):c.105G>A (p.Ser35=) rs181655698
NM_000143.3(FH):c.1061G>A (p.Gly354Glu) rs1057523184
NM_000143.3(FH):c.1063G>T (p.Glu355Ter) rs1060499642
NM_000143.3(FH):c.1066T>C (p.Leu356=) rs1157405003
NM_000143.3(FH):c.1067T>A (p.Leu356Ter) rs727503927
NM_000143.3(FH):c.1072T>C (p.Leu358=) rs918902822
NM_000143.3(FH):c.1077T>A (p.Pro359=) rs750535216
NM_000143.3(FH):c.1082delA (p.Asn361Metfs) rs1553341012
NM_000143.3(FH):c.1083_1086delTGAA (p.Glu362Glnfs) rs756469140
NM_000143.3(FH):c.1084G>C (p.Glu362Gln) rs121913119
NM_000143.3(FH):c.1086A>G (p.Glu362=) rs1553341008
NM_000143.3(FH):c.1093A>G (p.Ser365Gly) rs863223966
NM_000143.3(FH):c.1094G>A (p.Ser365Asn) rs1131691238
NM_000143.3(FH):c.1097G>A (p.Ser366Asn) rs863224004
NM_000143.3(FH):c.1104_1106delGCCinsACT (p.Met368_Pro369delinsIleLeu) rs863223987
NM_000143.3(FH):c.1108+1G>T rs1057517734
NM_000143.3(FH):c.1109-7C>T rs1060504079
NM_000143.3(FH):c.1109G>A (p.Gly370Asp) rs1553340894
NM_000143.3(FH):c.1112delA (p.Lys371Argfs) rs1060500904
NM_000143.3(FH):c.1117_1119delAAC (p.Asn373del) rs1553340884
NM_000143.3(FH):c.1118A>G (p.Asn373Ser) rs1060499643
NM_000143.3(FH):c.1118A>T (p.Asn373Ile)
NM_000143.3(FH):c.1119C>T (p.Asn373=) rs542014575
NM_000143.3(FH):c.1120C>A (p.Pro374Thr) rs876660446
NM_000143.3(FH):c.1126C>T (p.Gln376Ter) rs398123160
NM_000143.3(FH):c.1127A>C (p.Gln376Pro) rs200796606
NM_000143.3(FH):c.1129T>C (p.Cys377Arg) rs398123161
NM_000143.3(FH):c.1130G>A (p.Cys377Tyr) rs1553340880
NM_000143.3(FH):c.1138A>G (p.Met380Val) rs587778362
NM_000143.3(FH):c.1138delA (p.Met380Terfs)
NM_000143.3(FH):c.1138dupA (p.Met380Asnfs) rs781466938
NM_000143.3(FH):c.1139_1142delTGAC (p.Met380Thrfs) rs863223988
NM_000143.3(FH):c.1144A>G (p.Met382Val) rs886039365
NM_000143.3(FH):c.1146G>A (p.Met382Ile) rs863224006
NM_000143.3(FH):c.1154C>A (p.Ala385Asp) rs727503926
NM_000143.3(FH):c.1157A>G (p.Gln386Arg) rs750447792
NM_000143.3(FH):c.1163T>C (p.Met388Thr) rs876660830
NM_000143.3(FH):c.1184C>T (p.Thr395Ile) rs878853690
NM_000143.3(FH):c.1189G>A (p.Gly397Arg) rs863224007
NM_000143.3(FH):c.1195A>G (p.Ser399Gly)
NM_000143.3(FH):c.1198A>G (p.Asn400Asp) rs1131691247
NM_000143.3(FH):c.1199A>G (p.Asn400Ser) rs764430466
NM_000143.3(FH):c.1200delT (p.Asn400Lysfs) rs398123162
NM_000143.3(FH):c.1204C>T (p.His402Tyr)
NM_000143.3(FH):c.1205A>G (p.His402Arg) rs886039366
NM_000143.3(FH):c.1205delA (p.His402Leufs)
NM_000143.3(FH):c.1209delT (p.Phe403Leufs) rs1060499644
NM_000143.3(FH):c.120C>T (p.Asn40=) rs876658186
NM_000143.3(FH):c.1210G>T (p.Glu404Ter) rs797044974
NM_000143.3(FH):c.1216A>G (p.Asn406Asp) rs876659362
NM_000143.3(FH):c.1229C>T (p.Pro410Leu) rs1057517735
NM_000143.3(FH):c.122C>T (p.Ala41Val) rs201486221
NM_000143.3(FH):c.1236+14C>T rs149241949
NM_000143.3(FH):c.1236+1G>A rs1131691249
NM_000143.3(FH):c.1236+1G>C rs1131691249
NM_000143.3(FH):c.1237-10_1237-9dupTC rs1553340717
