ClinVar Miner

List of variants in gene LDB3 reported as likely benign for not specified

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 96
Download table as spreadsheet
NM_001080116.1(LDB3):c.780C>T (p.Asn260=) rs372789789
NM_007078.3(LDB3):c.-18G>A rs778777335
NM_007078.3(LDB3):c.-19G>A rs770775053
NM_007078.3(LDB3):c.-23-20T>C rs45453092
NM_007078.3(LDB3):c.-24+18G>A rs1054080127
NM_007078.3(LDB3):c.-48G>T rs2803556
NM_007078.3(LDB3):c.1014A>G (p.Thr338=) rs150209221
NM_007078.3(LDB3):c.1017T>G (p.Ala339=) rs727504526
NM_007078.3(LDB3):c.1035C>T (p.Ile345=) rs121908336
NM_007078.3(LDB3):c.1036G>A (p.Ala346Thr) rs201968775
NM_007078.3(LDB3):c.1041C>T (p.Ser347=) rs45555240
NM_007078.3(LDB3):c.1045T>A (p.Ser349Thr) rs147042608
NM_007078.3(LDB3):c.1049C>T (p.Thr350Ile) rs200796750
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1071T>A (p.Pro357=) rs143823978
NM_007078.3(LDB3):c.1105A>G (p.Ser369Gly) rs181700296
NM_007078.3(LDB3):c.1111G>A (p.Ala371Thr) rs45539535
NM_007078.3(LDB3):c.1164C>T (p.Pro388=) rs780108812
NM_007078.3(LDB3):c.1167C>T (p.Ala389=) rs768844187
NM_007078.3(LDB3):c.1200T>G (p.Thr400=) rs1447980981
NM_007078.3(LDB3):c.1231+30C>G rs11597201
NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) rs368888118
NM_007078.3(LDB3):c.1296C>T (p.Ser432=) rs753546855
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1317C>T (p.Pro439=) rs397517208
NM_007078.3(LDB3):c.1335C>T (p.Tyr445=) rs587781024
NM_007078.3(LDB3):c.1422G>A (p.Ser474=) rs142625982
NM_007078.3(LDB3):c.1437G>C (p.Gly479=) rs960379328
NM_007078.3(LDB3):c.144C>T (p.Leu48=) rs397517213
NM_007078.3(LDB3):c.1460G>A (p.Arg487His) rs146265188
NM_007078.3(LDB3):c.147G>A (p.Val49=) rs45591834
NM_007078.3(LDB3):c.1503C>T (p.Ala501=) rs147692024
NM_007078.3(LDB3):c.1521C>T (p.Thr507=) rs200838004
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1562A>G (p.Tyr521Cys) rs535737552
NM_007078.3(LDB3):c.1572G>A (p.Ala524=) rs149423035
NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) rs143764931
NM_007078.3(LDB3):c.159C>T (p.Asp53=) rs200114285
NM_007078.3(LDB3):c.1605C>T (p.Thr535=) rs727505207
NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) rs113817827
NM_007078.3(LDB3):c.163G>A (p.Val55Ile) rs3740343
NM_007078.3(LDB3):c.1653C>T (p.Cys551=) rs45581435
NM_007078.3(LDB3):c.1668T>C (p.Asn556=) rs916700413
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627
NM_007078.3(LDB3):c.1677-19C>T rs749512075
NM_007078.3(LDB3):c.1728C>T (p.Thr576=) rs749988944
NM_007078.3(LDB3):c.1815C>T (p.Phe605=) rs1057522289
NM_007078.3(LDB3):c.1836G>A (p.Lys612=) rs886038406
NM_007078.3(LDB3):c.1858-10T>C rs202208256
NM_007078.3(LDB3):c.1858-7C>G rs1057520727
NM_007078.3(LDB3):c.1911G>A (p.Ala637=) rs150710377
NM_007078.3(LDB3):c.1956C>T (p.Asp652=) rs139213290
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) rs140552419
NM_007078.3(LDB3):c.2016C>T (p.Cys672=) rs45578640
NM_007078.3(LDB3):c.2025C>T (p.Pro675=) rs876657490
NM_007078.3(LDB3):c.2091C>T (p.Cys697=) rs571356142
NM_007078.3(LDB3):c.2094+10T>C rs769802374
NM_007078.3(LDB3):c.2124G>A (p.Pro708=) rs759812655
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.3(LDB3):c.287T>C (p.Val96Ala) rs794729056
NM_007078.3(LDB3):c.295C>T (p.Pro99Ser) rs201693259
NM_007078.3(LDB3):c.322-20C>T rs199536065
NM_007078.3(LDB3):c.328G>A (p.Ala110Thr) rs768737496
NM_007078.3(LDB3):c.352G>A (p.Val118Met) rs35507268
NM_007078.3(LDB3):c.385A>G (p.Ser129Gly) rs794729057
NM_007078.3(LDB3):c.398C>T (p.Pro133Leu) rs200239096
NM_007078.3(LDB3):c.407C>T (p.Pro136Leu) rs772887402
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.468C>T (p.Ala156=) rs374233873
NM_007078.3(LDB3):c.493C>T (p.Arg165Trp) rs45610637
NM_007078.3(LDB3):c.540A>G (p.Leu180=) rs1283051092
NM_007078.3(LDB3):c.567G>A (p.Ser189=) rs778777214
NM_007078.3(LDB3):c.600C>T (p.Gly200=) rs397517225
NM_007078.3(LDB3):c.646A>T (p.Met216Leu) rs765199175
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.689+10G>A rs45563234
NM_007078.3(LDB3):c.689+15T>C rs375094467
NM_007078.3(LDB3):c.689+9C>T rs727503124
NM_007078.3(LDB3):c.690-17CT[3] rs544039308
NM_007078.3(LDB3):c.714C>T (p.Ala238=) rs727503125
NM_007078.3(LDB3):c.732C>T (p.Pro244=) rs144509718
NM_007078.3(LDB3):c.81C>G (p.Leu27=) rs1554844351
NM_007078.3(LDB3):c.860-15C>T rs727503126
NM_007078.3(LDB3):c.867C>T (p.Asp289=) rs397517227
NM_007078.3(LDB3):c.896+6669TC[11] rs71019410
NM_007078.3(LDB3):c.896+6669TC[12] rs71019410
NM_007078.3(LDB3):c.896+6669TC[13] rs71019410
NM_007078.3(LDB3):c.897-10G>A rs77304928
NM_007078.3(LDB3):c.897-11C>T rs766463668
NM_007078.3(LDB3):c.897-14T>C rs763081924
NM_007078.3(LDB3):c.897-16G>C rs45513100
NM_007078.3(LDB3):c.900C>A (p.Thr300=) rs760071118
NM_007078.3(LDB3):c.93+10C>A rs1222755412
NM_007078.3(LDB3):c.93+7G>T rs397517229
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121
NM_007078.3(LDB3):c.993G>A (p.Ala331=) rs140347820

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.