ClinVar Miner

List of variants in gene LDB3 reported as benign for not specified

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 49
Download table as spreadsheet
HGVS dbSNP
NM_001080114.1(LDB3):c.1000G>A (p.Ala334Thr) rs786205350
NM_001080114.1(LDB3):c.1074C>T (p.Asn358=) rs886038405
NM_001080114.1(LDB3):c.1130G>A (p.Arg377His) rs146265188
NM_001080114.1(LDB3):c.718+47G>C rs3740346
NM_001080114.1(LDB3):c.966_1013delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC (p.Ala324_Pro339del) rs397517209
NM_001080114.1(LDB3):c.995C>T (p.Ala332Val) rs786205349
NM_001080116.1(LDB3):c.*16984G>A rs139834701
NM_001080116.1(LDB3):c.*17227G>A rs45579241
NM_001080116.1(LDB3):c.*26800C>T rs45578640
NM_001080116.1(LDB3):c.163G>A (p.Val55Ile) rs3740343
NM_001080116.1(LDB3):c.302C>T (p.Pro101Leu) rs45592139
NM_001080116.1(LDB3):c.321+1533G>T rs45543741
NM_001080116.1(LDB3):c.321+1566G>A rs45531131
NM_001080116.1(LDB3):c.321+1656G>A rs45563234
NM_001080116.1(LDB3):c.611A>G (p.Lys204Arg) rs34423165
NM_001080116.1(LDB3):c.756-10_756-9insCT rs71019410
NM_001080116.1(LDB3):c.756-10_756-9insCTCT rs71019410
NM_001080116.1(LDB3):c.756-13_756-10delCTCT rs71019410
NM_007078.2(LDB3):c.-114T>C rs2803558
NM_007078.2(LDB3):c.-134A>G rs2803557
NM_007078.2(LDB3):c.-146G>A rs2803556
NM_007078.2(LDB3):c.-147C>T rs146911972
NM_007078.2(LDB3):c.1014A>G (p.Thr338=) rs150209221
NM_007078.2(LDB3):c.1035C>T (p.Ile345=) rs121908336
NM_007078.2(LDB3):c.1041C>A (p.Ser347=) rs45555240
NM_007078.2(LDB3):c.1074C>T (p.Ala358=) rs45459491
NM_007078.2(LDB3):c.1231+19G>A rs763969244
NM_007078.2(LDB3):c.1335C>T (p.Tyr445=) rs587781024
NM_007078.2(LDB3):c.1386C>T (p.Thr462=) rs764330273
NM_007078.2(LDB3):c.1422G>A (p.Ser474=) rs142625982
NM_007078.2(LDB3):c.147G>A (p.Val49=) rs45591834
NM_007078.2(LDB3):c.162C>T (p.Gly54=) rs757856121
NM_007078.2(LDB3):c.1903G>A (p.Val635Ile) rs45618633
NM_007078.2(LDB3):c.1956C>T (p.Asp652=) rs139213290
NM_007078.2(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.2(LDB3):c.295C>T (p.Pro99Ser) rs201693259
NM_007078.2(LDB3):c.352G>A (p.Val118Met) rs35507268
NM_007078.2(LDB3):c.423C>A (p.Thr141=) rs1253491293
NM_007078.2(LDB3):c.465C>T (p.Leu155=) rs45516997
NM_007078.2(LDB3):c.576G>A (p.Pro192=) rs45543741
NM_007078.2(LDB3):c.689+9C>T rs727503124
NM_007078.2(LDB3):c.690-4A>G rs45529531
NM_007078.2(LDB3):c.690-50G>C rs886038580
NM_007078.2(LDB3):c.859+14C>G rs748281629
NM_007078.2(LDB3):c.891G>A (p.Arg297=) rs374336814
NM_007078.2(LDB3):c.896+6722G>A rs144445130
NM_007078.2(LDB3):c.896+6731C>T rs372789789
NM_007078.2(LDB3):c.896+6823C>T rs377726575
NM_007078.2(LDB3):c.954C>T (p.Pro318=) rs45603139

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.