ClinVar Miner

List of variants in gene LDB3

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 333
Download table as spreadsheet
HGVS dbSNP
NM_001080114.1(LDB3):c.1000G>A (p.Ala334Thr) rs786205350
NM_001080114.1(LDB3):c.1074C>T (p.Asn358=) rs886038405
NM_001080114.1(LDB3):c.1130G>A (p.Arg377His) rs146265188
NM_001080114.1(LDB3):c.1142T>A (p.Val381Glu) rs139709036
NM_001080114.1(LDB3):c.1205A>C (p.Gln402Pro) rs138951890
NM_001080114.1(LDB3):c.133C>T (p.Gln45Ter) rs1057524744
NM_001080114.1(LDB3):c.1342A>G (p.Ile448Val) rs372331627
NM_001080114.1(LDB3):c.1406A>G (p.Tyr469Cys) rs199749907
NM_001080114.1(LDB3):c.1506G>A (p.Lys502=) rs886038406
NM_001080114.1(LDB3):c.718+47G>C rs3740346
NM_001080114.1(LDB3):c.728C>T (p.Pro243Leu) rs775180716
NM_001080114.1(LDB3):c.781G>A (p.Ala261Thr) rs45539535
NM_001080114.1(LDB3):c.901+30C>G rs11597201
NM_001080114.1(LDB3):c.966_1013delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC (p.Ala324_Pro339del) rs397517209
NM_001080114.1(LDB3):c.995C>T (p.Ala332Val) rs786205349
NM_001080116.1(LDB3):c.*154G>A rs886047354
NM_001080116.1(LDB3):c.*156C>T rs139415121
NM_001080116.1(LDB3):c.*16984G>A rs139834701
NM_001080116.1(LDB3):c.*17227G>A rs45579241
NM_001080116.1(LDB3):c.*17293G>A rs149423035
NM_001080116.1(LDB3):c.*17374C>T rs45581435
NM_001080116.1(LDB3):c.*18610T>G rs566463138
NM_001080116.1(LDB3):c.*19457G>A rs201063130
NM_001080116.1(LDB3):c.*19482A>C rs1060504199
NM_001080116.1(LDB3):c.*248G>A rs532856980
NM_001080116.1(LDB3):c.*26800C>T rs45578640
NM_001080116.1(LDB3):c.*323C>T rs185972751
NM_001080116.1(LDB3):c.*326C>T rs886047355
NM_001080116.1(LDB3):c.*398C>G rs11594242
NM_001080116.1(LDB3):c.*450G>A rs537660741
NM_001080116.1(LDB3):c.*492C>T rs549156118
NM_001080116.1(LDB3):c.*632T>C rs886047356
NM_001080116.1(LDB3):c.*678C>T rs1554857593
NM_001080116.1(LDB3):c.-55C>A rs34972863
NM_001080116.1(LDB3):c.-81G>A rs45578532
NM_001080116.1(LDB3):c.139G>A (p.Asp47Asn) rs397517212
NM_001080116.1(LDB3):c.160G>A (p.Gly54Ser) rs201786090
NM_001080116.1(LDB3):c.163G>A (p.Val55Ile) rs3740343
NM_001080116.1(LDB3):c.196C>T (p.Gln66Ter) rs1554849100
NM_001080116.1(LDB3):c.236C>G (p.Thr79Ser) rs397517221
NM_001080116.1(LDB3):c.236C>T (p.Thr79Ile) rs397517221
NM_001080116.1(LDB3):c.23C>A (p.Thr8Asn) rs1060501317
NM_001080116.1(LDB3):c.242delA (p.Gln81Argfs) rs1554849133
NM_001080116.1(LDB3):c.254G>A (p.Arg85His) rs200420174
NM_001080116.1(LDB3):c.272C>T (p.Thr91Met) rs769237367
