ClinVar Miner

List of variants in gene FLNC reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 700
Download table as spreadsheet
NM_001458.4(FLNC):c.1040T>C (p.Leu347Ser) rs1554397631
NM_001458.4(FLNC):c.1053C>T (p.Thr351=) rs375071103
NM_001458.4(FLNC):c.1054G>A (p.Val352Met) rs773023988
NM_001458.4(FLNC):c.1081C>T (p.Arg361Cys) rs200206944
NM_001458.4(FLNC):c.1082G>A (p.Arg361His) rs752888774
NM_001458.4(FLNC):c.1094A>G (p.Glu365Gly) rs752027721
NM_001458.4(FLNC):c.1102G>A (p.Val368Met) rs781718076
NM_001458.4(FLNC):c.1106G>C (p.Gly369Ala) rs754733061
NM_001458.4(FLNC):c.1108A>G (p.Met370Val)
NM_001458.4(FLNC):c.1128C>A (p.Asn376Lys) rs773165378
NM_001458.4(FLNC):c.1166G>A (p.Gly389Asp) rs763039506
NM_001458.4(FLNC):c.1168A>C (p.Asn390His) rs922960289
NM_001458.4(FLNC):c.1169A>G (p.Asn390Ser) rs188905854
NM_001458.4(FLNC):c.1171G>A (p.Val391Met) rs757887021
NM_001458.4(FLNC):c.1176C>T (p.Ala392=) rs767977714
NM_001458.4(FLNC):c.1186A>G (p.Thr396Ala) rs1437029966
NM_001458.4(FLNC):c.1206T>A (p.Thr402=) rs757898362
NM_001458.4(FLNC):c.1210+7C>T rs776554557
NM_001458.4(FLNC):c.1210+8G>A rs368892134
NM_001458.4(FLNC):c.1211-6C>T rs745834917
NM_001458.4(FLNC):c.1215C>T (p.Ala405=) rs749510534
NM_001458.4(FLNC):c.1216G>A (p.Gly406Ser) rs1343684536
NM_001458.4(FLNC):c.1227T>C (p.Asp409=) rs375033262
NM_001458.4(FLNC):c.1242C>T (p.Ile414=) rs761922411
NM_001458.4(FLNC):c.1243G>A (p.Val415Met)
NM_001458.4(FLNC):c.1259G>A (p.Arg420Gln) rs371410741
NM_001458.4(FLNC):c.125T>C (p.Phe42Ser) rs777706683
NM_001458.4(FLNC):c.1261C>T (p.Arg421Trp) rs759075520
NM_001458.4(FLNC):c.1304C>T (p.Thr435Met) rs199935488
NM_001458.4(FLNC):c.1309C>T (p.Arg437Cys)
NM_001458.4(FLNC):c.1310G>T (p.Arg437Leu) rs370138936
NM_001458.4(FLNC):c.1348G>A (p.Val450Met) rs747550431
NM_001458.4(FLNC):c.1354G>A (p.Val452Met) rs192163925
NM_001458.4(FLNC):c.1364C>T (p.Ala455Val) rs777210524
NM_001458.4(FLNC):c.1372C>T (p.Pro458Ser)
NM_001458.4(FLNC):c.1374C>T (p.Pro458=) rs115140972
NM_001458.4(FLNC):c.1392C>T (p.Phe464=) rs910678755
NM_001458.4(FLNC):c.141T>C (p.Asn47=) rs1331955110
NM_001458.4(FLNC):c.1420C>T (p.Pro474Ser)
NM_001458.4(FLNC):c.1425C>T (p.Asn475=) rs143610360
NM_001458.4(FLNC):c.1426G>T (p.Ala476Ser) rs746359389
NM_001458.4(FLNC):c.1430G>C (p.Cys477Ser) rs560530105
NM_001458.4(FLNC):c.1433G>A (p.Arg478His)
NM_001458.4(FLNC):c.1434C>T (p.Arg478=) rs201810745
NM_001458.4(FLNC):c.1435G>A (p.Ala479Thr) rs772697482
NM_001458.4(FLNC):c.1444C>T (p.Arg482Ter) rs1420159591
NM_001458.4(FLNC):c.1445G>A (p.Arg482Gln) rs770337434
NM_001458.4(FLNC):c.1448G>A (p.Gly483Asp)
NM_001458.4(FLNC):c.1454A>G (p.Gln485Arg) rs1012536919
NM_001458.4(FLNC):c.1469G>A (p.Arg490His)
NM_001458.4(FLNC):c.1471G>A (p.Val491Met)
NM_001458.4(FLNC):c.1474A>G (p.Lys492Glu) rs118056738
NM_001458.4(FLNC):c.147delCinsTCT (p.Lys51Serfs)
NM_001458.4(FLNC):c.1510G>A (p.Ala504Thr)
NM_001458.4(FLNC):c.1513G>A (p.Gly505Ser) rs200935123
NM_001458.4(FLNC):c.1517G>A (p.Ser506Asn) rs1554398094
NM_001458.4(FLNC):c.1518C>T (p.Ser506=) rs368101036
NM_001458.4(FLNC):c.1519G>A (p.Gly507Arg) rs189525930
NM_001458.4(FLNC):c.1519_1525delGGGGAGC (p.Gly507Serfs) rs1554398092
NM_001458.4(FLNC):c.1535C>A (p.Thr512Lys) rs775538827
NM_001458.4(FLNC):c.1541A>C (p.Lys514Thr) rs375881193
NM_001458.4(FLNC):c.1549+2T>G rs111806457
NM_001458.4(FLNC):c.1568T>C (p.Val523Ala) rs182845462
NM_001458.4(FLNC):c.1576C>T (p.Arg526Trp) rs758758113
NM_001458.4(FLNC):c.1577G>A (p.Arg526Gln) rs34932223
NM_001458.4(FLNC):c.1589A>T (p.Asp530Val) rs1371853934
NM_001458.4(FLNC):c.1599C>A (p.Phe533Leu) rs768072902
NM_001458.4(FLNC):c.15C>A (p.Ser5Arg) rs759632330
NM_001458.4(FLNC):c.1600G>A (p.Glu534Lys) rs201905890
NM_001458.4(FLNC):c.1605C>A (p.Cys535Ter) rs199976790
NM_001458.4(FLNC):c.1605C>T (p.Cys535=) rs199976790
NM_001458.4(FLNC):c.1606G>A (p.Glu536Lys) rs141616435
NM_001458.4(FLNC):c.1614C>T (p.Tyr538=) rs76046880
NM_001458.4(FLNC):c.1617G>A (p.Pro539=) rs369222964
NM_001458.4(FLNC):c.1645A>G (p.Ile549Val) rs547997371
NM_001458.4(FLNC):c.1657G>A (p.Gly553Ser) rs201572079
NM_001458.4(FLNC):c.1673G>A (p.Arg558His) rs776881635
NM_001458.4(FLNC):c.1676+1G>A rs111452612
NM_001458.4(FLNC):c.1698C>T (p.Ser566=) rs112194548
NM_001458.4(FLNC):c.16G>C (p.Gly6Arg)
NM_001458.4(FLNC):c.174C>G (p.Thr58=) rs763488290
NM_001458.4(FLNC):c.1757T>C (p.Val586Ala) rs374132023
NM_001458.4(FLNC):c.1766C>T (p.Ser589Leu)
NM_001458.4(FLNC):c.176A>G (p.Asp59Gly)
