ClinVar Miner

List of variants in gene LDB3 reported as uncertain significance for not specified

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 62
Download table as spreadsheet
HGVS dbSNP
NM_001080116.1(LDB3):c.775C>G (p.Arg259Gly) rs397516560
NM_001080116.1(LDB3):c.802C>T (p.Arg268Cys) rs121908335
NM_007078.3(LDB3):c.*13G>T rs397517207
NM_007078.3(LDB3):c.-15G>A rs201865389
NM_007078.3(LDB3):c.1016C>G (p.Ala339Gly) rs764530865
NM_007078.3(LDB3):c.1036G>A (p.Ala346Thr) rs201968775
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.10A>C (p.Ser4Arg) rs727505295
NM_007078.3(LDB3):c.1153A>G (p.Ser385Gly) rs777547764
NM_007078.3(LDB3):c.1253C>G (p.Pro418Arg) rs141870580
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[3] (p.434_441APAYTPSP[3]) rs397517209
NM_007078.3(LDB3):c.1339C>G (p.Pro447Ala) rs397517211
NM_007078.3(LDB3):c.139G>A (p.Asp47Asn) rs397517212
NM_007078.3(LDB3):c.1453G>T (p.Ala485Ser) rs397517214
NM_007078.3(LDB3):c.1471G>T (p.Val491Leu) rs397517215
NM_007078.3(LDB3):c.1472T>A (p.Val491Glu) rs139709036
NM_007078.3(LDB3):c.1475C>T (p.Thr492Ile) rs397517216
NM_007078.3(LDB3):c.1586C>G (p.Pro529Arg) rs397517217
NM_007078.3(LDB3):c.1607T>C (p.Val536Ala) rs727503128
NM_007078.3(LDB3):c.1609del (p.Gln537fs) rs727503129
NM_007078.3(LDB3):c.1697T>G (p.Met566Arg) rs566463138
NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) rs727504944
NM_007078.3(LDB3):c.1786G>A (p.Val596Ile) rs727503130
NM_007078.3(LDB3):c.1789T>C (p.Tyr597His) rs727503131
NM_007078.3(LDB3):c.1798C>T (p.Arg600Ter) rs727503132
NM_007078.3(LDB3):c.1799G>A (p.Arg600Gln) rs747523570
NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.3(LDB3):c.1858-10T>C rs202208256
NM_007078.3(LDB3):c.1907G>A (p.Cys636Tyr) rs397517218
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.3(LDB3):c.200A>G (p.Asn67Ser) rs727504500
NM_007078.3(LDB3):c.2078C>A (p.Thr693Asn) rs397517219
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) rs45577134
NM_007078.3(LDB3):c.2155A>G (p.Lys719Glu) rs397517220
NM_007078.3(LDB3):c.2164G>A (p.Ala722Thr) rs727505129
NM_007078.3(LDB3):c.236C>G (p.Thr79Ser) rs397517221
NM_007078.3(LDB3):c.343G>A (p.Gly115Ser) rs397517222
NM_007078.3(LDB3):c.356C>T (p.Ala119Val) rs397517223
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.526G>A (p.Gly176Arg) rs149167391
NM_007078.3(LDB3):c.529dup (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.530C>A (p.Ala177Asp) rs397517224
NM_007078.3(LDB3):c.530C>T (p.Ala177Val) rs397517224
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) rs774886148
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.575C>T (p.Pro192Leu) rs758182278
NM_007078.3(LDB3):c.655C>T (p.Arg219Ter) rs727503123
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771
NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) rs139922045
NM_007078.3(LDB3):c.733G>A (p.Val245Ile) rs573061464
NM_007078.3(LDB3):c.789G>A (p.Trp263Ter) rs876657847
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.80T>C (p.Leu27Pro) rs1057517864
NM_007078.3(LDB3):c.826C>T (p.Arg276Cys) rs397517226
NM_007078.3(LDB3):c.845C>T (p.Thr282Met) rs199811186
NM_007078.3(LDB3):c.859+3G>A rs376313045
NM_007078.3(LDB3):c.860-15C>T rs727503126
NM_007078.3(LDB3):c.860-22_860-12del rs727504602
NM_007078.3(LDB3):c.897-10G>A rs77304928
NM_007078.3(LDB3):c.899C>A (p.Thr300Asn) rs397517228
NM_007078.3(LDB3):c.93+1G>T rs727505066

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.