ClinVar Miner

List of variants in gene KCNH2 reported as uncertain significance by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 196
Download table as spreadsheet
HGVS dbSNP
NM_000238.3(KCNH2):c.1067G>A (p.Arg356His) rs730880118
NM_000238.3(KCNH2):c.1076T>A (p.Ile359Lys) rs1554427331
NM_000238.3(KCNH2):c.1081C>T (p.Pro361Ser) rs1293901043
NM_000238.3(KCNH2):c.115T>C (p.Cys39Arg) rs757491162
NM_000238.3(KCNH2):c.1181G>A (p.Arg394His)
NM_000238.3(KCNH2):c.1189C>T (p.Arg397Cys) rs1060500663
NM_000238.3(KCNH2):c.1205A>G (p.His402Arg) rs199473506
NM_000238.3(KCNH2):c.1225G>A (p.Val409Met) rs539146547
NM_000238.3(KCNH2):c.1262C>T (p.Thr421Met) rs199472894
NM_000238.3(KCNH2):c.1291T>C (p.Phe431Leu) rs1554426244
NM_000238.3(KCNH2):c.1307C>T (p.Thr436Met) rs199472901
NM_000238.3(KCNH2):c.1325C>T (p.Ala442Val) rs1554426225
NM_000238.3(KCNH2):c.135C>A (p.Asn45Lys)
NM_000238.3(KCNH2):c.1372A>T (p.Ile458Phe) rs374303744
NM_000238.3(KCNH2):c.1459G>A (p.Gly487Ser) rs562875924
NM_000238.3(KCNH2):c.1475A>T (p.His492Leu)
NM_000238.3(KCNH2):c.1500C>A (p.Ile500=) rs147126965
NM_000238.3(KCNH2):c.1525G>A (p.Asp509Asn) rs370637245
NM_000238.3(KCNH2):c.1537T>C (p.Phe513Leu)
NM_000238.3(KCNH2):c.1567C>A (p.Leu523Met) rs1060500671
NM_000238.3(KCNH2):c.1582C>T (p.Arg528Trp) rs864622403
NM_000238.3(KCNH2):c.1591C>T (p.Arg531Trp) rs199472915
NM_000238.3(KCNH2):c.1600C>A (p.Arg534Ser) rs199472916
NM_000238.3(KCNH2):c.1603G>A (p.Val535Met) rs375872367
NM_000238.3(KCNH2):c.1603G>T (p.Val535Leu)
NM_000238.3(KCNH2):c.167G>T (p.Arg56Leu) rs199472845
NM_000238.3(KCNH2):c.1684C>T (p.His562Tyr) rs794728481
NM_000238.3(KCNH2):c.1685A>G (p.His562Arg) rs199472922
NM_000238.3(KCNH2):c.1691T>A (p.Leu564Gln)
NM_000238.3(KCNH2):c.1700T>C (p.Ile567Thr) rs199473519
NM_000238.3(KCNH2):c.1704G>C (p.Trp568Cys) rs199472926
NM_000238.3(KCNH2):c.1711A>G (p.Ile571Val) rs199472928
NM_000238.3(KCNH2):c.1742C>T (p.Ser581Leu)
NM_000238.3(KCNH2):c.1770C>T (p.Gly590=) rs369187892
NM_000238.3(KCNH2):c.1805T>C (p.Leu602Pro) rs876661348
NM_000238.3(KCNH2):c.1808G>A (p.Gly603Asp) rs1554425806
NM_000238.3(KCNH2):c.1814C>T (p.Pro605Leu) rs199472938
NM_000238.3(KCNH2):c.1826A>C (p.Asp609Ala) rs199472940
NM_000238.3(KCNH2):c.1864C>T (p.Leu622Phe) rs199473525
NM_000238.3(KCNH2):c.188C>A (p.Pro63His) rs766379103
NM_000238.3(KCNH2):c.1892C>T (p.Ser631Phe) rs1554425720
NM_000238.3(KCNH2):c.1904A>G (p.Asn635Ser)
NM_000238.3(KCNH2):c.194C>G (p.Thr65Ser) rs878853772
NM_000238.3(KCNH2):c.1963A>G (p.Ile655Val) rs1060500673
NM_000238.3(KCNH2):c.196T>C (p.Cys66Arg) rs199473416
NM_000238.3(KCNH2):c.1973A>G (p.Asn658Ser) rs1057523338
NM_000238.3(KCNH2):c.1979C>T (p.Ser660Leu) rs199472979
NM_000238.3(KCNH2):c.2033T>C (p.Leu678Pro) rs199472981