NM_001458.4(FLNC):c.1797C>T (p.Thr599=) rs773793586
NM_001458.4(FLNC):c.1802T>C (p.Val601Ala) rs763590899
NM_001458.4(FLNC):c.1810C>T (p.Leu604=) rs1554398303
NM_001458.4(FLNC):c.1813+10T>A rs756806116
NM_001458.4(FLNC):c.1813G>A (p.Gly605Ser)
NM_001458.4(FLNC):c.1824C>G (p.Ile608Met)
NM_001458.4(FLNC):c.1825G>A (p.Glu609Lys) rs758389160
NM_001458.4(FLNC):c.1848C>G (p.Ile616Met) rs770173704
NM_001458.4(FLNC):c.1857C>T (p.Asp619=) rs771469976
NM_001458.4(FLNC):c.1858G>C (p.Asp620His)
NM_001458.4(FLNC):c.1902G>A (p.Glu634=) rs12536635
NM_001458.4(FLNC):c.1923C>T (p.His641=) rs375361259
NM_001458.4(FLNC):c.1924G>A (p.Val642Ile) rs369387744
NM_001458.4(FLNC):c.1934A>C (p.Asp645Ala) rs1554398369
NM_001458.4(FLNC):c.1935_1937delCGA (p.Asp646del) rs765300084
NM_001458.4(FLNC):c.1945_1953dup (p.Asp651_Ser652insIleArgAsp) rs1554398377
NM_001458.4(FLNC):c.1948C>G (p.Arg650Gly)
NM_001458.4(FLNC):c.1948C>T (p.Arg650Ter) rs770606675
NM_001458.4(FLNC):c.1980C>T (p.Pro660=) rs762673516
NM_001458.4(FLNC):c.2008-7C>T rs767576240
NM_001458.4(FLNC):c.2023C>T (p.Pro675Ser)
NM_001458.4(FLNC):c.2036C>T (p.Pro679Leu) rs975517733
NM_001458.4(FLNC):c.2052G>A (p.Val684=) rs1554398437
NM_001458.4(FLNC):c.205C>T (p.Arg69Trp)
NM_001458.4(FLNC):c.2062G>T (p.Ala688Ser)
NM_001458.4(FLNC):c.2065G>T (p.Glu689Ter) rs1446694237
NM_001458.4(FLNC):c.2068T>C (p.Phe690Leu) rs200943714
NM_001458.4(FLNC):c.2075T>C (p.Ile692Thr)
NM_001458.4(FLNC):c.2078A>C (p.Asp693Ala) rs34972246
NM_001458.4(FLNC):c.2084G>T (p.Arg695Leu)
NM_001458.4(FLNC):c.2093G>A (p.Gly698Asp)
NM_001458.4(FLNC):c.2124C>T (p.Asp708=) rs187481700
NM_001458.4(FLNC):c.2125G>A (p.Ala709Thr) rs192725607
NM_001458.4(FLNC):c.2128G>A (p.Asp710Asn) rs370035829
NM_001458.4(FLNC):c.212T>C (p.Ile71Thr) rs1554396387
NM_001458.4(FLNC):c.2130C>A (p.Asp710Glu)
NM_001458.4(FLNC):c.2141T>C (p.Ile714Thr) rs1554398541
NM_001458.4(FLNC):c.2142C>A (p.Ile714=)
NM_001458.4(FLNC):c.2142C>T (p.Ile714=) rs199595235
NM_001458.4(FLNC):c.2160C>T (p.Pro720=) rs1389842402
NM_001458.4(FLNC):c.2163C>A (p.Asn721Lys)
NM_001458.4(FLNC):c.2169C>T (p.Asp723=) rs377553322
NM_001458.4(FLNC):c.2171G>A (p.Gly724Asp) rs1554398553
NM_001458.4(FLNC):c.2180G>A (p.Arg727His) rs200618242
NM_001458.4(FLNC):c.2194C>T (p.Pro732Ser)
NM_001458.4(FLNC):c.2199C>G (p.Thr733=) rs200655185
NM_001458.4(FLNC):c.2266-3C>T rs369153392
NM_001458.4(FLNC):c.2277C>T (p.Gly759=) rs534989876
NM_001458.4(FLNC):c.2278G>A (p.Glu760Lys) rs772574007
NM_001458.4(FLNC):c.2292C>T (p.Pro764=) rs369916201
NM_001458.4(FLNC):c.2296C>T (p.Arg766Trp) rs200215340
NM_001458.4(FLNC):c.2297G>A (p.Arg766Gln) rs369935650
NM_001458.4(FLNC):c.2305G>T (p.Val769Leu) rs1046022647
NM_001458.4(FLNC):c.2310C>T (p.Tyr770=) rs374087953
NM_001458.4(FLNC):c.2364G>A (p.Thr788=) rs1020284790
NM_001458.4(FLNC):c.2376C>T (p.Ser792=) rs754097557
NM_001458.4(FLNC):c.2377G>A (p.Glu793Lys) rs187143486
NM_001458.4(FLNC):c.2380G>A (p.Ala794Thr)
NM_001458.4(FLNC):c.2382G>A (p.Ala794=) rs536456072
NM_001458.4(FLNC):c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC rs1554398674
NM_001458.4(FLNC):c.2390-8C>G rs146063718
NM_001458.4(FLNC):c.2390-9T>C rs368068407
NM_001458.4(FLNC):c.2391C>T (p.Gly797=)
NM_001458.4(FLNC):c.2392G>A (p.Asp798Asn) rs778594252
NM_001458.4(FLNC):c.2394C>T (p.Asp798=) rs747802743
NM_001458.4(FLNC):c.2404G>A (p.Gly802Ser) rs371398126
NM_001458.4(FLNC):c.2450T>C (p.Ile817Thr) rs200653747
NM_001458.4(FLNC):c.2457C>T (p.Phe819=) rs761900404
NM_001458.4(FLNC):c.246G>A (p.Met82Ile) rs1554396403
NM_001458.4(FLNC):c.2470A>T (p.Asn824Tyr)
NM_001458.4(FLNC):c.2490C>T (p.Thr830=) rs777580254
NM_001458.4(FLNC):c.2491G>A (p.Val831Ile) rs746478952
NM_001458.4(FLNC):c.2501C>T (p.Thr834Met) rs75133741
NM_001458.4(FLNC):c.2507C>A (p.Pro836Gln) rs199652368
NM_001458.4(FLNC):c.2546A>G (p.Asn849Ser)
NM_001458.4(FLNC):c.2560G>A (p.Ala854Thr)
NM_001458.4(FLNC):c.2568C>T (p.Pro856=) rs201611050
NM_001458.4(FLNC):c.2616C>T (p.Ala872=) rs769947935
NM_001458.4(FLNC):c.2617G>A (p.Glu873Lys) rs771092335
NM_001458.4(FLNC):c.2624C>G (p.Pro875Arg) rs1418979185
NM_001458.4(FLNC):c.2635C>T (p.Arg879Cys) rs374983276
NM_001458.4(FLNC):c.2636G>A (p.Arg879His) rs367997079
NM_001458.4(FLNC):c.2650G>T (p.Val884Phe) rs770379589
NM_001458.4(FLNC):c.2652C>G (p.Val884=) rs369714355
NM_001458.4(FLNC):c.2653G>A (p.Gly885Arg) rs769110628
NM_001458.4(FLNC):c.266G>A (p.Arg89His) rs1554396410
NM_001458.4(FLNC):c.2673G>A (p.Thr891=)