NM_001080116.1(LDB3):c.290A>G (p.Gln97Arg) rs762580653
NM_001080116.1(LDB3):c.302C>T (p.Pro101Leu) rs45592139
NM_001080116.1(LDB3):c.306G>A (p.Val102=) rs201715521
NM_001080116.1(LDB3):c.309C>A (p.Ile103=) rs1060504198
NM_001080116.1(LDB3):c.30C>G (p.Pro10=) rs766817285
NM_001080116.1(LDB3):c.321+1335G>A rs149872184
NM_001080116.1(LDB3):c.321+1400G>A rs751254270
NM_001080116.1(LDB3):c.321+1449G>A rs368407147
NM_001080116.1(LDB3):c.321+1486del rs730880345
NM_001080116.1(LDB3):c.321+1517C>T rs149218167
NM_001080116.1(LDB3):c.321+1523C>T rs45487699
NM_001080116.1(LDB3):c.321+1533G>T rs45543741
NM_001080116.1(LDB3):c.321+1566G>A rs45531131
NM_001080116.1(LDB3):c.321+1656G>A rs45563234
NM_001080116.1(LDB3):c.4T>A (p.Ser2Thr)
NM_001080116.1(LDB3):c.549-2A>G rs1060501315
NM_001080116.1(LDB3):c.574G>A (p.Val192Ile) rs201417512
NM_001080116.1(LDB3):c.582C>T (p.Ser194=) rs200580597
NM_001080116.1(LDB3):c.611A>G (p.Lys204Arg) rs34423165
NM_001080116.1(LDB3):c.623A>G (p.Lys208Arg) rs199739130
NM_001080116.1(LDB3):c.641A>C (p.Asp214Ala) rs1285921374
NM_001080116.1(LDB3):c.652C>T (p.Arg218Cys) rs45521338
NM_001080116.1(LDB3):c.685C>T (p.Arg229Cys) rs397517226
NM_001080116.1(LDB3):c.717C>T (p.Phe239=) rs764056994
NM_001080116.1(LDB3):c.726C>T (p.Asp242=) rs397517227
NM_001080116.1(LDB3):c.72C>A (p.Asn24Lys)
NM_001080116.1(LDB3):c.745C>T (p.Arg249Ter) rs1060501316
NM_001080116.1(LDB3):c.746G>A (p.Arg249Gln) rs201689564
NM_001080116.1(LDB3):c.750G>T (p.Arg250Ser) rs374336814
NM_001080116.1(LDB3):c.756-10_756-9insCT rs71019410
NM_001080116.1(LDB3):c.756-10_756-9insCTCT rs71019410
NM_001080116.1(LDB3):c.756-11_756-10delCT rs71019410
NM_001080116.1(LDB3):c.756-13_756-10delCTCT rs71019410
NM_001080116.1(LDB3):c.756-15_756-10delCTCTCT rs71019410
NM_001080116.1(LDB3):c.770C>T (p.Thr257Met) rs375798002
NM_001080116.1(LDB3):c.772G>C (p.Glu258Gln) rs868365512
NM_001080116.1(LDB3):c.775C>G (p.Arg259Gly) rs397516560
NM_001080116.1(LDB3):c.787C>T (p.Arg263Cys) rs377201153
NM_001080116.1(LDB3):c.802C>T (p.Arg268Cys) rs121908335
NM_001080116.1(LDB3):c.816T>C (p.His272=) rs748780980
NM_001080116.1(LDB3):c.817G>A (p.Gly273Ser) rs771037817
NM_001080116.1(LDB3):c.94-9T>C
NM_001080116.1(LDB3):c.99dup (p.Pro34Thrfs) rs1554849000
NM_001171610.1(LDB3):c.1134C>T (p.Ala378=) rs773647394
NM_001171610.1(LDB3):c.1136C>T (p.Ala379Val) rs1554860812
NM_001171610.1(LDB3):c.1304C>A (p.Thr435Asn) rs746183666
NM_001171610.1(LDB3):c.1328C>G (p.Thr443Ser) rs767914340
NM_001171610.1(LDB3):c.1336C>T (p.Pro446Ser) rs757728320