NM_000238.3(KCNH2):c.2035C>T (p.Arg679Trp)
NM_000238.3(KCNH2):c.2053C>T (p.Arg685Cys) rs778135438
NM_000238.3(KCNH2):c.2122A>G (p.Thr708Ala) rs1554425463
NM_000238.3(KCNH2):c.2145G>A (p.Ala715=) rs794728384
NM_000238.3(KCNH2):c.215C>G (p.Pro72Arg) rs199473421
NM_000238.3(KCNH2):c.2171T>C (p.Leu724Pro) rs1554425307
NM_000238.3(KCNH2):c.2204C>T (p.Ser735Leu) rs199472988
NM_000238.3(KCNH2):c.2222A>G (p.Lys741Arg)
NM_000238.3(KCNH2):c.2245G>T (p.Gly749Cys) rs1060500668
NM_000238.3(KCNH2):c.2291C>T (p.Pro764Leu) rs878853773
NM_000238.3(KCNH2):c.2312A>G (p.His771Arg) rs1060500659
NM_000238.3(KCNH2):c.235G>T (p.Ala79Ser) rs794728494
NM_000238.3(KCNH2):c.2360T>A (p.Ile787Asn) rs794728387
NM_000238.3(KCNH2):c.2376C>T (p.Gly792=) rs745993706
NM_000238.3(KCNH2):c.2405A>G (p.Asn802Ser) rs863224632
NM_000238.3(KCNH2):c.243G>C (p.Gln81His) rs199472849
NM_000238.3(KCNH2):c.2536C>T (p.Pro846Ser) rs199473006
NM_000238.3(KCNH2):c.2537C>T (p.Pro846Leu) rs1060500669
NM_000238.3(KCNH2):c.253G>A (p.Ala85Thr) rs199472850
NM_000238.3(KCNH2):c.2626G>A (p.Glu876Lys) rs1554424688
NM_000238.3(KCNH2):c.2653C>T (p.Arg885Cys) rs143512106
NM_000238.3(KCNH2):c.2654G>A (p.Arg885His) rs202194495
NM_000238.3(KCNH2):c.2659C>T (p.Arg887Cys) rs140279503
NM_000238.3(KCNH2):c.2660G>A (p.Arg887His) rs199473432
NM_000238.3(KCNH2):c.2684C>T (p.Thr895Met) rs199473434
NM_000238.3(KCNH2):c.2692+7C>T
NM_000238.3(KCNH2):c.2692_2692+1insACACGG
NM_000238.3(KCNH2):c.2696C>G (p.Thr899Arg) rs1480554629
NM_000238.3(KCNH2):c.26C>T (p.Ala9Val) rs775317201
NM_000238.3(KCNH2):c.2707G>A (p.Gly903Arg) rs199473669
NM_000238.3(KCNH2):c.2717C>T (p.Ser906Leu) rs199473435
NM_000238.3(KCNH2):c.2729C>T (p.Pro910Leu) rs199473436
NM_000238.3(KCNH2):c.2730G>A (p.Pro910=) rs916754925
NM_000238.3(KCNH2):c.2735G>A (p.Arg912Gln) rs958442820
NM_000238.3(KCNH2):c.2750C>T (p.Pro917Leu) rs76420733
NM_000238.3(KCNH2):c.2758C>G (p.Arg920Gly) rs199473438
NM_000238.3(KCNH2):c.2758C>T (p.Arg920Trp) rs199473438
NM_000238.3(KCNH2):c.2765G>A (p.Arg922Gln) rs199473439
NM_000238.3(KCNH2):c.2768C>T (p.Pro923Leu)
NM_000238.3(KCNH2):c.2770G>A (p.Gly924Arg) rs794728397
NM_000238.3(KCNH2):c.2770G>T (p.Gly924Trp) rs794728397
NM_000238.3(KCNH2):c.2771G>C (p.Gly924Ala) rs199473009
NM_000238.3(KCNH2):c.2780G>T (p.Trp927Leu) rs794728399
NM_000238.3(KCNH2):c.2810G>A (p.Ser937Asn) rs199473540
NM_000238.3(KCNH2):c.2832G>T (p.Glu944Asp) rs1232364499
NM_000238.3(KCNH2):c.2860C>T (p.Arg954Cys) rs141401803
NM_000238.3(KCNH2):c.2861G>A (p.Arg954His) rs772977598
NM_000238.3(KCNH2):c.2863C>G (p.Leu955Val) rs199473012
NM_000238.3(KCNH2):c.2900C>T (p.Pro967Leu) rs199473016
NM_000238.3(KCNH2):c.2902C>G (p.Pro968Ala) rs753788508
NM_000238.3(KCNH2):c.2930G>T (p.Cys977Phe) rs767252448
