ClinVar Miner

List of variants in gene KCNQ3

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 397
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 8q24.22(chr8:133226397-133306801)x1
NM_001204824.1(KCNQ3):c.-32977G>C rs796052673
NM_001204824.1(KCNQ3):c.-33014A>G rs143194379
NM_001204824.1(KCNQ3):c.-33067G>A rs587781012
NM_001204824.1(KCNQ3):c.-33250C>A rs1057522486
NM_001204824.1(KCNQ3):c.-33272C>T rs796052672
NM_001204824.1(KCNQ3):c.-33319G>C rs796052671
NM_001204824.1(KCNQ3):c.1043A>G (p.Asn348Ser) rs118192252
NM_001204824.1(KCNQ3):c.1061C>T (p.Thr354Met) rs757583944
NM_001204824.1(KCNQ3):c.1147G>A (p.Gly383Arg) rs773584143
NM_001204824.1(KCNQ3):c.117+5G>A rs373813381
NM_001204824.1(KCNQ3):c.1178C>T (p.Pro393Leu) rs768520561
NM_001204824.1(KCNQ3):c.118-15T>C rs1057520808
NM_001204824.1(KCNQ3):c.1209-11T>A rs1057520865
NM_001204824.1(KCNQ3):c.1231A>G (p.Lys411Glu) rs796052681
NM_001204824.1(KCNQ3):c.1278G>A (p.Val426=) rs765209359
NM_001204824.1(KCNQ3):c.1360C>A (p.Pro454Thr) rs74582884
NM_001204824.1(KCNQ3):c.1440-10T>C rs774538909
NM_001204824.1(KCNQ3):c.1440-12G>A rs761923188
NM_001204824.1(KCNQ3):c.1440-13C>T rs772137862
NM_001204824.1(KCNQ3):c.1490G>C (p.Ser497Thr) rs758002609
NM_001204824.1(KCNQ3):c.1525G>T (p.Val509Phe) rs185511111
NM_001204824.1(KCNQ3):c.1575A>G (p.Gln525=) rs587781011
NM_001204824.1(KCNQ3):c.1768T>C (p.Tyr590His) rs181746838
NM_001204824.1(KCNQ3):c.1784A>G (p.His595Arg) rs112314858
NM_001204824.1(KCNQ3):c.1834G>A (p.Ala612Thr) rs796052682
NM_001204824.1(KCNQ3):c.1970G>A (p.Arg657Gln) rs201328910
NM_001204824.1(KCNQ3):c.1991G>A (p.Arg664Gln) rs754896169
NM_001204824.1(KCNQ3):c.202C>T (p.Arg68Trp) rs754551218
NM_001204824.1(KCNQ3):c.2083G>T (p.Asp695Tyr) rs530506549
NM_001204824.1(KCNQ3):c.2131C>T (p.Arg711Trp) rs185628977
NM_001204824.1(KCNQ3):c.2202G>A (p.Ser734=) rs201736771
NM_001204824.1(KCNQ3):c.2254A>G (p.Ile752Val) rs199682667
NM_001204824.1(KCNQ3):c.418-17A>C rs373349894
NM_001204824.1(KCNQ3):c.429G>A (p.Thr143=) rs762086066
NM_001204824.1(KCNQ3):c.437A>G (p.Tyr146Cys) rs796052677
NM_001204824.1(KCNQ3):c.553G>T (p.Asp185Tyr) rs1085307996
NM_001204824.1(KCNQ3):c.557C>T (p.Ala186Val) rs796052678
NM_001204824.1(KCNQ3):c.563G>C (p.Trp188Ser) rs1064794632
NM_001204824.1(KCNQ3):c.594C>A (p.Gly198=) rs143224896
NM_001204824.1(KCNQ3):c.683C>T (p.Ala228Val) rs796052679
NM_001204824.1(KCNQ3):c.700G>T (p.Gly234Trp) rs796052680
NM_001204824.1(KCNQ3):c.717G>A (p.Val239=) rs750375617