NM_001171610.1(LDB3):c.1436C>T (p.Ser479Leu) rs1011836119
NM_001171610.1(LDB3):c.1512G>T (p.Lys504Asn)
NM_001171610.1(LDB3):c.1655G>A (p.Arg552Gln) rs201968826
NM_001171610.1(LDB3):c.1804T>A (p.Tyr602Asn) rs727503131
NM_001171610.1(LDB3):c.1917C>A (p.Phe639Leu) rs773904344
NM_001171610.1(LDB3):c.2025T>C (p.His675=) rs759857527
NM_001171610.1(LDB3):c.2088C>T (p.His696=) rs45486293
NM_001171610.1(LDB3):c.2119G>T (p.Val707Leu) rs773235586
NM_001171610.1(LDB3):c.2188A>G (p.Ile730Val) rs1554870749
NM_001171610.1(LDB3):c.2189T>A (p.Ile730Asn) rs748399477
NM_001171610.1(LDB3):c.358C>A (p.Pro120Thr) rs587782955
NM_001171610.1(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_001171610.1(LDB3):c.526G>A (p.Gly176Arg) rs149167391
NM_001171610.1(LDB3):c.592C>T (p.Pro198Ser) rs1060501318
NM_001171610.1(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_001171611.1(LDB3):c.172G>A (p.Asp58Asn) rs730880127
NM_007078.2(LDB3):c.*13G>T rs397517207
NM_007078.2(LDB3):c.-104G>A rs1054080127
NM_007078.2(LDB3):c.-114T>C rs2803558
NM_007078.2(LDB3):c.-134A>G rs2803557
NM_007078.2(LDB3):c.-146G>A rs2803556
NM_007078.2(LDB3):c.-146G>T rs2803556
NM_007078.2(LDB3):c.-147C>T rs146911972
NM_007078.2(LDB3):c.-15G>A rs201865389
NM_007078.2(LDB3):c.-18G>A rs778777335
NM_007078.2(LDB3):c.-19G>A rs770775053
NM_007078.2(LDB3):c.-23-?_93+?dup
NM_007078.2(LDB3):c.-43T>C rs45453092
NM_007078.2(LDB3):c.1014A>G (p.Thr338=) rs150209221
NM_007078.2(LDB3):c.1016C>G (p.Ala339Gly) rs764530865
NM_007078.2(LDB3):c.1017T>G (p.Ala339=) rs727504526
NM_007078.2(LDB3):c.1035C>G (p.Ile345Met) rs121908336
NM_007078.2(LDB3):c.1035C>T (p.Ile345=) rs121908336
NM_007078.2(LDB3):c.1036G>A (p.Ala346Thr) rs201968775
NM_007078.2(LDB3):c.1041C>A (p.Ser347=) rs45555240
NM_007078.2(LDB3):c.1041C>T (p.Ser347=) rs45555240
NM_007078.2(LDB3):c.1045T>A (p.Ser349Thr) rs147042608
NM_007078.2(LDB3):c.1049C>T (p.Thr350Ile) rs200796750
NM_007078.2(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.2(LDB3):c.1071T>A (p.Pro357=) rs143823978
NM_007078.2(LDB3):c.1074C>T (p.Ala358=) rs45459491
NM_007078.2(LDB3):c.1075G>A (p.Asp359Asn) rs557956141
NM_007078.2(LDB3):c.1086-248_1231+1del
NM_007078.2(LDB3):c.10A>C (p.Ser4Arg) rs727505295
NM_007078.2(LDB3):c.1105A>G (p.Ser369Gly) rs181700296
NM_007078.2(LDB3):c.1109C>T (p.Pro370Leu) rs794729060
NM_007078.2(LDB3):c.1120G>A (p.Ala374Thr) rs762701610
NM_007078.2(LDB3):c.1129G>A (p.Ala377Thr) rs794729061
NM_007078.2(LDB3):c.1132C>T (p.Pro378Ser)