NM_000238.3(KCNH2):c.2944G>A (p.Asp982Asn) rs569452580
NM_000238.3(KCNH2):c.2948C>T (p.Thr983Ile) rs149955375
NM_000238.3(KCNH2):c.2954A>G (p.Asn985Ser) rs199473541
NM_000238.3(KCNH2):c.3007G>A (p.Asp1003Asn) rs794728402
NM_000238.3(KCNH2):c.3020G>A (p.Arg1007His) rs199473542
NM_000238.3(KCNH2):c.3049G>T (p.Ala1017Ser)
NM_000238.3(KCNH2):c.3061A>G (p.Ser1021Gly)
NM_000238.3(KCNH2):c.3087_3096delCCCGGGTCGGinsGC (p.Ser1029Argfs) rs1554424085
NM_000238.3(KCNH2):c.3094C>T (p.Arg1032Trp)
NM_000238.3(KCNH2):c.3095G>A (p.Arg1032Gln) rs199473020
NM_000238.3(KCNH2):c.3097C>T (p.Arg1033Trp) rs199473021
NM_000238.3(KCNH2):c.3098G>A (p.Arg1033Gln) rs750858069
NM_000238.3(KCNH2):c.3099_3109delGCCCCGGGGCG (p.Pro1034Argfs) rs794728466
NM_000238.3(KCNH2):c.3103C>T (p.Arg1035Trp) rs199473543
NM_000238.3(KCNH2):c.3104G>A (p.Arg1035Gln) rs761933920
NM_000238.3(KCNH2):c.3107_3127delGCGACGTGGAGAGCAGGCTGG (p.Gly1036_Leu1042del) rs1064792917
NM_000238.3(KCNH2):c.3108C>T (p.Gly1036=) rs373414022
NM_000238.3(KCNH2):c.3112G>A (p.Val1038Met) rs199473544
NM_000238.3(KCNH2):c.3112G>T (p.Val1038Leu) rs199473544
NM_000238.3(KCNH2):c.312C>G (p.Ser104Arg) rs1554428245
NM_000238.3(KCNH2):c.3139C>T (p.Arg1047Cys) rs377095107
NM_000238.3(KCNH2):c.3153-3C>T rs1165322354
NM_000238.3(KCNH2):c.3161C>T (p.Thr1054Ile) rs1554423904
NM_000238.3(KCNH2):c.3163C>T (p.Arg1055Trp) rs541259035
NM_000238.3(KCNH2):c.3164G>A (p.Arg1055Gln) rs41307270
NM_000238.3(KCNH2):c.3172G>A (p.Ala1058Thr) rs555269990
NM_000238.3(KCNH2):c.3229G>A (p.Ala1077Thr) rs201382073
NM_000238.3(KCNH2):c.3233A>G (p.Tyr1078Cys) rs199473029
NM_000238.3(KCNH2):c.3251C>T (p.Pro1084Leu) rs762510312
NM_000238.3(KCNH2):c.3279_3303delGCTGTTGCCCGTCAGCCCCCTCCCC (p.Leu1094Profs) rs1554423720
NM_000238.3(KCNH2):c.3286C>A (p.Pro1096Thr) rs1554423737
NM_000238.3(KCNH2):c.3289G>A (p.Val1097Ile) rs199473030
NM_000238.3(KCNH2):c.3296C>T (p.Pro1099Leu) rs1339742380
NM_000238.3(KCNH2):c.3301C>T (p.Pro1101Ser) rs1347039291
NM_000238.3(KCNH2):c.3350G>T (p.Cys1117Phe)
NM_000238.3(KCNH2):c.3365C>T (p.Pro1122Leu) rs531460655
NM_000238.3(KCNH2):c.3394C>G (p.Pro1132Ala) rs786205422
NM_000238.3(KCNH2):c.343G>A (p.Val115Met) rs150988911
NM_000238.3(KCNH2):c.3448C>A (p.Leu1150Met) rs754883792
NM_000238.3(KCNH2):c.3457C>T (p.His1153Tyr) rs199473035
NM_000238.3(KCNH2):c.3460G>A (p.Gly1154Ser) rs199473548
NM_000238.3(KCNH2):c.3464C>T (p.Ser1155Leu)
NM_000238.3(KCNH2):c.3469C>T (p.Pro1157Ser) rs1449906095
NM_000238.3(KCNH2):c.348_350delGAA (p.Lys116del) rs864622157
NM_000238.3(KCNH2):c.355G>C (p.Asp119His) rs376308069
NM_000238.3(KCNH2):c.383A>G (p.Asn128Ser) rs200343670
NM_000238.3(KCNH2):c.388G>A (p.Glu130Lys) rs199472863
NM_000238.3(KCNH2):c.423G>A (p.Pro141=) rs148483769