NM_000143.3(FH):c.1237-12A>T rs74405673
NM_000143.3(FH):c.1237-13C>T rs752468689
NM_000143.3(FH):c.1237-13_1237-12insTT rs1553340725
NM_000143.3(FH):c.1237-14_1237-13delTC rs144131869
NM_000143.3(FH):c.1237-14_1237-13dupTC rs144131869
NM_000143.3(FH):c.1237-14_1237-9dupTCACTC rs779985493
NM_000143.3(FH):c.1237-16_1237-13delTCTC rs144131869
NM_000143.3(FH):c.1237-16_1237-13dupTCTC rs144131869
NM_000143.3(FH):c.1237-18T>A rs202206776
NM_000143.3(FH):c.1237-18_1237-13dupTCTCTC rs144131869
NM_000143.3(FH):c.1237-20_1237-13dupTCTCTCTC rs144131869
NM_000143.3(FH):c.1237-22_1237-13dupTCTCTCTCTC rs144131869
NM_000143.3(FH):c.1237-24_1237-13dupTCTCTCTCTCTC rs144131869
NM_000143.3(FH):c.1237-5C>T rs200926050
NM_000143.3(FH):c.1237-5_1237-4insTCTC rs886046316
NM_000143.3(FH):c.1237-7C>T rs376260223
NM_000143.3(FH):c.1237-7_1237-4dupCTCA rs750898743
NM_000143.3(FH):c.1237-9C>T rs767413280
NM_000143.3(FH):c.1237-9_1237-8insTCTCTC rs1553340717
NM_000143.3(FH):c.1250T>G (p.Leu417Ter) rs1553340709
NM_000143.3(FH):c.1251dup (p.His418Thrfs) rs1553340708
NM_000143.3(FH):c.1255T>C (p.Ser419Pro) rs200004220
NM_000143.3(FH):c.1256C>T (p.Ser419Leu) rs1131691244
NM_000143.3(FH):c.1263delG (p.Arg421Serfs) rs863223989
NM_000143.3(FH):c.1268T>G (p.Leu423Arg) rs863224009
NM_000143.3(FH):c.1270G>A (p.Gly424Arg) rs1553340705
NM_000143.3(FH):c.1277C>A (p.Ala426Asp) rs1553340703
NM_000143.3(FH):c.127C>G (p.Arg43Gly) rs200496951
NM_000143.3(FH):c.1282G>C (p.Val428Leu)
NM_000143.3(FH):c.1286C>G (p.Ser429Cys)
NM_000143.3(FH):c.1292C>T (p.Thr431Ile) rs201005880
NM_000143.3(FH):c.1293A>G (p.Thr431=) rs772800627
NM_000143.3(FH):c.1293delA (p.Glu432Lysfs) rs398123163
NM_000143.3(FH):c.1294_1336dup (p.Asn446Argfs) rs1553340686
NM_000143.3(FH):c.1298_1340dup (p.Met449Argfs) rs1553340681
NM_000143.3(FH):c.12A>G (p.Ala4=) rs201277370
NM_000143.3(FH):c.1301G>A (p.Cys434Tyr) rs398123164
NM_000143.3(FH):c.1302C>A (p.Cys434Ter) rs2070080
NM_000143.3(FH):c.1302C>T (p.Cys434=) rs2070080
NM_000143.3(FH):c.1303G>A (p.Val435Met) rs147528200
NM_000143.3(FH):c.1305G>A (p.Val435=) rs772415507
NM_000143.3(FH):c.1306G>T (p.Val436Leu) rs1324526971
NM_000143.3(FH):c.1308G>A (p.Val436=) rs201535626
NM_000143.3(FH):c.1314C>T (p.Ile438=) rs140873869
NM_000143.3(FH):c.132+5G>A rs1060499627
NM_000143.3(FH):c.132+5G>T rs1060499627
NM_000143.3(FH):c.1322A>G (p.Asn441Ser) rs1357584529
NM_000143.3(FH):c.1325C>G (p.Thr442Arg) rs1060500899
NM_000143.3(FH):c.132G>A (p.Met44Ile) rs863223982
NM_000143.3(FH):c.133-1G>A rs863224011
NM_000143.3(FH):c.133-3T>C rs1553341989
NM_000143.3(FH):c.1330A>G (p.Arg444Gly)
NM_000143.3(FH):c.1339A>T (p.Lys447Ter) rs863223977
NM_000143.3(FH):c.1347delG (p.Met449Ilefs) rs1060500903
NM_000143.3(FH):c.1349_1352delATGA (p.Asn450Serfs) rs863223990
NM_000143.3(FH):c.1349_1352dup (p.Ser452Terfs) rs863223990