NM_001458.4(FLNC):c.2736C>T (p.Gly912=) rs768894698
NM_001458.4(FLNC):c.2747G>A (p.Arg916Gln)
NM_001458.4(FLNC):c.2767A>C (p.Asn923His)
NM_001458.4(FLNC):c.2790C>T (p.Val930=) rs199966433
NM_001458.4(FLNC):c.2796C>T (p.Tyr932=) rs1371836474
NM_001458.4(FLNC):c.2800G>A (p.Ala934Thr)
NM_001458.4(FLNC):c.282A>G (p.Gln94=)
NM_001458.4(FLNC):c.2839G>C (p.Gly947Arg) rs372741923
NM_001458.4(FLNC):c.2841C>T (p.Gly947=) rs547060988
NM_001458.4(FLNC):c.2842G>A (p.Gly948Arg) rs768103657
NM_001458.4(FLNC):c.2845G>C (p.Asp949His)
NM_001458.4(FLNC):c.2845G>T (p.Asp949Tyr) rs761905908
NM_001458.4(FLNC):c.2851G>T (p.Val951Phe) rs760566825
NM_001458.4(FLNC):c.2889G>A (p.Pro963=) rs191892345
NM_001458.4(FLNC):c.2890C>A (p.Leu964Met)
NM_001458.4(FLNC):c.2943A>G (p.Gly981=) rs759397444
NM_001458.4(FLNC):c.294G>A (p.Glu98=) rs201839252
NM_001458.4(FLNC):c.2982C>G (p.Gly994=) rs947174901
NM_001458.4(FLNC):c.2994A>G (p.Gln998=) rs558712725
NM_001458.4(FLNC):c.3000T>C (p.Asp1000=) rs184454068
NM_001458.4(FLNC):c.3005G>A (p.Arg1002Gln) rs202039743
NM_001458.4(FLNC):c.3006G>A (p.Arg1002=) rs61737781
NM_001458.4(FLNC):c.3022C>T (p.Arg1008Cys) rs757969015
NM_001458.4(FLNC):c.302C>T (p.Ser101Phe) rs1554396416
NM_001458.4(FLNC):c.3039C>A (p.Cys1013Ter) rs1554399014
NM_001458.4(FLNC):c.3054C>T (p.Gly1018=) rs769624093
NM_001458.4(FLNC):c.3055G>A (p.Gly1019Ser) rs200864007
NM_001458.4(FLNC):c.3055G>T (p.Gly1019Cys) rs200864007
NM_001458.4(FLNC):c.3062C>T (p.Ala1021Val) rs574118437
NM_001458.4(FLNC):c.3069C>G (p.Ala1023=) rs1022641897
NM_001458.4(FLNC):c.3081C>A (p.Arg1027=) rs1554399030
NM_001458.4(FLNC):c.3085A>G (p.Met1029Val) rs369078760
NM_001458.4(FLNC):c.3088C>A (p.Pro1030Thr) rs1554399034
NM_001458.4(FLNC):c.3092C>A (p.Pro1031Gln)
NM_001458.4(FLNC):c.3133C>A (p.His1045Asn) rs201863231
NM_001458.4(FLNC):c.3141G>C (p.Val1047=) rs1554399057
NM_001458.4(FLNC):c.3148A>G (p.Ser1050Gly) rs773580485
NM_001458.4(FLNC):c.3152C>T (p.Pro1051Leu)
NM_001458.4(FLNC):c.3180delT (p.Asp1061Ilefs) rs1064795229
NM_001458.4(FLNC):c.31G>A (p.Gly11Ser) rs370512642
NM_001458.4(FLNC):c.3201T>G (p.Ala1067=) rs760214102
NM_001458.4(FLNC):c.3207C>T (p.Gly1069=) rs753825183
NM_001458.4(FLNC):c.3209C>T (p.Pro1070Leu) rs370391049
NM_001458.4(FLNC):c.3240C>T (p.Pro1080=) rs570290798
NM_001458.4(FLNC):c.3241G>A (p.Ala1081Thr) rs781760817
NM_001458.4(FLNC):c.3242C>T (p.Ala1081Val) rs200169573
NM_001458.4(FLNC):c.3243G>A (p.Ala1081=) rs534482249
NM_001458.4(FLNC):c.3260C>G (p.Thr1087Ser) rs372205719
NM_001458.4(FLNC):c.3265G>A (p.Gly1089Arg) rs1554399171
NM_001458.4(FLNC):c.3304C>T (p.Pro1102Ser) rs199707920
NM_001458.4(FLNC):c.3376C>G (p.Pro1126Ala)
NM_001458.4(FLNC):c.3415C>T (p.His1139Tyr)
NM_001458.4(FLNC):c.3426C>T (p.Gly1142=) rs201313781
NM_001458.4(FLNC):c.3428C>T (p.Ser1143Leu) rs756192123
NM_001458.4(FLNC):c.3458T>G (p.Phe1153Cys) rs138663492
NM_001458.4(FLNC):c.3475C>T (p.Arg1159Trp) rs760500171
NM_001458.4(FLNC):c.3488C>T (p.Pro1163Leu) rs377489161
NM_001458.4(FLNC):c.3489G>C (p.Pro1163=) rs369853278
NM_001458.4(FLNC):c.3499C>T (p.Arg1167Cys)
NM_001458.4(FLNC):c.3506A>G (p.Lys1169Arg) rs530742766
NM_001458.4(FLNC):c.3510C>T (p.Val1170=) rs745571747
NM_001458.4(FLNC):c.3511G>A (p.Gly1171Ser) rs769490872
NM_001458.4(FLNC):c.352+10G>A rs79489893
NM_001458.4(FLNC):c.353-9C>T rs778957130
NM_001458.4(FLNC):c.3553G>A (p.Glu1185Lys) rs912926530
NM_001458.4(FLNC):c.3557C>T (p.Ala1186Val) rs1114167361
NM_001458.4(FLNC):c.3588C>T (p.Ala1196=) rs376078628
NM_001458.4(FLNC):c.3589G>A (p.Gly1197Arg) rs753812010
NM_001458.4(FLNC):c.3592G>C (p.Val1198Leu) rs201912847
NM_001458.4(FLNC):c.3600C>T (p.Ala1200=) rs777931249
NM_001458.4(FLNC):c.3615C>T (p.His1205=) rs1554399300
NM_001458.4(FLNC):c.3621C>T (p.Asn1207=) rs117864464
NM_001458.4(FLNC):c.3622G>A (p.Ala1208Thr) rs528279616
NM_001458.4(FLNC):c.3623C>T (p.Ala1208Val) rs202184162
NM_001458.4(FLNC):c.3624G>A (p.Ala1208=) rs35281128
NM_001458.4(FLNC):c.3630C>A (p.Gly1210=) rs771020495
NM_001458.4(FLNC):c.3649A>T (p.Ser1217Cys) rs759597112
NM_001458.4(FLNC):c.3680C>T (p.Thr1227Ile) rs373573447
NM_001458.4(FLNC):c.3693C>T (p.Gly1231=) rs765922145
NM_001458.4(FLNC):c.3703G>A (p.Val1235Met) rs1208885010
NM_001458.4(FLNC):c.3721C>T (p.Arg1241Cys) rs146953558
NM_001458.4(FLNC):c.3744C>T (p.Val1248=) rs374922440
NM_001458.4(FLNC):c.3745G>A (p.Asp1249Asn) rs774968828
NM_001458.4(FLNC):c.3757G>A (p.Val1253Ile) rs117366477
NM_001458.4(FLNC):c.3765C>A (p.Val1255=) rs556428588
