ClinVar Miner

List of variants in gene FLNC reported as pathogenic for Myofibrillar myopathy, filamin C-related; Myopathy, distal, 4; Cardiomyopathy, familial hypertrophic, 26; Dilated Cardiomyopathy, Dominant

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 41
Download table as spreadsheet
NM_001458.4(FLNC):c.1444C>T (p.Arg482Ter) rs1420159591
NM_001458.4(FLNC):c.147delinsTCT (p.Lys51fs) rs1562988883
NM_001458.4(FLNC):c.1519_1525del (p.Gly507fs) rs1554398092
NM_001458.4(FLNC):c.1605C>A (p.Cys535Ter) rs199976790
NM_001458.4(FLNC):c.1861_1885dup (p.Arg629fs)
NM_001458.4(FLNC):c.1948C>T (p.Arg650Ter) rs770606675
NM_001458.4(FLNC):c.2065G>T (p.Glu689Ter) rs1446694237
NM_001458.4(FLNC):c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC rs1554398674
NM_001458.4(FLNC):c.3180del (p.Asp1061fs) rs1064795229
NM_001458.4(FLNC):c.3557C>T (p.Ala1186Val) rs1114167361
NM_001458.4(FLNC):c.3791-1G>C rs781135153
NM_001458.4(FLNC):c.3934_3937dup (p.Arg1313fs) rs1554399513
NM_001458.4(FLNC):c.3937C>T (p.Arg1313Ter)
NM_001458.4(FLNC):c.4333_4336del (p.Gly1444_Lys1445insTer) rs1562998858
NM_001458.4(FLNC):c.444G>A (p.Trp148Ter) rs1554397197
NM_001458.4(FLNC):c.4621A>T (p.Lys1541Ter) rs1562999451
NM_001458.4(FLNC):c.4716del (p.Leu1573fs) rs1554400021
NM_001458.4(FLNC):c.4729C>T (p.Gln1577Ter)
NM_001458.4(FLNC):c.4926_4927insACGTCACA (p.Val1643fs) rs1402879259
NM_001458.4(FLNC):c.4969C>T (p.Arg1657Ter) rs1563000044
NM_001458.4(FLNC):c.5165del (p.Gly1722fs) rs1554400242
NM_001458.4(FLNC):c.554G>A (p.Trp185Ter)
NM_001458.4(FLNC):c.5653A>T (p.Lys1885Ter) rs1563001456
NM_001458.4(FLNC):c.5672delG rs1563001548
NM_001458.4(FLNC):c.5675_5678del (p.Leu1892fs)
NM_001458.4(FLNC):c.5697dup (p.Ser1900fs) rs1554400700
NM_001458.4(FLNC):c.5904dup (p.Ile1969fs)
NM_001458.4(FLNC):c.6242dup (p.Ser2082fs)
NM_001458.4(FLNC):c.6447del (p.Ile2150fs) rs1563003153
NM_001458.4(FLNC):c.6883C>T (p.Gln2295Ter)
NM_001458.4(FLNC):c.6976C>T (p.Arg2326Ter) rs748416758
NM_001458.4(FLNC):c.7251+1G>A rs1554401581
NM_001458.4(FLNC):c.7294C>T (p.Gln2432Ter) rs1554401756
NM_001458.4(FLNC):c.7334_7335AC[2] (p.Pro2447fs)
NM_001458.4(FLNC):c.7365C>A (p.Tyr2455Ter)
NM_001458.4(FLNC):c.7371del (p.Glu2458fs) rs1554401780
NM_001458.4(FLNC):c.7496_7497insTGCT (p.Gln2499fs) rs1554401830
NM_001458.4(FLNC):c.7536_7548del (p.Pro2513fs) rs1554401837
NM_001458.4(FLNC):c.805C>T (p.Arg269Ter) rs755583250

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.