NM_001204824.1(KCNQ3):c.781-3C>T rs377479583
NM_001204824.1(KCNQ3):c.866C>G (p.Pro289Arg) rs149272208
NM_001204824.1(KCNQ3):c.986A>T (p.Asn329Ile) rs193920887
NM_004519.2(KCNQ3):c.679C>T (p.Arg227Ter) rs796052675
NM_004519.3(KCNQ3):c.*1050A>C rs76720699
NM_004519.3(KCNQ3):c.*1066A>G rs886062681
NM_004519.3(KCNQ3):c.*1159G>A rs117218884
NM_004519.3(KCNQ3):c.*1383C>T rs146987908
NM_004519.3(KCNQ3):c.*1384G>A rs528989294
NM_004519.3(KCNQ3):c.*1407A>C rs76570743
NM_004519.3(KCNQ3):c.*1478G>A rs886062680
NM_004519.3(KCNQ3):c.*1582C>T rs140360332
NM_004519.3(KCNQ3):c.*1676T>C rs574831064
NM_004519.3(KCNQ3):c.*1697C>G rs71526238
NM_004519.3(KCNQ3):c.*1754C>T rs977939
NM_004519.3(KCNQ3):c.*2010T>A rs139631143
NM_004519.3(KCNQ3):c.*2013C>T rs886062679
NM_004519.3(KCNQ3):c.*2137C>T rs2272679
NM_004519.3(KCNQ3):c.*2166A>G rs35279095
NM_004519.3(KCNQ3):c.*2266_*2269delCTTT rs886062678
NM_004519.3(KCNQ3):c.*2271T>A rs149825293
NM_004519.3(KCNQ3):c.*2385_*2388delAGTA rs763323782
NM_004519.3(KCNQ3):c.*2475C>T rs141143602
NM_004519.3(KCNQ3):c.*2847T>C rs138023368
NM_004519.3(KCNQ3):c.*2876C>G rs572963665
NM_004519.3(KCNQ3):c.*2921T>C rs886062676
NM_004519.3(KCNQ3):c.*3032A>G rs2469626
NM_004519.3(KCNQ3):c.*3035A>G rs2469627
NM_004519.3(KCNQ3):c.*3165G>T rs567074601
NM_004519.3(KCNQ3):c.*3216G>C rs886062675
NM_004519.3(KCNQ3):c.*3217C>T rs886062674
NM_004519.3(KCNQ3):c.*3261C>T rs181166117
NM_004519.3(KCNQ3):c.*3262G>A rs866041778
NM_004519.3(KCNQ3):c.*3280G>C rs550558851
NM_004519.3(KCNQ3):c.*3303C>A rs571392133
NM_004519.3(KCNQ3):c.*3544A>G rs61190986
NM_004519.3(KCNQ3):c.*3591T>C rs778136645
NM_004519.3(KCNQ3):c.*3597G>A rs1025436
NM_004519.3(KCNQ3):c.*3672C>T rs886062673
NM_004519.3(KCNQ3):c.*3692T>C rs886062672
NM_004519.3(KCNQ3):c.*3701G>A rs576940686
NM_004519.3(KCNQ3):c.*3731G>T rs117524261
NM_004519.3(KCNQ3):c.*3805C>T rs886062671
NM_004519.3(KCNQ3):c.*3823G>A rs17651980
NM_004519.3(KCNQ3):c.*3897C>G rs191691741
NM_004519.3(KCNQ3):c.*3957A>G rs16904601
NM_004519.3(KCNQ3):c.*396A>G rs78243592
NM_004519.3(KCNQ3):c.*3977G>A rs2469628
NM_004519.3(KCNQ3):c.*4008G>A rs886062670
NM_004519.3(KCNQ3):c.*4027G>A rs529880251
NM_004519.3(KCNQ3):c.*4043C>T rs117527951
NM_004519.3(KCNQ3):c.*4125T>C rs2163608
NM_004519.3(KCNQ3):c.*4243A>T rs2436131
NM_004519.3(KCNQ3):c.*4258T>C rs113937538
NM_004519.3(KCNQ3):c.*425C>A rs10956641
NM_004519.3(KCNQ3):c.*426C>G rs10956640
NM_004519.3(KCNQ3):c.*4316delC rs61438560