NM_001458.4(FLNC):c.3772C>T (p.Pro1258Ser) rs374764212
NM_001458.4(FLNC):c.3790+5G>A rs199917473
NM_001458.4(FLNC):c.3790+7G>A rs534439574
NM_001458.4(FLNC):c.3790G>A (p.Gly1264Ser) rs201335143
NM_001458.4(FLNC):c.3799C>T (p.Arg1267Trp)
NM_001458.4(FLNC):c.37G>A (p.Gly13Ser)
NM_001458.4(FLNC):c.3800G>A (p.Arg1267Gln) rs768767784
NM_001458.4(FLNC):c.3833G>A (p.Arg1278Lys) rs540117605
NM_001458.4(FLNC):c.3835T>C (p.Ser1279Pro)
NM_001458.4(FLNC):c.3838C>T (p.Leu1280=) rs34180031
NM_001458.4(FLNC):c.3847A>G (p.Thr1283Ala) rs367860958
NM_001458.4(FLNC):c.3852C>T (p.Gly1284=) rs111337293
NM_001458.4(FLNC):c.3853G>A (p.Gly1285Ser) rs200928780
NM_001458.4(FLNC):c.3861C>T (p.His1287=) rs375986462
NM_001458.4(FLNC):c.3871C>G (p.Arg1291Gly) rs753591663
NM_001458.4(FLNC):c.3872G>A (p.Arg1291His)
NM_001458.4(FLNC):c.387G>A (p.Leu129=) rs1159200587
NM_001458.4(FLNC):c.3881A>G (p.Asn1294Ser)
NM_001458.4(FLNC):c.3885C>T (p.Pro1295=) rs778413094
NM_001458.4(FLNC):c.3887C>T (p.Ser1296Leu) rs747587140
NM_001458.4(FLNC):c.3934_3937dup (p.Arg1313Leufs) rs1554399513
NM_001458.4(FLNC):c.3937C>G (p.Arg1313Gly)
NM_001458.4(FLNC):c.3937C>T (p.Arg1313Ter)
NM_001458.4(FLNC):c.3938G>A (p.Arg1313Gln) rs199804244
NM_001458.4(FLNC):c.3951C>T (p.Thr1317=) rs765476086
NM_001458.4(FLNC):c.3960G>A (p.Glu1320=) rs200717144
NM_001458.4(FLNC):c.3964+10G>A rs747730336
NM_001458.4(FLNC):c.3964+9C>T rs200448727
NM_001458.4(FLNC):c.3966C>T (p.Gly1322=) rs200237564
NM_001458.4(FLNC):c.3967G>A (p.Val1323Met) rs771676134
NM_001458.4(FLNC):c.3972T>C (p.His1324=) rs201922688
NM_001458.4(FLNC):c.4000G>A (p.Ala1334Thr) rs556477946
NM_001458.4(FLNC):c.4018T>A (p.Phe1340Ile) rs775383465
NM_001458.4(FLNC):c.4022G>A (p.Arg1341Gln) rs149641783
NM_001458.4(FLNC):c.4054C>T (p.Arg1352Cys) rs367931139
NM_001458.4(FLNC):c.4060C>G (p.Arg1354Gly)
NM_001458.4(FLNC):c.4068C>T (p.Phe1356=) rs745413025
NM_001458.4(FLNC):c.4073C>G (p.Pro1358Arg) rs769586047
NM_001458.4(FLNC):c.408G>A (p.Thr136=) rs370110008
NM_001458.4(FLNC):c.4092G>C (p.Leu1364Phe) rs768635501
NM_001458.4(FLNC):c.4097A>G (p.Asn1366Ser) rs185746835
NM_001458.4(FLNC):c.4106A>G (p.Asn1369Ser) rs1554399615
NM_001458.4(FLNC):c.4127+9C>T rs368729011
NM_001458.4(FLNC):c.4140C>T (p.Thr1380=) rs183668401
NM_001458.4(FLNC):c.4141G>A (p.Gly1381Arg)
NM_001458.4(FLNC):c.4153C>T (p.Leu1385=) rs202125701
NM_001458.4(FLNC):c.4159A>G (p.Ile1387Val) rs1032003580
NM_001458.4(FLNC):c.4161C>T (p.Ile1387=) rs200288149
NM_001458.4(FLNC):c.4218C>T (p.Thr1406=) rs748827721
NM_001458.4(FLNC):c.4219G>A (p.Val1407Met)
NM_001458.4(FLNC):c.4229T>A (p.Ile1410Asn)
NM_001458.4(FLNC):c.4270G>A (p.Gly1424Arg) rs1202331272
NM_001458.4(FLNC):c.4289-4A>C rs140031589
NM_001458.4(FLNC):c.4289-7_4289-5delCTC rs1286999803
NM_001458.4(FLNC):c.4296G>A (p.Pro1432=) rs370827536
NM_001458.4(FLNC):c.4301G>A (p.Arg1434His) rs143623535
NM_001458.4(FLNC):c.4301G>T (p.Arg1434Leu) rs143623535
NM_001458.4(FLNC):c.4302C>T (p.Arg1434=) rs114697352
NM_001458.4(FLNC):c.4303G>A (p.Val1435Met) rs370643162
NM_001458.4(FLNC):c.4310T>C (p.Val1437Ala) rs754170282
NM_001458.4(FLNC):c.4315G>A (p.Asp1439Asn)
NM_001458.4(FLNC):c.4333_4336delAAGG (p.Lys1445Terfs)
NM_001458.4(FLNC):c.4334A>G (p.Lys1445Arg)
NM_001458.4(FLNC):c.4367G>C (p.Gly1456Ala)
NM_001458.4(FLNC):c.4372A>G (p.Arg1458Gly)
NM_001458.4(FLNC):c.4374G>A (p.Arg1458=) rs1305563889
NM_001458.4(FLNC):c.4404C>T (p.Asp1468=) rs2249128
NM_001458.4(FLNC):c.4413A>T (p.Gln1471His) rs765435961
NM_001458.4(FLNC):c.4420C>T (p.Arg1474Trp) rs372454458
NM_001458.4(FLNC):c.4424C>T (p.Ala1475Val) rs369305865
NM_001458.4(FLNC):c.444G>A (p.Trp148Ter) rs1554397197
NM_001458.4(FLNC):c.4474G>A (p.Glu1492Lys)
NM_001458.4(FLNC):c.4480C>T (p.Arg1494Trp) rs779079128
NM_001458.4(FLNC):c.449A>G (p.Asp150Gly) rs760711912
NM_001458.4(FLNC):c.4549G>A (p.Val1517Ile) rs532654321
NM_001458.4(FLNC):c.4553A>G (p.Lys1518Arg) rs201635205
NM_001458.4(FLNC):c.4565A>G (p.Gln1522Arg) rs1022106059
NM_001458.4(FLNC):c.4570G>A (p.Val1524Met) rs1358403336
NM_001458.4(FLNC):c.4579A>G (p.Ser1527Gly) rs747642919
NM_001458.4(FLNC):c.4581-5T>A rs368660628
NM_001458.4(FLNC):c.4589A>G (p.Lys1530Arg) rs756526090
NM_001458.4(FLNC):c.4593C>G (p.Ile1531Met) rs371988433
NM_001458.4(FLNC):c.4597G>A (p.Val1533Ile) rs1554399973
NM_001458.4(FLNC):c.4621A>T (p.Lys1541Ter)
NM_001458.4(FLNC):c.4627C>T (p.Arg1543Trp) rs745648230
NM_001458.4(FLNC):c.4636G>A (p.Gly1546Ser) rs774263134