NM_000143.3(FH):c.134delC (p.Ala45Glufs) rs1131691237
NM_000143.3(FH):c.1351G>T (p.Glu451Ter)
NM_000143.3(FH):c.1354T>A (p.Ser452Thr)
NM_000143.3(FH):c.1357_1358delCT (p.Leu453Asnfs) rs863223991
NM_000143.3(FH):c.1366G>C (p.Val456Leu) rs200244096
NM_000143.3(FH):c.1370_1371insTCAC (p.Ala458Hisfs) rs863223992
NM_000143.3(FH):c.1379A>G (p.Asn460Ser) rs767253363
NM_000143.3(FH):c.1384C>T (p.His462Tyr) rs201625211
NM_000143.3(FH):c.1389A>G (p.Ile463Met) rs876659472
NM_000143.3(FH):c.1390+1G>T rs886039367
NM_000143.3(FH):c.1390+2T>C
NM_000143.3(FH):c.1391-1G>A rs863223978
NM_000143.3(FH):c.1391-1G>C rs863223978
NM_000143.3(FH):c.1391-2A>T rs863224008
NM_000143.3(FH):c.1391-2delA rs1064795320
NM_000143.3(FH):c.1391G>A (p.Gly464Glu) rs1131691250
NM_000143.3(FH):c.1391G>T (p.Gly464Val) rs1131691250
NM_000143.3(FH):c.1394A>G (p.Tyr465Cys) rs863224010
NM_000143.3(FH):c.1398C>G (p.Asp466Glu)
NM_000143.3(FH):c.139C>T (p.Gln47Ter) rs863223980
NM_000143.3(FH):c.13C>T (p.Leu5Phe) rs1553342165
NM_000143.3(FH):c.1400dupA (p.Ala468Glyfs) rs863223993
NM_000143.3(FH):c.1405G>A (p.Ala469Thr) rs1060500906
NM_000143.3(FH):c.1408A>G (p.Lys470Glu) rs922905323
NM_000143.3(FH):c.1421C>G (p.Thr474Arg) rs369802820
NM_000143.3(FH):c.1421C>T (p.Thr474Ile) rs369802820
NM_000143.3(FH):c.1424C>A (p.Ala475Glu) rs863224012
NM_000143.3(FH):c.1428C>T (p.His476=) rs199887605
NM_000143.3(FH):c.1430_1437dupAAAATGGA (p.Ser480Lysfs) rs863223994
NM_000143.3(FH):c.1431_1433dupAAA (p.Lys477_Asn478insLys) rs367543046
NM_000143.3(FH):c.1433A>G (p.Asn478Ser) rs201886827
NM_000143.3(FH):c.1434T>C (p.Asn478=) rs786202199
NM_000143.3(FH):c.1439C>G (p.Ser480Ter) rs1131691245
NM_000143.3(FH):c.1443C>G (p.Thr481=) rs780200136
NM_000143.3(FH):c.1445T>G (p.Leu482Ter) rs1064796708
NM_000143.3(FH):c.1446A>C (p.Leu482Phe) rs863223979
NM_000143.3(FH):c.1446_1449delAAAG (p.Glu484Leufs) rs398123165
NM_000143.3(FH):c.1447A>C (p.Lys483Gln) rs1017406473
NM_000143.3(FH):c.1461C>T (p.Ile487=) rs377091029
NM_000143.3(FH):c.1462G>A (p.Glu488Lys) rs201115573
NM_000143.3(FH):c.1468G>C (p.Gly490Arg) rs1553340515
NM_000143.3(FH):c.1469delG (p.Gly490Alafs) rs1060499645
NM_000143.3(FH):c.1471T>C (p.Tyr491His) rs749713004
NM_000143.3(FH):c.1472A>G (p.Tyr491Cys) rs773801940
NM_000143.3(FH):c.1475_1476delTC (p.Leu492Hisfs) rs886041201
NM_000143.3(FH):c.1478C>A (p.Thr493Lys)
NM_000143.3(FH):c.1480G>C (p.Ala494Pro) rs1553340508
NM_000143.3(FH):c.1481C>G (p.Ala494Gly) rs752369363
NM_000143.3(FH):c.1482A>G (p.Ala494=) rs201559643
NM_000143.3(FH):c.1484_1488delAGCAG (p.Glu495Valfs) rs1060500907
NM_000143.3(FH):c.1486C>T (p.Gln496Ter) rs1553340506
NM_000143.3(FH):c.14T>C (p.Leu5Pro)
NM_000143.3(FH):c.1500G>A (p.Trp500Ter) rs886039368
NM_000143.3(FH):c.1503A>G (p.Val501=) rs1553340502
NM_000143.3(FH):c.1506dupA (p.Pro503Thrfs) rs886041202