NM_004519.3(KCNQ3):c.*4479C>T rs886062669
NM_004519.3(KCNQ3):c.*4481C>A rs886062668
NM_004519.3(KCNQ3):c.*4551T>C rs184864538
NM_004519.3(KCNQ3):c.*4736G>A rs114070302
NM_004519.3(KCNQ3):c.*4746_*4747insACAG rs112550767
NM_004519.3(KCNQ3):c.*4817G>A rs76758430
NM_004519.3(KCNQ3):c.*4949G>T rs561176499
NM_004519.3(KCNQ3):c.*4958A>G rs1437824
NM_004519.3(KCNQ3):c.*4982A>T rs545252668
NM_004519.3(KCNQ3):c.*4982delA rs35772668
NM_004519.3(KCNQ3):c.*5018C>G rs534993423
NM_004519.3(KCNQ3):c.*5255T>C rs146830560
NM_004519.3(KCNQ3):c.*5391C>T rs569024726
NM_004519.3(KCNQ3):c.*5466T>A rs886062667
NM_004519.3(KCNQ3):c.*5482A>G rs192695801
NM_004519.3(KCNQ3):c.*5521C>T rs886062666
NM_004519.3(KCNQ3):c.*5578A>G rs148780224
NM_004519.3(KCNQ3):c.*5580G>A rs886062665
NM_004519.3(KCNQ3):c.*5704C>T rs145396746
NM_004519.3(KCNQ3):c.*5719C>T rs11786417
NM_004519.3(KCNQ3):c.*5761C>T rs746747886
NM_004519.3(KCNQ3):c.*5762G>A rs77343115
NM_004519.3(KCNQ3):c.*5932A>C rs2436130
NM_004519.3(KCNQ3):c.*5965T>C rs537622929
NM_004519.3(KCNQ3):c.*6174A>G rs116373101
NM_004519.3(KCNQ3):c.*6199C>T rs183259250
NM_004519.3(KCNQ3):c.*6205G>T rs886062664
NM_004519.3(KCNQ3):c.*6238T>C rs10108362
NM_004519.3(KCNQ3):c.*6267T>C rs548690680
NM_004519.3(KCNQ3):c.*6282A>T rs10095295
NM_004519.3(KCNQ3):c.*6340G>A rs2469629
NM_004519.3(KCNQ3):c.*6351A>G rs781738692
NM_004519.3(KCNQ3):c.*6446delA rs35153843
NM_004519.3(KCNQ3):c.*6460C>T rs763946605
NM_004519.3(KCNQ3):c.*6461G>A rs886062663
NM_004519.3(KCNQ3):c.*6607A>G rs751961648
NM_004519.3(KCNQ3):c.*6632T>C rs9297840
NM_004519.3(KCNQ3):c.*6812A>G rs7815106
NM_004519.3(KCNQ3):c.*6831G>A rs529301177
NM_004519.3(KCNQ3):c.*6874C>G rs2436129
NM_004519.3(KCNQ3):c.*6956A>G rs2469630
NM_004519.3(KCNQ3):c.*7015G>A rs886062662
NM_004519.3(KCNQ3):c.*7033T>C rs2436128
NM_004519.3(KCNQ3):c.*7075A>G rs2436127
NM_004519.3(KCNQ3):c.*7095T>G rs1437823
NM_004519.3(KCNQ3):c.*7119C>T rs2436126
NM_004519.3(KCNQ3):c.*7131G>A rs75865310
NM_004519.3(KCNQ3):c.*7143A>G rs2436125
NM_004519.3(KCNQ3):c.*716_*717insAACA rs886062688
NM_004519.3(KCNQ3):c.*7214G>A rs150753935
NM_004519.3(KCNQ3):c.*7221C>T rs2436124
NM_004519.3(KCNQ3):c.*7243C>G rs886062661
NM_004519.3(KCNQ3):c.*732A>G rs886062687
NM_004519.3(KCNQ3):c.*7331A>G rs557322356
NM_004519.3(KCNQ3):c.*7371T>G rs76268875
NM_004519.3(KCNQ3):c.*7413G>C rs111267263
NM_004519.3(KCNQ3):c.*743C>T rs886062686
NM_004519.3(KCNQ3):c.*7464C>A rs35604597
NM_004519.3(KCNQ3):c.*747_*754dupCACACACA rs35230760