NM_001458.4(FLNC):c.4651G>A (p.Ala1551Thr) rs565918031
NM_001458.4(FLNC):c.4660A>C (p.Ile1554Leu) rs754224673
NM_001458.4(FLNC):c.4662C>T (p.Ile1554=) rs374683306
NM_001458.4(FLNC):c.4695C>T (p.Asp1565=) rs769871754
NM_001458.4(FLNC):c.469C>T (p.Arg157Cys)
NM_001458.4(FLNC):c.4705G>A (p.Ala1569Thr) rs768737324
NM_001458.4(FLNC):c.4707G>A (p.Ala1569=) rs541323590
NM_001458.4(FLNC):c.4710C>T (p.Gly1570=)
NM_001458.4(FLNC):c.4716delG (p.Leu1573Cysfs) rs1554400021
NM_001458.4(FLNC):c.4737+9_4737+10delCT rs794727437
NM_001458.4(FLNC):c.4744G>A (p.Glu1582Lys) rs753022721
NM_001458.4(FLNC):c.4762G>C (p.Ala1588Pro)
NM_001458.4(FLNC):c.4763C>G (p.Ala1588Gly) rs148545460
NM_001458.4(FLNC):c.4771C>T (p.Arg1591Trp)
NM_001458.4(FLNC):c.4790C>T (p.Thr1597Met) rs753742681
NM_001458.4(FLNC):c.479C>T (p.Thr160Met)
NM_001458.4(FLNC):c.4825C>G (p.Arg1609Gly)
NM_001458.4(FLNC):c.4826G>A (p.Arg1609Gln)
NM_001458.4(FLNC):c.4872G>A (p.Ser1624=) rs767264014
NM_001458.4(FLNC):c.4879C>T (p.Arg1627Cys) rs760407609
NM_001458.4(FLNC):c.4880G>A (p.Arg1627His) rs751592993
NM_001458.4(FLNC):c.4888G>T (p.Ala1630Ser) rs1479430297
NM_001458.4(FLNC):c.490C>T (p.Arg164Trp)
NM_001458.4(FLNC):c.4925C>T (p.Thr1642Ile) rs756074974
NM_001458.4(FLNC):c.4926_4927insACGTCACA (p.Val1643Thrfs) rs1402879259
NM_001458.4(FLNC):c.4928-7T>C rs201957008
NM_001458.4(FLNC):c.4947C>T (p.Gly1649=) rs201069454
NM_001458.4(FLNC):c.4951+10C>T rs778809639
NM_001458.4(FLNC):c.4951+7G>A rs370501464
NM_001458.4(FLNC):c.4952-10C>T rs142611699
NM_001458.4(FLNC):c.4952-9G>T rs747821376
NM_001458.4(FLNC):c.4970G>A (p.Arg1657Gln) rs374294752
NM_001458.4(FLNC):c.4991C>T (p.Thr1664Met) rs780829334
NM_001458.4(FLNC):c.5000C>T (p.Thr1667Met) rs753945728
NM_001458.4(FLNC):c.5011A>G (p.Lys1671Glu)
NM_001458.4(FLNC):c.5020G>A (p.Gly1674Ser) rs374124083
NM_001458.4(FLNC):c.5029A>C (p.Lys1677Gln) rs1554400214
NM_001458.4(FLNC):c.5042C>G (p.Thr1681Arg) rs193159707
NM_001458.4(FLNC):c.5070C>T (p.Leu1690=) rs202027738
NM_001458.4(FLNC):c.5071G>A (p.Asp1691Asn)
NM_001458.4(FLNC):c.5097C>T (p.Asp1699=) rs1246194093
NM_001458.4(FLNC):c.5123C>T (p.Ala1708Val) rs1011817473
NM_001458.4(FLNC):c.5128G>A (p.Glu1710Lys)
NM_001458.4(FLNC):c.5132C>T (p.Pro1711Leu)
NM_001458.4(FLNC):c.5143G>A (p.Val1715Ile) rs200178370
NM_001458.4(FLNC):c.5155C>T (p.Arg1719Cys) rs773260834
NM_001458.4(FLNC):c.5160C>T (p.Phe1720=) rs562101000
NM_001458.4(FLNC):c.5165delG (p.Gly1722Valfs) rs1554400242
NM_001458.4(FLNC):c.517G>T (p.Val173Leu)
NM_001458.4(FLNC):c.5181C>A (p.Asn1727Lys) rs764500516
NM_001458.4(FLNC):c.5182A>G (p.Ser1728Gly) rs1554400248
NM_001458.4(FLNC):c.5200-10G>A rs1554400346
NM_001458.4(FLNC):c.5200-8C>T rs1478656876
NM_001458.4(FLNC):c.5200-9C>T rs777290470
NM_001458.4(FLNC):c.5202G>A (p.Ala1734=) rs757233206
NM_001458.4(FLNC):c.5208C>A (p.Asp1736Glu) rs1291689149
NM_001458.4(FLNC):c.5216C>T (p.Pro1739Leu) rs745650222
NM_001458.4(FLNC):c.5221G>A (p.Glu1741Lys) rs200792813
NM_001458.4(FLNC):c.5238A>C (p.Glu1746Asp)
NM_001458.4(FLNC):c.5239G>A (p.Val1747Met) rs764373507
NM_001458.4(FLNC):c.5262C>T (p.Tyr1754=) rs369165766
NM_001458.4(FLNC):c.5272C>T (p.Arg1758Trp)
NM_001458.4(FLNC):c.5275C>T (p.Pro1759Ser)
NM_001458.4(FLNC):c.5277C>A (p.Pro1759=) rs763698034
NM_001458.4(FLNC):c.5278G>A (p.Gly1760Ser) rs150986092
NM_001458.4(FLNC):c.5281G>A (p.Ala1761Thr) rs376023896
NM_001458.4(FLNC):c.5284C>T (p.Arg1762Cys) rs201926772
NM_001458.4(FLNC):c.5285G>A (p.Arg1762His)
NM_001458.4(FLNC):c.5296T>C (p.Trp1766Arg) rs751650734
NM_001458.4(FLNC):c.5298+6G>A rs373553314
NM_001458.4(FLNC):c.5298+7C>T rs773294846
NM_001458.4(FLNC):c.5299-9C>T rs1554400444
NM_001458.4(FLNC):c.5311C>G (p.Pro1771Ala) rs200001272
NM_001458.4(FLNC):c.5343G>A (p.Met1781Ile) rs1554400464
NM_001458.4(FLNC):c.5363T>G (p.Val1788Gly)
NM_001458.4(FLNC):c.5367C>T (p.Ile1789=) rs377214486
NM_001458.4(FLNC):c.5373C>T (p.Phe1791=) rs370373860
NM_001458.4(FLNC):c.5374G>A (p.Ala1792Thr) rs201348102
NM_001458.4(FLNC):c.5375C>T (p.Ala1792Val) rs200233856
NM_001458.4(FLNC):c.5376G>A (p.Ala1792=) rs758648462
NM_001458.4(FLNC):c.5418G>A (p.Ser1806=) rs376078394
NM_001458.4(FLNC):c.5427G>A (p.Thr1809=) rs774600814
NM_001458.4(FLNC):c.5432G>A (p.Arg1811Gln)
NM_001458.4(FLNC):c.5445C>T (p.Thr1815=) rs758995789
NM_001458.4(FLNC):c.5449A>T (p.Asn1817Tyr)
NM_001458.4(FLNC):c.5451_5453delCAA (p.Asn1817del) rs1312829675
NM_001458.4(FLNC):c.5457C>T (p.Asp1819=) rs376660713
NM_001458.4(FLNC):c.5468C>T (p.Thr1823Met)
