ClinVar Miner

List of variants in gene GJA5 reported as likely benign by Illumina Laboratory Services, Illumina

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 8
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NC_000001.11:g.147773393C>T rs35594137 0.19061
NM_005266.7(GJA5):c.-61A>G rs11552588 0.18395
NM_181703.4(GJA5):c.*608C>T rs36005900 0.14728
NM_181703.4(GJA5):c.-27T>C rs2232190 0.01531
NM_181703.4(GJA5):c.369C>T (p.Tyr123=) rs2232191 0.00664
NM_181703.4(GJA5):c.*1396G>A rs886045242 0.00001
NM_005266.6(GJA5):c.-152G= rs791286
NM_181703.4(GJA5):c.*617TGGTATGTACCTCTGGCAAATGCCC[3] rs11267274

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.