NM_004519.3(KCNQ3):c.*7504C>G rs532052931
NM_004519.3(KCNQ3):c.*7506C>T rs11785257
NM_004519.3(KCNQ3):c.*7512T>G rs886062660
NM_004519.3(KCNQ3):c.*751_*754delCACA rs35230760
NM_004519.3(KCNQ3):c.*751_*754dupCACA rs35230760
NM_004519.3(KCNQ3):c.*753_*754delCA rs35230760
NM_004519.3(KCNQ3):c.*753_*754dupCA rs35230760
NM_004519.3(KCNQ3):c.*755_*758delTACA rs886062684
NM_004519.3(KCNQ3):c.*755_*760delTACACA rs886062683
NM_004519.3(KCNQ3):c.*759_*760delCA rs886062682
NM_004519.3(KCNQ3):c.*7689A>G rs142621198
NM_004519.3(KCNQ3):c.*7722T>A rs138128512
NM_004519.3(KCNQ3):c.*7980dupT rs886062659
NM_004519.3(KCNQ3):c.*8148G>A rs1437822
NM_004519.3(KCNQ3):c.*828T>C rs79953574
NM_004519.3(KCNQ3):c.*9A>G rs1057523827
NM_004519.3(KCNQ3):c.-130_-129dupGG rs886062694
NM_004519.3(KCNQ3):c.-134dupG rs886062695
NM_004519.3(KCNQ3):c.-135_-134dupGG rs886062695
NM_004519.3(KCNQ3):c.-136_-134dupGGG rs886062695
NM_004519.3(KCNQ3):c.-138T>G rs868425061
NM_004519.3(KCNQ3):c.-138delT rs886062696
NM_004519.3(KCNQ3):c.-139dupG rs879019805
NM_004519.3(KCNQ3):c.-140_-139dupGG rs879019805
NM_004519.3(KCNQ3):c.-140_-139insTG rs886062697
NM_004519.3(KCNQ3):c.-141_-139dupGGG rs879019805
NM_004519.3(KCNQ3):c.-142G>T rs28606540
NM_004519.3(KCNQ3):c.-148_-147insTG rs886062698
NM_004519.3(KCNQ3):c.-156C>T rs886062699
NM_004519.3(KCNQ3):c.-54C>G rs772067108
NM_004519.3(KCNQ3):c.-65C>T rs180674534
NM_004519.3(KCNQ3):c.-7G>C rs745345051
NM_004519.3(KCNQ3):c.-85C>T rs765522706
NM_004519.3(KCNQ3):c.1000G>A (p.Ala334Thr) rs1381851622
NM_004519.3(KCNQ3):c.1005C>A (p.Thr335=) rs758511572
NM_004519.3(KCNQ3):c.1026C>T (p.Ser342=) rs1057524036
NM_004519.3(KCNQ3):c.1032T>C (p.Phe344=) rs1554627208
NM_004519.3(KCNQ3):c.1044+7A>G rs1437816175
NM_004519.3(KCNQ3):c.1045-4C>T rs777650536
NM_004519.3(KCNQ3):c.1059C>T (p.Ser353=) rs35413925
NM_004519.3(KCNQ3):c.105_106invGG (p.Ala36Pro)
NM_004519.3(KCNQ3):c.1060G>A (p.Gly354Arg) rs796052680
NM_004519.3(KCNQ3):c.1067C>T (p.Ala356Val) rs1554627025
NM_004519.3(KCNQ3):c.1071C>G (p.Leu357=) rs17575754
NM_004519.3(KCNQ3):c.1078C>T (p.Gln360Ter) rs1554627019
NM_004519.3(KCNQ3):c.1119G>A (p.Lys373=) rs148581537
NM_004519.3(KCNQ3):c.1142C>T (p.Ala381Val) rs1554626549
NM_004519.3(KCNQ3):c.116_148dup (p.Asp49_Val50insGluGluArgLysValGlyLeuAlaProGlyAsp)
NM_004519.3(KCNQ3):c.1178T>C (p.Ile393Thr)
NM_004519.3(KCNQ3):c.1199G>A (p.Arg400Lys) rs943073757
NM_004519.3(KCNQ3):c.1209A>G (p.Glu403=) rs1554626530