NM_000143.3(FH):c.1508_1509insCAAACC (p.Lys504_Asp505insProLys) rs1060500895
NM_000143.3(FH):c.1520T>C (p.Leu507Pro) rs1425094515
NM_000143.3(FH):c.1526C>T (p.Pro509Leu) rs1553340499
NM_000143.3(FH):c.153G>A (p.Arg51=) rs757002779
NM_000143.3(FH):c.154A>T (p.Ile52Leu) rs543844061
NM_000143.3(FH):c.157G>T (p.Glu53Ter) rs863224013
NM_000143.3(FH):c.166A>G (p.Thr56Ala) rs1232573732
NM_000143.3(FH):c.172G>A (p.Gly58Ser)
NM_000143.3(FH):c.174_177dup (p.Leu60Terfs) rs1131691246
NM_000143.3(FH):c.185_188dup (p.Asn64Alafs)
NM_000143.3(FH):c.190A>G (p.Asn64Asp) rs886046319
NM_000143.3(FH):c.193G>A (p.Asp65Asn) rs769956664
NM_000143.3(FH):c.194A>G (p.Asp65Gly) rs145116688
NM_000143.3(FH):c.194A>T (p.Asp65Val) rs145116688
NM_000143.3(FH):c.1A>C (p.Met1Leu) rs776806414
NM_000143.3(FH):c.1A>G (p.Met1Val) rs776806414
NM_000143.3(FH):c.201T>G (p.Tyr67Ter)
NM_000143.3(FH):c.204T>A (p.Tyr68Ter) rs1060500883
NM_000143.3(FH):c.207C>T (p.Gly69=) rs370392829
NM_000143.3(FH):c.208G>A (p.Ala70Thr) rs587782207
NM_000143.3(FH):c.214A>C (p.Thr72Pro) rs886039362
NM_000143.3(FH):c.217G>A (p.Val73Met) rs201878591
NM_000143.3(FH):c.221dup (p.Ser75Ilefs) rs1553341951
NM_000143.3(FH):c.222A>T (p.Arg74Ser) rs146739519
NM_000143.3(FH):c.228G>A (p.Thr76=) rs373586584
NM_000143.3(FH):c.228G>C (p.Thr76=) rs373586584
NM_000143.3(FH):c.232A>C (p.Asn78His)
NM_000143.3(FH):c.237dup (p.Lys80Terfs) rs1553341945
NM_000143.3(FH):c.239dupA (p.Ile81Aspfs) rs1553341942
NM_000143.3(FH):c.245G>A (p.Gly82Glu)
NM_000143.3(FH):c.251T>C (p.Val84Ala) rs878853692
NM_000143.3(FH):c.259C>T (p.Arg87Cys) rs139642944
NM_000143.3(FH):c.267+1G>A rs878853691
NM_000143.3(FH):c.267+1G>C rs878853691
NM_000143.3(FH):c.267+1_267+10delGTAAGTGGCA rs1060499629
NM_000143.3(FH):c.267A>C (p.Pro89=) rs1060500897
NM_000143.3(FH):c.268-2A>G rs1064793741
NM_000143.3(FH):c.26C>G (p.Ala9Gly) rs766915154
NM_000143.3(FH):c.270C>G (p.Thr90=) rs748852152
NM_000143.3(FH):c.270C>T (p.Thr90=) rs748852152
NM_000143.3(FH):c.27G>A (p.Ala9=) rs983362570
NM_000143.3(FH):c.288T>C (p.Phe96=) rs747348623
NM_000143.3(FH):c.295_301delTTGAAGC (p.Leu99Glufs) rs863224017
NM_000143.3(FH):c.2T>G (p.Met1Arg) rs201261794
NM_000143.3(FH):c.301C>T (p.Arg101Ter) rs121913120
NM_000143.3(FH):c.301_319delCGAGCGGCCGCTGAAGTAA (p.Arg101Thrfs)
NM_000143.3(FH):c.302G>A (p.Arg101Gln) rs75086406
NM_000143.3(FH):c.302G>C (p.Arg101Pro) rs75086406
NM_000143.3(FH):c.305C>T (p.Ala102Val) rs61753295
NM_000143.3(FH):c.306G>A (p.Ala102=) rs142283468
NM_000143.3(FH):c.309C>T (p.Ala103=) rs10926501
NM_000143.3(FH):c.316delG (p.Val106Terfs) rs876658569
NM_000143.3(FH):c.320A>C (p.Asn107Thr) rs121913121
NM_000143.3(FH):c.322C>T (p.Gln108Ter) rs1060499630
NM_000143.3(FH):c.33G>A (p.Ser11=) rs200542051
NM_000143.3(FH):c.33G>C (p.Ser11=) rs200542051
NM_000143.3(FH):c.346A>T (p.Ile116Phe) rs201532589
NM_000143.3(FH):c.349G>C (p.Ala117Pro) rs886039363