NM_001458.4(FLNC):c.5500C>T (p.His1834Tyr) rs377141822
NM_001458.4(FLNC):c.5537C>T (p.Pro1846Leu) rs1408298919
NM_001458.4(FLNC):c.5540-6C>G rs201335006
NM_001458.4(FLNC):c.5568C>G (p.Ala1856=) rs1554400651
NM_001458.4(FLNC):c.5578C>T (p.Arg1860Cys) rs181067717
NM_001458.4(FLNC):c.5579G>A (p.Arg1860His) rs1019973830
NM_001458.4(FLNC):c.5592C>T (p.Ala1864=) rs117517372
NM_001458.4(FLNC):c.561C>T (p.Asp187=) rs149474376
NM_001458.4(FLNC):c.5644A>G (p.Ile1882Val) rs184018403
NM_001458.4(FLNC):c.5653A>T (p.Lys1885Ter)
NM_001458.4(FLNC):c.5668+4A>C rs1259876470
NM_001458.4(FLNC):c.5668+6G>A rs773119692
NM_001458.4(FLNC):c.5672delG (p.Gly1891Valfs)
NM_001458.4(FLNC):c.5686G>A (p.Val1896Met) rs891651799
NM_001458.4(FLNC):c.5697dup (p.Ser1900Ilefs) rs1554400700
NM_001458.4(FLNC):c.5709G>A (p.Glu1903=) rs1279073825
NM_001458.4(FLNC):c.5746G>A (p.Val1916Met)
NM_001458.4(FLNC):c.5754T>C (p.Tyr1918=) rs764539989
NM_001458.4(FLNC):c.5763_5764invTG (p.Ala1922Thr)
NM_001458.4(FLNC):c.5766G>A (p.Ala1922=) rs58914363
NM_001458.4(FLNC):c.5777A>G (p.Tyr1926Cys) rs376653815
NM_001458.4(FLNC):c.5787C>T (p.Ile1929=) rs377063332
NM_001458.4(FLNC):c.5791C>T (p.Arg1931Cys) rs562155863
NM_001458.4(FLNC):c.5792G>A (p.Arg1931His) rs780685346
NM_001458.4(FLNC):c.5792G>T (p.Arg1931Leu) rs780685346
NM_001458.4(FLNC):c.5793C>G (p.Arg1931=) rs374631384
NM_001458.4(FLNC):c.5796C>T (p.Phe1932=) rs572337697
NM_001458.4(FLNC):c.5797G>A (p.Asp1933Asn) rs762297336
NM_001458.4(FLNC):c.5813C>T (p.Pro1938Leu) rs764747370
NM_001458.4(FLNC):c.5828C>T (p.Thr1943Ile) rs376413798
NM_001458.4(FLNC):c.5842+8G>A rs781168906
NM_001458.4(FLNC):c.5872A>T (p.Asn1958Tyr) rs567595947
NM_001458.4(FLNC):c.5888C>T (p.Thr1963Met)
NM_001458.4(FLNC):c.5889G>A (p.Thr1963=) rs374743518
NM_001458.4(FLNC):c.5892C>T (p.Asp1964=) rs747546440
NM_001458.4(FLNC):c.5909C>T (p.Thr1970Ile)
NM_001458.4(FLNC):c.5910C>T (p.Thr1970=) rs544613263
NM_001458.4(FLNC):c.5913G>A (p.Glu1971=) rs368751662
NM_001458.4(FLNC):c.5954C>T (p.Ser1985Leu) rs200415625
NM_001458.4(FLNC):c.5955G>A (p.Ser1985=)
NM_001458.4(FLNC):c.595G>A (p.Ala199Thr)
NM_001458.4(FLNC):c.597C>T (p.Ala199=) rs143942649
NM_001458.4(FLNC):c.5984G>A (p.Arg1995His) rs371508414
NM_001458.4(FLNC):c.5996G>A (p.Arg1999Gln) rs1346364708
NM_001458.4(FLNC):c.5997G>A (p.Arg1999=) rs1554400935
NM_001458.4(FLNC):c.59A>C (p.Glu20Ala) rs1478918808
NM_001458.4(FLNC):c.6002T>C (p.Ile2001Thr) rs1554400940
NM_001458.4(FLNC):c.6005-9T>C rs118124743
NM_001458.4(FLNC):c.6005G>T (p.Gly2002Val)
NM_001458.4(FLNC):c.600C>T (p.Pro200=) rs202105410
NM_001458.4(FLNC):c.6015C>T (p.Phe2005=) rs771715893
NM_001458.4(FLNC):c.6031G>A (p.Gly2011Arg) rs1554400962
NM_001458.4(FLNC):c.6040G>A (p.Val2014Met) rs772477251
NM_001458.4(FLNC):c.6053G>A (p.Arg2018His) rs764326184
NM_001458.4(FLNC):c.6058A>T (p.Ser2020Cys) rs537114122
NM_001458.4(FLNC):c.6095T>C (p.Leu2032Pro) rs1554400980
NM_001458.4(FLNC):c.609C>T (p.Cys203=) rs1455396332
NM_001458.4(FLNC):c.6114C>T (p.Ile2038=) rs559639511
NM_001458.4(FLNC):c.6120C>T (p.Asp2040=) rs116974302
NM_001458.4(FLNC):c.6121G>C (p.Ala2041Pro) rs745842738
NM_001458.4(FLNC):c.612C>T (p.Pro204=) rs368103032
NM_001458.4(FLNC):c.6134G>A (p.Arg2045Gln)
NM_001458.4(FLNC):c.613G>A (p.Asp205Asn) rs767740333
NM_001458.4(FLNC):c.6170T>C (p.Phe2057Ser) rs1554400996
NM_001458.4(FLNC):c.6175G>A (p.Val2059Met) rs201333104
NM_001458.4(FLNC):c.6208+4C>T rs1554401011
NM_001458.4(FLNC):c.6209-3C>G rs896971028
NM_001458.4(FLNC):c.6209-4C>T rs752959773
NM_001458.4(FLNC):c.6246C>T (p.Ser2082=) rs1554401089
NM_001458.4(FLNC):c.6252G>A (p.Val2084=) rs1386646158
NM_001458.4(FLNC):c.6278A>C (p.Asp2093Ala)
NM_001458.4(FLNC):c.6309C>T (p.Thr2103=) rs376992044
NM_001458.4(FLNC):c.6325A>G (p.Ile2109Val)
NM_001458.4(FLNC):c.6354C>T (p.His2118=) rs368455239
NM_001458.4(FLNC):c.6355G>A (p.Val2119Met)
NM_001458.4(FLNC):c.635A>G (p.Asn212Ser)
NM_001458.4(FLNC):c.6369C>T (p.Pro2123=) rs752728262
NM_001458.4(FLNC):c.6387C>T (p.Thr2129=) rs200182180
NM_001458.4(FLNC):c.6390C>T (p.Gly2130=) rs746751083
NM_001458.4(FLNC):c.6397C>T (p.Arg2133Cys) rs1186464414
NM_001458.4(FLNC):c.6419G>A (p.Arg2140Gln) rs368662317
NM_001458.4(FLNC):c.642C>T (p.Pro214=) rs2291558
NM_001458.4(FLNC):c.643G>A (p.Val215Met) rs754309921
NM_001458.4(FLNC):c.6441C>T (p.Ile2147=) rs762017885
NM_001458.4(FLNC):c.6447delC (p.Ile2150Serfs)
NM_001458.4(FLNC):c.6451G>T (p.Gly2151Cys)
NM_001458.4(FLNC):c.6459C>T (p.Thr2153=) rs113618587