NM_004519.3(KCNQ3):c.1215C>T (p.Val405=) rs370250223
NM_004519.3(KCNQ3):c.1216G>A (p.Val406Ile) rs144474368
NM_004519.3(KCNQ3):c.1236-16C>T rs201168632
NM_004519.3(KCNQ3):c.1241A>G (p.Glu414Gly) rs2303995
NM_004519.3(KCNQ3):c.1248G>A (p.Leu416=) rs913811509
NM_004519.3(KCNQ3):c.1249_1250delGAinsAT (p.Glu417Met) rs1554625699
NM_004519.3(KCNQ3):c.127G>A (p.Val43Met) rs794726918
NM_004519.3(KCNQ3):c.12G>A (p.Lys4=) rs1554660855
NM_004519.3(KCNQ3):c.132G>C (p.Gly44=) rs762808143
NM_004519.3(KCNQ3):c.1391T>C (p.Val464Ala) rs143664009
NM_004519.3(KCNQ3):c.141C>T (p.Pro47=) rs563366275
NM_004519.3(KCNQ3):c.1430G>A (p.Arg477His) rs141821338
NM_004519.3(KCNQ3):c.1443C>T (p.Tyr481=)
NM_004519.3(KCNQ3):c.1458T>A (p.Ser486Arg) rs886043116
NM_004519.3(KCNQ3):c.145G>A (p.Asp49Asn) rs886062693
NM_004519.3(KCNQ3):c.1470C>G (p.Ala490=) rs765705898
NM_004519.3(KCNQ3):c.1471G>A (p.Gly491Arg) rs201552546
NM_004519.3(KCNQ3):c.1525G>A (p.Glu509Lys)
NM_004519.3(KCNQ3):c.1529A>C (p.Asp510Ala) rs1554622841
NM_004519.3(KCNQ3):c.1531A>G (p.Met511Val) rs200219106
NM_004519.3(KCNQ3):c.1543C>G (p.Leu515Val) rs368013249
NM_004519.3(KCNQ3):c.1548G>A (p.Lys516=) rs994157818
NM_004519.3(KCNQ3):c.1549G>A (p.Ala517Thr) rs1554622834
NM_004519.3(KCNQ3):c.154C>G (p.Gln52Glu) rs1327292650
NM_004519.3(KCNQ3):c.1551C>T (p.Ala517=) rs35538317
NM_004519.3(KCNQ3):c.1552G>A (p.Ala518Thr) rs745463637
NM_004519.3(KCNQ3):c.1562C>G (p.Ala521Gly) rs1057518505
NM_004519.3(KCNQ3):c.1563C>T (p.Ala521=) rs186310292
NM_004519.3(KCNQ3):c.1564G>A (p.Val522Ile) rs143683496
NM_004519.3(KCNQ3):c.1568+12A>G rs181790623
NM_004519.3(KCNQ3):c.1568+14G>A rs370848714
NM_004519.3(KCNQ3):c.1599dupA (p.Phe534Ilefs) rs762289015
NM_004519.3(KCNQ3):c.1617G>A (p.Arg539=) rs140607300
NM_004519.3(KCNQ3):c.1617G>C (p.Arg539Ser) rs140607300
NM_004519.3(KCNQ3):c.1623C>T (p.Tyr541=) rs138900075
NM_004519.3(KCNQ3):c.1626T>C (p.Asp542=) rs145098530
NM_004519.3(KCNQ3):c.1656C>T (p.Ala552=) rs199722269
NM_004519.3(KCNQ3):c.1677C>A (p.Ser559=) rs377613824
NM_004519.3(KCNQ3):c.1685dup (p.Tyr563Valfs)
NM_004519.3(KCNQ3):c.168G>C (p.Ala56=) rs777374664
NM_004519.3(KCNQ3):c.1694A>G (p.Gln565Arg) rs1003860988
NM_004519.3(KCNQ3):c.1700+12A>C rs1035669898
NM_004519.3(KCNQ3):c.1700+3G>A rs115092422
NM_004519.3(KCNQ3):c.1701-17C>T rs375928058
NM_004519.3(KCNQ3):c.1701-4T>C rs1060503978
NM_004519.3(KCNQ3):c.1709T>C (p.Met570Thr) rs199999939
NM_004519.3(KCNQ3):c.170T>C (p.Leu57Pro) rs886062692