NM_007078.2(LDB3):c.1150T>A (p.Tyr384Asn) rs1554860857
NM_007078.2(LDB3):c.1153A>G (p.Ser385Gly) rs777547764
NM_007078.2(LDB3):c.1158G>A (p.Glu386=) rs45465300
NM_007078.2(LDB3):c.1164C>T (p.Pro388=) rs780108812
NM_007078.2(LDB3):c.1166_1167delCCinsGG (p.Ala389Gly) rs794729065
NM_007078.2(LDB3):c.1167C>T (p.Ala389=) rs768844187
NM_007078.2(LDB3):c.1200T>G (p.Thr400=) rs1447980981
NM_007078.2(LDB3):c.1225C>A (p.Gln409Lys) rs139104492
NM_007078.2(LDB3):c.1231+19G>A rs763969244
NM_007078.2(LDB3):c.1253C>G (p.Pro418Arg) rs141870580
NM_007078.2(LDB3):c.1253C>T (p.Pro418Leu) rs141870580
NM_007078.2(LDB3):c.1256C>A (p.Ser419Tyr) rs368888118
NM_007078.2(LDB3):c.1288A>G (p.Thr430Ala) rs143163993
NM_007078.2(LDB3):c.1296C>T (p.Ser432=) rs753546855
NM_007078.2(LDB3):c.1312A>G (p.Thr438Ala)
NM_007078.2(LDB3):c.1317C>T (p.Pro439=) rs397517208
NM_007078.2(LDB3):c.1320_1343del24 (p.Ala442_Pro449del) rs397517209
NM_007078.2(LDB3):c.1320_1343dup (p.Pro449_Val450insAlaProAlaTyrThrProSerPro) rs397517209
NM_007078.2(LDB3):c.1328C>T (p.Pro443Leu) rs1554863327
NM_007078.2(LDB3):c.1335C>T (p.Tyr445=) rs587781024
NM_007078.2(LDB3):c.1339C>G (p.Pro447Ala) rs397517211
NM_007078.2(LDB3):c.1381T>G (p.Tyr461Asp) rs145655904
NM_007078.2(LDB3):c.1386C>T (p.Thr462=) rs764330273
NM_007078.2(LDB3):c.1403A>G (p.Asn468Ser) rs730880129
NM_007078.2(LDB3):c.1410C>A (p.Asn470Lys) rs1135401943
NM_007078.2(LDB3):c.1422G>A (p.Ser474=) rs142625982
NM_007078.2(LDB3):c.1437G>C (p.Gly479=) rs960379328
NM_007078.2(LDB3):c.1442C>G (p.Pro481Arg) rs12761754
NM_007078.2(LDB3):c.1445C>T (p.Ala482Val) rs774313535
NM_007078.2(LDB3):c.144C>T (p.Leu48=) rs397517213
NM_007078.2(LDB3):c.1453G>T (p.Ala485Ser) rs397517214
NM_007078.2(LDB3):c.1471G>T (p.Val491Leu) rs397517215
NM_007078.2(LDB3):c.1475C>T (p.Thr492Ile) rs397517216
NM_007078.2(LDB3):c.147G>A (p.Val49=) rs45591834
NM_007078.2(LDB3):c.1487T>C (p.Phe496Ser) rs147072071
NM_007078.2(LDB3):c.1502C>T (p.Ala501Val) rs755362259
NM_007078.2(LDB3):c.1503C>T (p.Ala501=) rs147692024
NM_007078.2(LDB3):c.1520C>A (p.Thr507Asn)
NM_007078.2(LDB3):c.1521C>T (p.Thr507=) rs200838004
NM_007078.2(LDB3):c.1546C>T (p.Arg516Trp) rs773327911
NM_007078.2(LDB3):c.1562A>G (p.Tyr521Cys) rs535737552
NM_007078.2(LDB3):c.1567C>G (p.Pro523Ala) rs794729062
NM_007078.2(LDB3):c.1573G>C (p.Gly525Arg) rs794729063
NM_007078.2(LDB3):c.1586C>G (p.Pro529Arg) rs397517217
NM_007078.2(LDB3):c.1594G>C (p.Ala532Pro) rs143764931
NM_007078.2(LDB3):c.159C>T (p.Asp53=) rs200114285