NM_001458.4(FLNC):c.6460T>A (p.Cys2154Ser) rs1554401153
NM_001458.4(FLNC):c.6485-8C>T rs369347947
NM_001458.4(FLNC):c.6526C>T (p.Arg2176Cys)
NM_001458.4(FLNC):c.6533T>C (p.Phe2178Ser) rs1554401204
NM_001458.4(FLNC):c.6539G>C (p.Arg2180Pro) rs1554401209
NM_001458.4(FLNC):c.6564G>A (p.Thr2188=) rs775348656
NM_001458.4(FLNC):c.6569G>A (p.Arg2190His) rs762680314
NM_001458.4(FLNC):c.6572C>T (p.Thr2191Met) rs768329311
NM_001458.4(FLNC):c.6595G>A (p.Gly2199Arg) rs368977589
NM_001458.4(FLNC):c.6639C>T (p.Val2213=) rs747628268
NM_001458.4(FLNC):c.6640G>A (p.Gly2214Ser) rs1431110219
NM_001458.4(FLNC):c.6642C>T (p.Gly2214=) rs546247674
NM_001458.4(FLNC):c.6648C>T (p.Asp2216=) rs1362841989
NM_001458.4(FLNC):c.6665T>C (p.Phe2222Ser) rs1554401281
NM_001458.4(FLNC):c.6683G>A (p.Arg2228Gln) rs765438770
NM_001458.4(FLNC):c.6689G>A (p.Arg2230His)
NM_001458.4(FLNC):c.6689G>T (p.Arg2230Leu) rs376035195
NM_001458.4(FLNC):c.6702C>T (p.Phe2234=) rs370589662
NM_001458.4(FLNC):c.6714C>T (p.Thr2238=) rs10268251
NM_001458.4(FLNC):c.6720G>A (p.Gln2240=) rs371391208
NM_001458.4(FLNC):c.6724G>A (p.Glu2242Lys) rs1265897548
NM_001458.4(FLNC):c.6727+7A>G rs746982412
NM_001458.4(FLNC):c.676G>A (p.Asp226Asn) rs745775171
NM_001458.4(FLNC):c.6771A>G (p.Pro2257=) rs34422412
NM_001458.4(FLNC):c.6779A>G (p.Lys2260Arg) rs751019991
NM_001458.4(FLNC):c.678C>T (p.Asp226=) rs769791248
NM_001458.4(FLNC):c.6808G>A (p.Glu2270Lys) rs202223616
NM_001458.4(FLNC):c.6810G>A (p.Glu2270=) rs745858001
NM_001458.4(FLNC):c.6816C>T (p.Ser2272=) rs375139827
NM_001458.4(FLNC):c.6817G>A (p.Ala2273Thr) rs372251350
NM_001458.4(FLNC):c.6849G>A (p.Met2283Ile) rs1375490850
NM_001458.4(FLNC):c.6864C>T (p.Val2288=) rs761269440
NM_001458.4(FLNC):c.6878G>A (p.Arg2293His) rs1034483511
NM_001458.4(FLNC):c.6888C>T (p.His2296=) rs375259002
NM_001458.4(FLNC):c.6893C>T (p.Pro2298Leu)
NM_001458.4(FLNC):c.6895G>A (p.Gly2299Ser) rs756870838
NM_001458.4(FLNC):c.690G>A (p.Gly230=) rs775254295
NM_001458.4(FLNC):c.6923C>T (p.Pro2308Leu) rs369250297
NM_001458.4(FLNC):c.6958G>A (p.Gly2320Arg) rs867808948
NM_001458.4(FLNC):c.6976C>T (p.Arg2326Ter) rs748416758
NM_001458.4(FLNC):c.6977G>A (p.Arg2326Gln) rs201028676
NM_001458.4(FLNC):c.697C>T (p.Gln233Ter) rs1554397464
NM_001458.4(FLNC):c.6986C>G (p.Ala2329Gly)
NM_001458.4(FLNC):c.6987C>T (p.Ala2329=) rs771037016
NM_001458.4(FLNC):c.6988G>A (p.Gly2330Ser) rs527248119
NM_001458.4(FLNC):c.6991G>A (p.Val2331Met) rs191288058
NM_001458.4(FLNC):c.6998-10C>T rs1427937152
NM_001458.4(FLNC):c.6998-5C>T rs139030003
NM_001458.4(FLNC):c.7016C>T (p.Thr2339Ile) rs1554401463
NM_001458.4(FLNC):c.7041G>A (p.Leu2347=) rs772789448
NM_001458.4(FLNC):c.7047T>C (p.Ile2349=) rs760345428
NM_001458.4(FLNC):c.7070_7072delCGG (p.Ala2357del) rs1554401479
NM_001458.4(FLNC):c.7075A>G (p.Ile2359Val) rs1554401481
NM_001458.4(FLNC):c.7078G>A (p.Ala2360Thr) rs1390516682
NM_001458.4(FLNC):c.7080A>G (p.Ala2360=) rs1554401489
NM_001458.4(FLNC):c.7091G>A (p.Arg2364His) rs201672146
NM_001458.4(FLNC):c.7107C>T (p.Cys2369=) rs781154278
NM_001458.4(FLNC):c.7108G>A (p.Gly2370Ser) rs201917318
NM_001458.4(FLNC):c.7110C>A (p.Gly2370=) rs770288312
NM_001458.4(FLNC):c.7111G>A (p.Val2371Ile) rs552252122
NM_001458.4(FLNC):c.7123G>A (p.Val2375Ile)
NM_001458.4(FLNC):c.7136-6C>A rs368292177
NM_001458.4(FLNC):c.7138G>C (p.Asp2380His) rs1334300883
NM_001458.4(FLNC):c.7146G>A (p.Glu2382=) rs779162678
NM_001458.4(FLNC):c.7158G>A (p.Lys2386=) rs1554401556
NM_001458.4(FLNC):c.7171C>T (p.His2391Tyr) rs1554401558
NM_001458.4(FLNC):c.7177C>G (p.Pro2393Ala) rs1554401559
NM_001458.4(FLNC):c.7180G>C (p.Asp2394His) rs1554401561
NM_001458.4(FLNC):c.7185C>T (p.Ser2395=) rs199880128
NM_001458.4(FLNC):c.7215G>A (p.Ser2405=) rs774019775
NM_001458.4(FLNC):c.7222G>A (p.Ala2408Thr) rs376257910
NM_001458.4(FLNC):c.7226G>A (p.Arg2409His) rs767279710
NM_001458.4(FLNC):c.7229G>A (p.Arg2410His) rs558239439
NM_001458.4(FLNC):c.7251+1G>A rs1554401581
NM_001458.4(FLNC):c.7281G>A (p.Ala2427=) rs186451916
NM_001458.4(FLNC):c.7289C>T (p.Ala2430Val) rs200516164
NM_001458.4(FLNC):c.7290C>T (p.Ala2430=) rs373240622
NM_001458.4(FLNC):c.7291G>A (p.Val2431Met) rs572952653
NM_001458.4(FLNC):c.7294C>T (p.Gln2432Ter) rs1554401756
NM_001458.4(FLNC):c.7309C>T (p.Arg2437Trp)
NM_001458.4(FLNC):c.7310G>A (p.Arg2437Gln) rs201762568
NM_001458.4(FLNC):c.7313_7330dup (p.Arg2443_Val2444insGlyValIleAspAlaArg) rs1554401762
NM_001458.4(FLNC):c.7319T>C (p.Ile2440Thr) rs764628080