NM_004519.3(KCNQ3):c.1715dupT (p.Thr573Hisfs) rs796052684
NM_004519.3(KCNQ3):c.1720C>T (p.Pro574Ser) rs74582884
NM_004519.3(KCNQ3):c.1722T>C (p.Pro574=) rs1554622049
NM_004519.3(KCNQ3):c.1737G>A (p.Thr579=) rs574981327
NM_004519.3(KCNQ3):c.1775C>G (p.Thr592Ser) rs556421495
NM_004519.3(KCNQ3):c.1783T>C (p.Ser595Pro) rs1064796743
NM_004519.3(KCNQ3):c.1799+17T>C rs772154355
NM_004519.3(KCNQ3):c.1799+6G>A rs1554622021
NM_004519.3(KCNQ3):c.1799G>A (p.Arg600Lys) rs1554622023
NM_004519.3(KCNQ3):c.1809A>G (p.Pro603=) rs886062691
NM_004519.3(KCNQ3):c.1810T>A (p.Tyr604Asn) rs1060500606
NM_004519.3(KCNQ3):c.1839C>T (p.Ile613=) rs140045642
NM_004519.3(KCNQ3):c.183C>G (p.Ala61=) rs761977947
NM_004519.3(KCNQ3):c.1885-5dupT rs769845388
NM_004519.3(KCNQ3):c.1885G>A (p.Val629Ile) rs185511111
NM_004519.3(KCNQ3):c.1885G>C (p.Val629Leu) rs185511111
NM_004519.3(KCNQ3):c.1917C>T (p.Leu639=) rs78731303
NM_004519.3(KCNQ3):c.1918G>A (p.Val640Met) rs767903815
NM_004519.3(KCNQ3):c.1938C>T (p.His646=)
NM_004519.3(KCNQ3):c.1941G>A (p.Met647Ile)
NM_004519.3(KCNQ3):c.1945C>T (p.Arg649Trp) rs770863845
NM_004519.3(KCNQ3):c.1947G>A (p.Arg649=) rs142082768
NM_004519.3(KCNQ3):c.1958A>G (p.Gln653Arg) rs554833870
NM_004519.3(KCNQ3):c.1964C>T (p.Thr655Met) rs199942237
NM_004519.3(KCNQ3):c.1980C>A (p.Thr660=) rs886062690
NM_004519.3(KCNQ3):c.1986C>A (p.Gly662=) rs140383266
NM_004519.3(KCNQ3):c.1994C>T (p.Ser665Leu) rs147173555
NM_004519.3(KCNQ3):c.1995G>A (p.Ser665=) rs759776061
NM_004519.3(KCNQ3):c.1995G>T (p.Ser665=) rs759776061
NM_004519.3(KCNQ3):c.2005G>A (p.Ala669Thr) rs201812160
NM_004519.3(KCNQ3):c.2034C>T (p.Ser678=) rs560675018
NM_004519.3(KCNQ3):c.2035G>A (p.Asp679Asn) rs773672399
NM_004519.3(KCNQ3):c.2038T>G (p.Leu680Val) rs1223253841
NM_004519.3(KCNQ3):c.2071G>A (p.Gly691Ser) rs747379988
NM_004519.3(KCNQ3):c.2072G>A (p.Gly691Asp)
NM_004519.3(KCNQ3):c.2074C>G (p.Pro692Ala) rs1131691408
NM_004519.3(KCNQ3):c.2079G>A (p.Pro693=) rs145204452
NM_004519.3(KCNQ3):c.2084C>T (p.Pro695Leu)
NM_004519.3(KCNQ3):c.2097C>T (p.Phe699=) rs139678098
NM_004519.3(KCNQ3):c.2123G>T (p.Ser708Ile) rs977989588
NM_004519.3(KCNQ3):c.2129A>G (p.Tyr710Cys) rs1060500605
NM_004519.3(KCNQ3):c.2133G>A (p.Gly711=) rs199701721
NM_004519.3(KCNQ3):c.2139delT (p.Phe713Leufs) rs1554621412
NM_004519.3(KCNQ3):c.2139dup (p.Ala714Cysfs)
NM_004519.3(KCNQ3):c.2146G>C (p.Asp716His) rs149324120
NM_004519.3(KCNQ3):c.2165G>A (p.Arg722Gln) rs377725346
NM_004519.3(KCNQ3):c.2168G>A (p.Gly723Glu) rs142149782