NM_000143.3(FH):c.353delA (p.Asn118Metfs)
NM_000143.3(FH):c.357A>C (p.Ala119=) rs767209674
NM_000143.3(FH):c.358A>G (p.Ile120Val) rs199641124
NM_000143.3(FH):c.35G>T (p.Arg12Leu)
NM_000143.3(FH):c.378+2T>C rs1131691241
NM_000143.3(FH):c.379-10T>G rs201020261
NM_000143.3(FH):c.379-15A>T rs374529177
NM_000143.3(FH):c.379-1G>A rs1553341623
NM_000143.3(FH):c.379-2A>G rs1131691240
NM_000143.3(FH):c.379-7dup rs761444069
NM_000143.3(FH):c.379G>T (p.Val127Leu) rs878853693
NM_000143.3(FH):c.37C>G (p.Pro13Ala) rs587778360
NM_000143.3(FH):c.37C>T (p.Pro13Ser) rs587778360
NM_000143.3(FH):c.382G>A (p.Ala128Thr) rs1553341620
NM_000143.3(FH):c.395T>C (p.Leu132Ser) rs1060499632
NM_000143.3(FH):c.395_399delTAAAT (p.Leu132Terfs) rs863223995
NM_000143.3(FH):c.395delT (p.Leu132Terfs) rs1060499631
NM_000143.3(FH):c.399T>C (p.Asn133=) rs376056309
NM_000143.3(FH):c.39C>T (p.Pro13=) rs1060504077
NM_000143.3(FH):c.403C>T (p.His135Tyr) rs1553341617
NM_000143.3(FH):c.404A>C (p.His135Pro) rs786202833
NM_000143.3(FH):c.404A>G (p.His135Arg) rs786202833
NM_000143.3(FH):c.40C>T (p.Leu14Phe) rs981562354
NM_000143.3(FH):c.40dupC (p.Leu14Profs) rs1060500900
NM_000143.3(FH):c.412C>G (p.Leu138Val) rs1466082062
NM_000143.3(FH):c.417G>A (p.Val139=)
NM_000143.3(FH):c.418G>C (p.Val140Leu) rs746195750
NM_000143.3(FH):c.41T>C (p.Leu14Pro) rs1553342163
NM_000143.3(FH):c.420A>G (p.Val140=) rs1180706892
NM_000143.3(FH):c.431G>T (p.Gly144Val) rs1057521425
NM_000143.3(FH):c.437G>A (p.Gly146Glu) rs11545654
NM_000143.3(FH):c.439A>G (p.Thr147Ala) rs863223983
NM_000143.3(FH):c.439dupA (p.Thr147Asnfs) rs1060499633
NM_000143.3(FH):c.442C>T (p.Gln148Ter)
NM_000143.3(FH):c.443dup (p.Thr149Aspfs) rs1553341610
NM_000143.3(FH):c.444G>A (p.Gln148=) rs928534157
NM_000143.3(FH):c.450T>A (p.Asn150Lys) rs1131691242
NM_000143.3(FH):c.456T>C (p.Asn152=) rs876658403
NM_000143.3(FH):c.468C>A (p.Val156=) rs202061330
NM_000143.3(FH):c.46C>T (p.Arg16Trp)
NM_000143.3(FH):c.473G>A (p.Ser158Asn) rs1060500902
NM_000143.3(FH):c.477T>C (p.Asn159=) rs372913738
NM_000143.3(FH):c.478A>G (p.Arg160Gly) rs878853694
NM_000143.3(FH):c.48G>T (p.Arg16=) rs1468361143
NM_000143.3(FH):c.497G>A (p.Gly166Glu)
NM_000143.3(FH):c.49G>C (p.Ala17Pro) rs755886213
NM_000143.3(FH):c.4T>C (p.Tyr2His) rs112335468
NM_000143.3(FH):c.500G>T (p.Gly167Val)
NM_000143.3(FH):c.504delA (p.Glu168Aspfs) rs776190273
NM_000143.3(FH):c.50C>T (p.Ala17Val) rs111548093
NM_000143.3(FH):c.514A>G (p.Lys172Glu) rs201154463
NM_000143.3(FH):c.517A>T (p.Ile173Leu)
NM_000143.3(FH):c.520C>A (p.Pro174Thr) rs1553341598
NM_000143.3(FH):c.521C>A (p.Pro174His)
NM_000143.3(FH):c.521C>G (p.Pro174Arg) rs199822819
NM_000143.3(FH):c.524delT (p.Val175Glyfs) rs1060499634
NM_000143.3(FH):c.525G>A (p.Val175=) rs1553341592
NM_000143.3(FH):c.527A>G (p.His176Arg) rs1158759883
NM_000143.3(FH):c.531C>G (p.Pro177=) rs202056137