NM_001458.4(FLNC):c.731A>G (p.Asn244Ser)
NM_001458.4(FLNC):c.7328G>A (p.Arg2443Gln) rs370293647
NM_001458.4(FLNC):c.7339C>A (p.Pro2447Thr) rs1554401770
NM_001458.4(FLNC):c.7344G>A (p.Ser2448=)
NM_001458.4(FLNC):c.7353G>A (p.Val2451=) rs368607789
NM_001458.4(FLNC):c.7366G>A (p.Val2456Ile)
NM_001458.4(FLNC):c.7371delT (p.Glu2458Serfs) rs1554401780
NM_001458.4(FLNC):c.7382G>A (p.Ser2461Asn) rs550547714
NM_001458.4(FLNC):c.7385-5C>T rs367793265
NM_001458.4(FLNC):c.7399C>T (p.Arg2467Cys) rs1278916117
NM_001458.4(FLNC):c.7400G>A (p.Arg2467His) rs775910704
NM_001458.4(FLNC):c.7432A>G (p.Ile2478Val) rs1430261045
NM_001458.4(FLNC):c.7449C>T (p.Asn2483=) rs761006044
NM_001458.4(FLNC):c.7450G>A (p.Gly2484Ser) rs778922568
NM_001458.4(FLNC):c.7455C>G (p.Ala2485=) rs1554401819
NM_001458.4(FLNC):c.7462C>T (p.Pro2488Ser)
NM_001458.4(FLNC):c.7484G>A (p.Arg2495His) rs757219498
NM_001458.4(FLNC):c.7496_7497insTGCT (p.Gln2499Hisfs) rs1554401830
NM_001458.4(FLNC):c.7499G>A (p.Ser2500Asn)
NM_001458.4(FLNC):c.7533C>T (p.Tyr2511=) rs376806697
NM_001458.4(FLNC):c.7536_7548delTCCTGGGCTCGAG (p.Pro2513Glufs) rs1554401837
NM_001458.4(FLNC):c.7545C>T (p.Leu2515=) rs369791058
NM_001458.4(FLNC):c.7546G>A (p.Glu2516Lys)
NM_001458.4(FLNC):c.7560C>T (p.Thr2520=) rs527921534
NM_001458.4(FLNC):c.7580T>C (p.Ile2527Thr)
NM_001458.4(FLNC):c.7604C>T (p.Ser2535Leu)
NM_001458.4(FLNC):c.7605G>A (p.Ser2535=)
NM_001458.4(FLNC):c.7610C>A (p.Ala2537Asp) rs1394723230
NM_001458.4(FLNC):c.7614G>T (p.Leu2538Phe) rs180834558
NM_001458.4(FLNC):c.7618G>C (p.Val2540Leu) rs746349463
NM_001458.4(FLNC):c.7626T>C (p.Ile2542=) rs1554401890
NM_001458.4(FLNC):c.7626T>G (p.Ile2542Met)
NM_001458.4(FLNC):c.7632C>T (p.Gly2544=) rs1297781614
NM_001458.4(FLNC):c.7636T>A (p.Ser2546Thr)
NM_001458.4(FLNC):c.7651G>C (p.Asp2551His) rs1187923021
NM_001458.4(FLNC):c.7657C>T (p.Arg2553Trp)
NM_001458.4(FLNC):c.7658G>A (p.Arg2553Gln)
NM_001458.4(FLNC):c.7659G>C (p.Arg2553=) rs1490653520
NM_001458.4(FLNC):c.7693C>T (p.Pro2565Ser) rs1554401906
NM_001458.4(FLNC):c.76A>G (p.Lys26Glu)
NM_001458.4(FLNC):c.7727A>C (p.Lys2576Thr) rs1554401912
NM_001458.4(FLNC):c.7732G>A (p.Gly2578Ser) rs566747845
NM_001458.4(FLNC):c.774delC (p.Lys259Argfs) rs1554397506
NM_001458.4(FLNC):c.7780+10A>G rs201149834
NM_001458.4(FLNC):c.7781-3C>T rs1444704657
NM_001458.4(FLNC):c.7785G>A (p.Pro2595=) rs780670412
NM_001458.4(FLNC):c.7803C>T (p.His2601=) rs749737805
NM_001458.4(FLNC):c.7813G>A (p.Glu2605Lys) rs1480530077
NM_001458.4(FLNC):c.7830G>C (p.Leu2610=) rs1032374300
NM_001458.4(FLNC):c.7834G>A (p.Glu2612Lys) rs1183050599
NM_001458.4(FLNC):c.7862G>A (p.Arg2621Gln) rs201636548
NM_001458.4(FLNC):c.7877G>A (p.Ser2626Asn)
NM_001458.4(FLNC):c.7906A>T (p.Ser2636Cys)
NM_001458.4(FLNC):c.7929delT (p.Leu2645Cysfs) rs1554402015
NM_001458.4(FLNC):c.7933C>T (p.Leu2645=) rs571671091
NM_001458.4(FLNC):c.7947C>T (p.Phe2649=) rs368849358
NM_001458.4(FLNC):c.7948G>A (p.Val2650Met)
NM_001458.4(FLNC):c.7972G>A (p.Val2658Met) rs1269145751
NM_001458.4(FLNC):c.7990+10G>A rs745488329
NM_001458.4(FLNC):c.7990+9C>T rs566679569
NM_001458.4(FLNC):c.8003T>C (p.Met2668Thr) rs200502811
NM_001458.4(FLNC):c.8019C>G (p.His2673Gln)
NM_001458.4(FLNC):c.8020G>A (p.Gly2674Ser)
NM_001458.4(FLNC):c.8049C>T (p.Tyr2683=) rs183104951
NM_001458.4(FLNC):c.805C>T (p.Arg269Ter) rs755583250
NM_001458.4(FLNC):c.8070G>T (p.Arg2690=) rs373087529
NM_001458.4(FLNC):c.8107delG (p.Asp2703Thrfs)
NM_001458.4(FLNC):c.8118C>T (p.Leu2706=) rs28379666
NM_001458.4(FLNC):c.8121T>C (p.Ile2707=) rs28437296
NM_001458.4(FLNC):c.8140dup (p.Ser2714Lysfs) rs1554402084
NM_001458.4(FLNC):c.8178A>G (p.Ter2726Trp)
NM_001458.4(FLNC):c.824C>T (p.Pro275Leu)
NM_001458.4(FLNC):c.851-4G>C rs372747855
NM_001458.4(FLNC):c.851-5C>T rs758216356
NM_001458.4(FLNC):c.851-7C>A rs576908770
NM_001458.4(FLNC):c.874G>A (p.Val292Met)
NM_001458.4(FLNC):c.896_897delCCinsTT (p.Thr299Ile)
NM_001458.4(FLNC):c.907G>A (p.Val303Met) rs1554397562
NM_001458.4(FLNC):c.912C>T (p.Asp304=) rs201239973
NM_001458.4(FLNC):c.919G>A (p.Val307Met) rs763968152
NM_001458.4(FLNC):c.924C>T (p.Gly308=) rs541392206
NM_001458.4(FLNC):c.925G>A (p.Glu309Lys)
NM_001458.4(FLNC):c.949C>A (p.Pro317Thr)
NM_001458.4(FLNC):c.967G>A (p.Glu323Lys)
NM_001458.4(FLNC):c.969+4T>G rs953435954
NM_001458.4(FLNC):c.96G>A (p.Ala32=) rs368239688
NM_001458.4(FLNC):c.970-4A>G rs532143625
NM_001458.4(FLNC):c.970-5A>G rs199755800

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.