NM_004519.3(KCNQ3):c.2169G>T (p.Gly723=) rs780315758
NM_004519.3(KCNQ3):c.2219C>T (p.Thr740Met)
NM_004519.3(KCNQ3):c.2225T>G (p.Val742Gly) rs1057517883
NM_004519.3(KCNQ3):c.2237C>T (p.Thr746Met) rs375833070
NM_004519.3(KCNQ3):c.2239G>T (p.Val747Phe)
NM_004519.3(KCNQ3):c.225C>G (p.Asp75Glu) rs138254004
NM_004519.3(KCNQ3):c.2262C>T (p.Leu754=) rs555827251
NM_004519.3(KCNQ3):c.2263G>A (p.Asp755Asn) rs150821246
NM_004519.3(KCNQ3):c.2274G>A (p.Val758=) rs886062689
NM_004519.3(KCNQ3):c.2298G>C (p.Leu766=) rs752643910
NM_004519.3(KCNQ3):c.2306C>A (p.Pro769His) rs114095081
NM_004519.3(KCNQ3):c.2318G>A (p.Arg773Gln) rs769160647
NM_004519.3(KCNQ3):c.2338C>T (p.Arg780Cys) rs138852641
NM_004519.3(KCNQ3):c.2343C>T (p.Ser781=) rs200772304
NM_004519.3(KCNQ3):c.2349G>A (p.Thr783=) rs145063831
NM_004519.3(KCNQ3):c.2381C>T (p.Ser794Leu)
NM_004519.3(KCNQ3):c.2383G>A (p.Val795Ile) rs764544537
NM_004519.3(KCNQ3):c.2388C>T (p.Asn796=) rs957388952
NM_004519.3(KCNQ3):c.2391C>T (p.His797=) rs763446963
NM_004519.3(KCNQ3):c.2393A>C (p.Glu798Ala)
NM_004519.3(KCNQ3):c.2423G>A (p.Ser808Asn) rs1554621319
NM_004519.3(KCNQ3):c.2451G>T (p.Val817=) rs754874948
NM_004519.3(KCNQ3):c.2455G>A (p.Gly819Ser) rs540574784
NM_004519.3(KCNQ3):c.2462A>G (p.Asn821Ser) rs118192254
NM_004519.3(KCNQ3):c.2469dupG (p.Ser824Valfs) rs886041208
NM_004519.3(KCNQ3):c.2492G>A (p.Arg831Gln) rs149004528
NM_004519.3(KCNQ3):c.2505G>C (p.Glu835Asp) rs748320350
NM_004519.3(KCNQ3):c.2537C>T (p.Thr846Met) rs765623435
NM_004519.3(KCNQ3):c.2538G>A (p.Thr846=) rs541215515
NM_004519.3(KCNQ3):c.2545G>A (p.Gly849Ser) rs761201259
NM_004519.3(KCNQ3):c.2550C>T (p.Ser850=) rs1554621294
NM_004519.3(KCNQ3):c.2556T>G (p.Pro852=) rs763432119
NM_004519.3(KCNQ3):c.2567C>T (p.Thr856Ile) rs762078830
NM_004519.3(KCNQ3):c.2611C>G (p.Pro871Ala) rs200647826
NM_004519.3(KCNQ3):c.2619A>G (p.Ter873=) rs893752295
NM_004519.3(KCNQ3):c.36_60delTGGCGGCGGCGGCGACGGGGGCGGC (p.Gly13Glufs) rs772417096
NM_004519.3(KCNQ3):c.386+15G>T rs778486411
NM_004519.3(KCNQ3):c.387-12C>A rs773400738
NM_004519.3(KCNQ3):c.387-4C>G
NM_004519.3(KCNQ3):c.387G>C (p.Val129=) rs1060500604
NM_004519.3(KCNQ3):c.39C>T (p.Gly13=) rs1313781213
NM_004519.3(KCNQ3):c.429C>T (p.Thr143=) rs1257391946
NM_004519.3(KCNQ3):c.449C>A (p.Thr150Asn)
NM_004519.3(KCNQ3):c.478-16A>T rs781487724
NM_004519.3(KCNQ3):c.478-20C>T rs543697742
NM_004519.3(KCNQ3):c.47_49dup (p.Gly16_Asp17insGly) rs981093917
NM_004519.3(KCNQ3):c.49G>A (p.Asp17Asn) rs1355500787