NM_000238.3(KCNH2):c.431A>T (p.Asp144Val) rs146284716
NM_000238.3(KCNH2):c.443G>A (p.Arg148Gln)
NM_000238.3(KCNH2):c.446G>C (p.Gly149Ala) rs199472865
NM_000238.3(KCNH2):c.451C>G (p.Pro151Ala) rs1060500674
NM_000238.3(KCNH2):c.491G>A (p.Arg164His) rs199472866
NM_000238.3(KCNH2):c.523G>A (p.Ala175Thr)
NM_000238.3(KCNH2):c.524C>A (p.Ala175Asp) rs776541110
NM_000238.3(KCNH2):c.545C>G (p.Ser182Trp) rs1057517742
NM_000238.3(KCNH2):c.555_569delGGGCGGCGCGGGCGC (p.Gly186_Ala190del) rs1554427907
NM_000238.3(KCNH2):c.55A>T (p.Ile19Phe) rs1554431444
NM_000238.3(KCNH2):c.560_568dupGCGCGGGCG (p.Gly189_Ala190insGlyAlaGly) rs551056698
NM_000238.3(KCNH2):c.563C>T (p.Ala188Val) rs794728356
NM_000238.3(KCNH2):c.568G>A (p.Ala190Thr) rs150817714
NM_000238.3(KCNH2):c.607G>A (p.Ala203Thr) rs199472868
NM_000238.3(KCNH2):c.617_618delGCinsTT (p.Ser206Ile) rs1060500660
NM_000238.3(KCNH2):c.647C>T (p.Thr216Ile)
NM_000238.3(KCNH2):c.652A>G (p.Met218Val) rs199472869
NM_000238.3(KCNH2):c.682G>C (p.Ala228Pro) rs989191027
NM_000238.3(KCNH2):c.707G>T (p.Gly236Val) rs199472870
NM_000238.3(KCNH2):c.710C>A (p.Pro237His) rs1554427821
NM_000238.3(KCNH2):c.725_726delGCinsAA (p.Arg242Gln) rs1554427803
NM_000238.3(KCNH2):c.731C>T (p.Ala244Val) rs748762712
NM_000238.3(KCNH2):c.751C>T (p.Pro251Ser) rs199472873
NM_000238.3(KCNH2):c.755G>A (p.Arg252Gln) rs730880117
NM_000238.3(KCNH2):c.77-3_77-2dupTA rs1554431003
NM_000238.3(KCNH2):c.77-5C>A rs72549419
NM_000238.3(KCNH2):c.775G>A (p.Asp259Asn) rs199472876
NM_000238.3(KCNH2):c.779C>T (p.Ala260Val)
NM_000238.3(KCNH2):c.817C>A (p.Arg273=) rs552583527
NM_000238.3(KCNH2):c.823A>C (p.Ser275Arg)
NM_000238.3(KCNH2):c.853G>A (p.Ala285Thr) rs864622366
NM_000238.3(KCNH2):c.865G>A (p.Glu289Lys) rs199472880
NM_000238.3(KCNH2):c.872T>G (p.Met291Arg) rs199472881
NM_000238.3(KCNH2):c.881G>T (p.Gly294Val) rs199473549
NM_000238.3(KCNH2):c.889C>T (p.Pro297Ser) rs199472882
NM_000238.3(KCNH2):c.89T>C (p.Ile30Thr) rs199472832
NM_000238.3(KCNH2):c.925C>T (p.His309Tyr) rs1241849013
NM_000238.3(KCNH2):c.934C>T (p.Arg312Cys) rs199472885
NM_000238.3(KCNH2):c.935G>A (p.Arg312His) rs747313232
NM_000238.3(KCNH2):c.950A>G (p.Asn317Ser) rs779027664
NM_000238.3(KCNH2):c.967G>A (p.Asp323Asn) rs199472887
NM_000238.3(KCNH2):c.973G>A (p.Val325Met) rs149381387
NM_000238.3(KCNH2):c.983G>A (p.Arg328His) rs747437736
NM_172056.2(KCNH2):c.1884_1894delCAACGTCTCTCinsTGAAG (p.Asn629_Pro632delinsGluAla)
NM_172057.2(KCNH2):c.108G>C (p.Glu36Asp) rs1060500666
NM_172057.2(KCNH2):c.2078_2080dup (p.Arg693_Pro694insArg) rs1060499872
NM_172057.2(KCNH2):c.2080_2086dup (p.Gly696Alafs) rs1554424062
NM_172057.2(KCNH2):c.5C>T (p.Ala2Val) rs1060500667
NM_172057.2(KCNH2):c.62G>A (p.Gly21Asp) rs1167016668

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.