NM_000143.3(FH):c.534C>T (p.Asn178=) rs375878939
NM_000143.3(FH):c.535G>A (p.Asp179Asn) rs1553341588
NM_000143.3(FH):c.539A>G (p.His180Arg) rs863224015
NM_000143.3(FH):c.53C>T (p.Pro18Leu) rs201887750
NM_000143.3(FH):c.540T>C (p.His180=) rs766280573
NM_000143.3(FH):c.545A>G (p.Asn182Ser)
NM_000143.3(FH):c.552C>G (p.Ser184Arg)
NM_000143.3(FH):c.552C>T (p.Ser184=) rs377660762
NM_000143.3(FH):c.553_554insTG (p.Gln185Leufs) rs768182640
NM_000143.3(FH):c.554A>C (p.Gln185Pro)
NM_000143.3(FH):c.554A>G (p.Gln185Arg) rs779707997
NM_000143.3(FH):c.555+1G>A rs1375252870
NM_000143.3(FH):c.555+3delC rs1553341583
NM_000143.3(FH):c.555+4A>G
NM_000143.3(FH):c.555+5G>C rs1553341582
NM_000143.3(FH):c.556-1G>C rs794727698
NM_000143.3(FH):c.556-2A>G
NM_000143.3(FH):c.556-2A>T rs750273092
NM_000143.3(FH):c.556-4A>G rs370229813
NM_000143.3(FH):c.556-5A>G rs1060500892
NM_000143.3(FH):c.556-7C>T rs780483420
NM_000143.3(FH):c.556A>T (p.Ser186Cys) rs1131691233
NM_000143.3(FH):c.556_557delAG (p.Ser186Leufs) rs1131691235
NM_000143.3(FH):c.557G>A (p.Ser186Asn) rs587782618
NM_000143.3(FH):c.560C>A (p.Ser187Ter) rs398123166
NM_000143.3(FH):c.560C>G (p.Ser187Ter) rs398123166
NM_000143.3(FH):c.560C>T (p.Ser187Leu) rs398123166
NM_000143.3(FH):c.563delA (p.Asn188Metfs) rs1131691248
NM_000143.3(FH):c.566A>T (p.Asp189Val) rs1064793125
NM_000143.3(FH):c.568_569delAC (p.Thr190Phefs) rs1553341367
NM_000143.3(FH):c.578_583delCAGCAA (p.Thr193_Ala194del) rs1060499635
NM_000143.3(FH):c.580G>A (p.Ala194Thr) rs587782215
NM_000143.3(FH):c.581C>A (p.Ala194Glu)
NM_000143.3(FH):c.583A>G (p.Met195Val) rs1553341364
NM_000143.3(FH):c.584T>C (p.Met195Thr) rs863223965
NM_000143.3(FH):c.586C>T (p.His196Tyr) rs1553341363
NM_000143.3(FH):c.587A>G (p.His196Arg) rs763601207
NM_000143.3(FH):c.593C>G (p.Ala198Gly) rs1414507017
NM_000143.3(FH):c.597_599delTGC (p.Ala200del) rs786202907
NM_000143.3(FH):c.5A>G (p.Tyr2Cys) rs1553342167
NM_000143.3(FH):c.610C>A (p.His204Asn) rs863223996
NM_000143.3(FH):c.611A>G (p.His204Arg) rs1060500898
NM_000143.3(FH):c.611A>T (p.His204Leu)
NM_000143.3(FH):c.616G>A (p.Val206Ile) rs763183520
NM_000143.3(FH):c.620T>C (p.Leu207Pro) rs1060500894
NM_000143.3(FH):c.628G>A (p.Gly210Arg) rs949267641
NM_000143.3(FH):c.62C>G (p.Ala21Gly) rs1131691251
NM_000143.3(FH):c.634C>T (p.Gln212Ter) rs1553341353
NM_000143.3(FH):c.639G>A (p.Lys213=) rs377222193
NM_000143.3(FH):c.63C>T (p.Ala21=) rs555404867
NM_000143.3(FH):c.647A>T (p.Asp216Val) rs1553341348
NM_000143.3(FH):c.648T>A (p.Asp216Glu) rs199536615
NM_000143.3(FH):c.653T>C (p.Leu218Pro) rs1553341345
NM_000143.3(FH):c.655G>A (p.Asp219Asn) rs11545656
NM_000143.3(FH):c.658_659delGCinsTT (p.Ala220Leu) rs1060500893
NM_000143.3(FH):c.65T>A (p.Leu22Ter)
NM_000143.3(FH):c.664T>A (p.Ser222Thr)
NM_000143.3(FH):c.668A>C (p.Lys223Thr) rs1064795294
NM_000143.3(FH):c.668_669delAA (p.Lys223Argfs) rs886039364
