ClinVar Miner

List of variants in gene LDB3 reported as uncertain significance for not provided

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 69
Download table as spreadsheet
HGVS dbSNP
NM_001080116.1(LDB3):c.771G>A (p.Thr257=) rs144445130
NM_001080116.1(LDB3):c.772G>A (p.Glu258Lys) rs868365512
NM_001080116.1(LDB3):c.787C>T (p.Arg263Cys) rs377201153
NM_007078.3(LDB3):c.1036G>A (p.Ala346Thr) rs201968775
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1075G>A (p.Asp359Asn) rs557956141
NM_007078.3(LDB3):c.1109C>T (p.Pro370Leu) rs794729060
NM_007078.3(LDB3):c.1120G>A (p.Ala374Thr) rs762701610
NM_007078.3(LDB3):c.1129G>A (p.Ala377Thr) rs794729061
NM_007078.3(LDB3):c.1166_1167inv (p.Ala389Gly) rs794729065
NM_007078.3(LDB3):c.1225C>A (p.Gln409Lys) rs139104492
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.133C>T (p.Gln45Ter) rs1057524744
NM_007078.3(LDB3):c.1381T>G (p.Tyr461Asp) rs145655904
NM_007078.3(LDB3):c.1472T>A (p.Val491Glu) rs139709036
NM_007078.3(LDB3):c.1487T>C (p.Phe496Ser) rs147072071
NM_007078.3(LDB3):c.1502C>T (p.Ala501Val) rs755362259
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1546C>T (p.Arg516Trp) rs773327911
NM_007078.3(LDB3):c.1567C>G (p.Pro523Ala) rs794729062
NM_007078.3(LDB3):c.1573G>C (p.Gly525Arg) rs794729063
NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) rs143764931
NM_007078.3(LDB3):c.160G>A (p.Gly54Ser) rs201786090
NM_007078.3(LDB3):c.1639C>T (p.Arg547Trp) rs374426474
NM_007078.3(LDB3):c.1667A>G (p.Asn556Ser) rs372583830
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627
NM_007078.3(LDB3):c.1736A>G (p.Tyr579Cys) rs199749907
NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) rs727504944
NM_007078.3(LDB3):c.1789T>C (p.Tyr597His) rs727503131
NM_007078.3(LDB3):c.1799G>A (p.Arg600Gln) rs747523570
NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.3(LDB3):c.184C>T (p.His62Tyr) rs779234633
NM_007078.3(LDB3):c.1858-11C>A rs369454227
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.3(LDB3):c.1978+2_1978+5del rs1554864768
NM_007078.3(LDB3):c.200A>G (p.Asn67Ser) rs727504500
NM_007078.3(LDB3):c.2017G>A (p.Asp673Asn) rs45514002
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) rs45577134
NM_007078.3(LDB3):c.2092G>T (p.Ala698Ser) rs45577134
NM_007078.3(LDB3):c.236C>T (p.Thr79Ile) rs397517221
NM_007078.3(LDB3):c.23C>A (p.Thr8Asn) rs1060501317
NM_007078.3(LDB3):c.253C>T (p.Arg85Cys) rs780200228
NM_007078.3(LDB3):c.254G>A (p.Arg85His) rs200420174
NM_007078.3(LDB3):c.322-1G>A rs794729059
NM_007078.3(LDB3):c.342C>T (p.Asn114=) rs151166414
NM_007078.3(LDB3):c.356C>T (p.Ala119Val) rs397517223
NM_007078.3(LDB3):c.443G>A (p.Arg148Gln) rs751254270
NM_007078.3(LDB3):c.529dup (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.533G>A (p.Arg178Gln) rs143311349
NM_007078.3(LDB3):c.536A>G (p.Asp179Gly) rs794729058
NM_007078.3(LDB3):c.54G>T (p.Gln18His) rs149348427
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) rs774886148
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.655C>T (p.Arg219Ter) rs727503123
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771
NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) rs139922045
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.715G>A (p.Val239Ile) rs201417512
NM_007078.3(LDB3):c.764A>G (p.Lys255Arg) rs199739130
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.794G>A (p.Arg265His) rs45458895
NM_007078.3(LDB3):c.79C>T (p.Leu27Phe) rs1554844343
NM_007078.3(LDB3):c.805A>C (p.Asn269His) rs1367297073
NM_007078.3(LDB3):c.81C>G (p.Leu27=) rs1554844351
NM_007078.3(LDB3):c.860-22_860-12del rs727504602
NM_007078.3(LDB3):c.887G>A (p.Arg296Gln) rs201689564
NM_007078.3(LDB3):c.91C>T (p.Arg31Trp) rs367792378
NM_007078.3(LDB3):c.955G>A (p.Ala319Thr) rs151219713
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.