NM_004519.3(KCNQ3):c.507C>T (p.Ala169=) rs1220196153
NM_004519.3(KCNQ3):c.50_67delACGGGGGCGGCGGAGGCG (p.Asp17_Gly22del)
NM_004519.3(KCNQ3):c.567C>T (p.Gly189=) rs1057524531
NM_004519.3(KCNQ3):c.56_73del18 (p.Gly19_Gly24del) rs774616642
NM_004519.3(KCNQ3):c.604+10G>T rs541587196
NM_004519.3(KCNQ3):c.604+16G>A rs1554628744
NM_004519.3(KCNQ3):c.608T>C (p.Ile203Thr) rs1554628237
NM_004519.3(KCNQ3):c.609C>T (p.Ile203=) rs574174380
NM_004519.3(KCNQ3):c.624C>T (p.Ala208=) rs747188490
NM_004519.3(KCNQ3):c.63_71dupAGGCGGCGG (p.Gly24_Ala25insGlyGlyGly) rs748459358
NM_004519.3(KCNQ3):c.640G>A (p.Ala214Thr)
NM_004519.3(KCNQ3):c.660T>C (p.Asn220=) rs41272389
NM_004519.3(KCNQ3):c.679C>A (p.Arg227=) rs796052675
NM_004519.3(KCNQ3):c.688C>T (p.Arg230Cys) rs796052676
NM_004519.3(KCNQ3):c.689G>A (p.Arg230His) rs749205120
NM_004519.3(KCNQ3):c.714G>A (p.Leu238=) rs377171734
NM_004519.3(KCNQ3):c.732T>C (p.Gly244=) rs41272387
NM_004519.3(KCNQ3):c.73G>A (p.Ala25Thr)
NM_004519.3(KCNQ3):c.75G>C (p.Ala25=) rs1554660829
NM_004519.3(KCNQ3):c.788C>T (p.Thr263Met) rs1479652323
NM_004519.3(KCNQ3):c.81C>T (p.Asn27=) rs1271630840
NM_004519.3(KCNQ3):c.834T>C (p.Leu278=) rs769657433
NM_004519.3(KCNQ3):c.856G>A (p.Val286Ile) rs549372035
NM_004519.3(KCNQ3):c.860C>T (p.Pro287Leu) rs531151809
NM_004519.3(KCNQ3):c.867G>A (p.Val289=)
NM_004519.3(KCNQ3):c.878G>A (p.Gly293Glu) rs1064795142
NM_004519.3(KCNQ3):c.891A>G (p.Lys297=) rs757426539
NM_004519.3(KCNQ3):c.895G>A (p.Glu299Lys) rs118192247
NM_004519.3(KCNQ3):c.897G>A (p.Glu299=) rs367611806
NM_004519.3(KCNQ3):c.899T>C (p.Phe300Ser) rs1554627439
NM_004519.3(KCNQ3):c.914A>G (p.Asp305Gly) rs118192248
NM_004519.3(KCNQ3):c.914A>T (p.Asp305Val)
NM_004519.3(KCNQ3):c.924G>A (p.Trp308Ter) rs1554627423
NM_004519.3(KCNQ3):c.925T>C (p.Trp309Arg) rs118192249
NM_004519.3(KCNQ3):c.929G>T (p.Gly310Val) rs118192250
NM_004519.3(KCNQ3):c.933+12C>T rs113965977
NM_004519.3(KCNQ3):c.948C>T (p.Thr316=) rs142144538
NM_004519.3(KCNQ3):c.956A>G (p.Tyr319Cys) rs1554627218
NM_004519.3(KCNQ3):c.959G>A (p.Gly320Glu)
NM_004519.3(KCNQ3):c.988C>T (p.Arg330Cys) rs118192251
NM_004519.3(KCNQ3):c.997G>C (p.Ala333Pro) rs1064797349
NM_004519.3(KCNQ3):c.99G>A (p.Ala33=) rs1057520485
NM_004519.4(KCNQ3):c.2454C>T (p.Phe818=)
NM_004519.4(KCNQ3):c.2467G>A (p.Gly823Arg)
NM_004519.4(KCNQ3):c.569G>A (p.Arg190Gln) rs796052674
NM_004519.4(KCNQ3):c.994A>T (p.Ile332Phe)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.