NM_000143.3(FH):c.670G>A (p.Glu224Lys) rs1060500905
NM_000143.3(FH):c.671_672del (p.Glu224Valfs) rs780001199
NM_000143.3(FH):c.674T>C (p.Phe225Ser) rs149651434
NM_000143.3(FH):c.675delT (p.Phe225Leufs) rs1553341337
NM_000143.3(FH):c.678A>G (p.Ala226=) rs757078832
NM_000143.3(FH):c.679C>T (p.Gln227Ter) rs11545658
NM_000143.3(FH):c.684C>T (p.Ile228=) rs1384151924
NM_000143.3(FH):c.687C>G (p.Ile229Met)
NM_000143.3(FH):c.688A>G (p.Lys230Glu) rs863223967
NM_000143.3(FH):c.689A>G (p.Lys230Arg) rs752232718
NM_000143.3(FH):c.692T>C (p.Ile231Thr) rs1335587342
NM_000143.3(FH):c.695G>A (p.Gly232Glu) rs727503929
NM_000143.3(FH):c.697C>T (p.Arg233Cys) rs587781682
NM_000143.3(FH):c.698G>A (p.Arg233His) rs121913123
NM_000143.3(FH):c.698G>T (p.Arg233Leu) rs121913123
NM_000143.3(FH):c.6C>G (p.Tyr2Ter) rs199971078
NM_000143.3(FH):c.6C>T (p.Tyr2=) rs199971078
NM_000143.3(FH):c.700A>C (p.Thr234Pro) rs372505976
NM_000143.3(FH):c.700A>G (p.Thr234Ala) rs372505976
NM_000143.3(FH):c.701C>T (p.Thr234Ile) rs878853695
NM_000143.3(FH):c.702T>G (p.Thr234=) rs201083387
NM_000143.3(FH):c.703C>G (p.His235Asp) rs863223968
NM_000143.3(FH):c.703C>T (p.His235Tyr) rs863223968
NM_000143.3(FH):c.706A>G (p.Thr236Ala) rs1064793126
NM_000143.3(FH):c.71C>G (p.Ser24Trp) rs587778361
NM_000143.3(FH):c.722C>T (p.Pro241Leu) rs1553341319
NM_000143.3(FH):c.722_738+3del rs1064792900
NM_000143.3(FH):c.731T>C (p.Leu244Pro) rs1060499636
NM_000143.3(FH):c.731T>G (p.Leu244Arg) rs1060499636
NM_000143.3(FH):c.736C>T (p.Gln246Ter) rs863223998
NM_000143.3(FH):c.737delA (p.Gln246Argfs) rs727503928
NM_000143.3(FH):c.738+2T>C rs1060500901
NM_000143.3(FH):c.739-10T>C rs201971572
NM_000143.3(FH):c.739-13_739-11delCTT rs771766378
NM_000143.3(FH):c.739-2A>C rs1553341174
NM_000143.3(FH):c.739G>T (p.Glu247Ter) rs1131691243
NM_000143.3(FH):c.757C>T (p.Gln253Ter) rs1131691239
NM_000143.3(FH):c.760C>T (p.Gln254Ter) rs398123167
NM_000143.3(FH):c.767A>C (p.Lys256Thr) rs978988174
NM_000143.3(FH):c.773C>T (p.Ala258Val) rs1553341166
NM_000143.3(FH):c.774_794dup (p.Met266_Pro267insThrArgIleLysAlaAlaMet) rs863223984
NM_000143.3(FH):c.77C>T (p.Pro26Leu) rs187226800
NM_000143.3(FH):c.782G>T (p.Arg261Ile) rs61736558
NM_000143.3(FH):c.785T>G (p.Ile262Arg) rs786203177
NM_000143.3(FH):c.786_806del21 (p.Lys263_Ile269del) rs786202220
NM_000143.3(FH):c.78C>T (p.Pro26=) rs1029677665
NM_000143.3(FH):c.793G>A (p.Ala265Thr) rs387906545
NM_000143.3(FH):c.797dupT (p.Met266Ilefs) rs863223981
NM_000143.3(FH):c.7C>G (p.Arg3Gly) rs202166344
NM_000143.3(FH):c.7C>T (p.Arg3Ter) rs202166344
NM_000143.3(FH):c.805A>G (p.Ile269Val) rs377015873
NM_000143.3(FH):c.805delA (p.Ile269Serfs) rs1131691234
NM_000143.3(FH):c.808delT (p.Tyr270Metfs) rs1060499637
NM_000143.3(FH):c.809A>G (p.Tyr270Cys) rs202060616
NM_000143.3(FH):c.809_810delAT (p.Tyr270Terfs) rs1553341163
NM_000143.3(FH):c.80G>C (p.Gly27Ala)
NM_000143.3(FH):c.814C>A (p.Leu272Ile) rs779019570
NM_000143.3(FH):c.816C>T (p.Leu272=) rs775368701
NM_000143.3(FH):c.816_836delCGCAGCTGGAGGCACTGCTGT (p.Ala273_Val279del) rs863223985
NM_000143.3(FH):c.817G>A (p.Ala273Thr) rs772190176
NM_000143.3(FH):c.81delCinsAT (p.Leu28Phefs) rs1553342155
NM_000143.3(FH):c.820G>C (p.Ala274Pro) rs1060499638
NM_000143.3(FH):c.823G>A (p.Gly275Arg) rs1060499639
NM_000143.3(FH):c.823G>C (p.Gly275Arg) rs1060499639
NM_000143.3(FH):c.830C>G (p.Thr277Ser) rs1553341160
NM_000143.3(FH):c.839G>A (p.Gly280Asp) rs863223969
NM_000143.3(FH):c.879delT (p.Ala294Leufs) rs1131691622
NM_000143.3(FH):c.883G>A (p.Ala295Thr) rs145843819
NM_000143.3(FH):c.892G>C (p.Ala298Pro) rs201395553
NM_000143.3(FH):c.894T>C (p.Ala298=) rs372099505
NM_000143.3(FH):c.894_896delTGC (p.Ala299del) rs863223986
NM_000143.3(FH):c.897A>G (p.Ala299=) rs1553341151
NM_000143.3(FH):c.904+47G>A rs145209119
NM_000143.3(FH):c.905-10T>G rs1060504080
NM_000143.3(FH):c.905-1G>A rs797044973
NM_000143.3(FH):c.905-1G>C rs797044973
NM_000143.3(FH):c.905-5T>A rs886046318
NM_000143.3(FH):c.907T>G (p.Leu303Val) rs1057523697
NM_000143.3(FH):c.908T>C (p.Leu303Ser) rs201502246
NM_000143.3(FH):c.90C>T (p.Gly30=)
NM_000143.3(FH):c.911C>G (p.Pro304Arg) rs200491078
NM_000143.3(FH):c.912_918delTTTTGTC (p.Phe305Leufs) rs794727836
NM_000143.3(FH):c.917T>C (p.Val306Ala) rs147991516
NM_000143.3(FH):c.919delA (p.Thr307Leufs) rs1553341049
NM_000143.3(FH):c.923C>G (p.Ala308Gly) rs1057524385
NM_000143.3(FH):c.925C>T (p.Pro309Ser) rs368849989
NM_000143.3(FH):c.926C>T (p.Pro309Leu) rs756528378
NM_000143.3(FH):c.927G>A (p.Pro309=) rs61737760
NM_000143.3(FH):c.92C>T (p.Ala31Val) rs876659347
NM_000143.3(FH):c.934T>C (p.Phe312Leu) rs863224000
NM_000143.3(FH):c.935T>G (p.Phe312Cys) rs1553341046
NM_000143.3(FH):c.937G>A (p.Glu313Lys) rs863224001
NM_000143.3(FH):c.937G>T (p.Glu313Ter) rs863224001
NM_000143.3(FH):c.944_945delTG (p.Leu315Argfs) rs886042044
NM_000143.3(FH):c.947C>A (p.Ala316Asp) rs863224002
NM_000143.3(FH):c.94G>T (p.Ala32Ser) rs1371664717
NM_000143.3(FH):c.952C>T (p.His318Tyr) rs398123168
NM_000143.3(FH):c.957C>T (p.Asp319=) rs146751488
NM_000143.3(FH):c.965T>G (p.Val322Gly) rs863224003
NM_000143.3(FH):c.974G>C (p.Ser325Thr)
NM_000143.3(FH):c.977G>A (p.Gly326Glu) rs1553341037
NM_000143.3(FH):c.981C>T (p.Ala327=) rs1060504078
NM_000143.3(FH):c.986A>G (p.Asn329Ser) rs768483509
NM_000143.3(FH):c.988A>C (p.Thr330Pro)
NM_000143.3(FH):c.989C>G (p.Thr330Ser) rs200028270
NM_000143.3(FH):c.98T>G (p.Val33Gly) rs1319755767
NM_000143.3(FH):c.991dup (p.Thr331Asnfs) rs1553341034
NM_000143.3(FH):c.994G>A (p.Ala332Thr) rs1157768121
NM_000143.3(FH):c.998G>A (p.Cys333Tyr) rs1553341032
NM_000143.3(FH):c.999C>A (p.Cys333Ter) rs1553341031
NM_000143.3:c.947delC

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.