NM_007078.2(LDB3):c.1605C>T (p.Thr535=) rs727505207
NM_007078.2(LDB3):c.1606G>A (p.Val536Ile) rs113817827
NM_007078.2(LDB3):c.1607T>C (p.Val536Ala) rs727503128
NM_007078.2(LDB3):c.1609delC (p.Gln537Argfs) rs727503129
NM_007078.2(LDB3):c.162C>T (p.Gly54=) rs757856121
NM_007078.2(LDB3):c.1639C>T (p.Arg547Trp) rs374426474
NM_007078.2(LDB3):c.1667A>G (p.Asn556Ser) rs372583830
NM_007078.2(LDB3):c.1668T>C (p.Asn556=) rs916700413
NM_007078.2(LDB3):c.1675C>T (p.Arg559Trp) rs142947567
NM_007078.2(LDB3):c.1676G>A (p.Arg559Gln) rs763908636
NM_007078.2(LDB3):c.1677-19C>T rs749512075
NM_007078.2(LDB3):c.1703G>A (p.Arg568His) rs769156627
NM_007078.2(LDB3):c.1728C>T (p.Thr576=) rs749988944
NM_007078.2(LDB3):c.1774G>C (p.Glu592Gln) rs727504944
NM_007078.2(LDB3):c.1779G>C (p.Gln593His) rs1291914478
NM_007078.2(LDB3):c.1783_1785delAAC (p.Asn595del) rs1554864337
NM_007078.2(LDB3):c.1786G>A (p.Val596Ile) rs727503130
NM_007078.2(LDB3):c.1789T>C (p.Tyr597His) rs727503131
NM_007078.2(LDB3):c.1798C>T (p.Arg600Ter) rs727503132
NM_007078.2(LDB3):c.1799G>A (p.Arg600Gln) rs747523570
NM_007078.2(LDB3):c.1799G>C (p.Arg600Pro) rs747523570
NM_007078.2(LDB3):c.1815C>T (p.Phe605=) rs1057522289
NM_007078.2(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.2(LDB3):c.184C>T (p.His62Tyr) rs779234633
NM_007078.2(LDB3):c.1851T>C (p.Ile617=) rs145402041
NM_007078.2(LDB3):c.1858-10T>C rs202208256
NM_007078.2(LDB3):c.1858-11C>A rs369454227
NM_007078.2(LDB3):c.1858-7C>G rs1057520727
NM_007078.2(LDB3):c.1894A>G (p.Thr632Ala)
NM_007078.2(LDB3):c.1903G>A (p.Val635Ile) rs45618633
NM_007078.2(LDB3):c.1907G>A (p.Cys636Tyr) rs397517218
NM_007078.2(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.2(LDB3):c.1911G>A (p.Ala637=) rs150710377
NM_007078.2(LDB3):c.1956C>T (p.Asp652=) rs139213290
NM_007078.2(LDB3):c.1957G>C (p.Gly653Arg)
NM_007078.2(LDB3):c.1971C>T (p.Cys657=) rs140552419
NM_007078.2(LDB3):c.1972G>A (p.Glu658Lys)
NM_007078.2(LDB3):c.1978+2_1978+5delTAGG rs1554864768
NM_007078.2(LDB3):c.200A>G (p.Asn67Ser) rs727504500
NM_007078.2(LDB3):c.2017G>A (p.Asp673Asn) rs45514002
NM_007078.2(LDB3):c.2025C>T (p.Pro675=) rs876657490
NM_007078.2(LDB3):c.2078C>A (p.Thr693Asn) rs397517219
NM_007078.2(LDB3):c.2091C>T (p.Cys697=) rs571356142
NM_007078.2(LDB3):c.2092G>A (p.Ala698Thr) rs45577134
NM_007078.2(LDB3):c.2092G>T (p.Ala698Ser) rs45577134
NM_007078.2(LDB3):c.2094+10T>C rs769802374
NM_007078.2(LDB3):c.2123C>T (p.Pro708Leu)
NM_007078.2(LDB3):c.2124G>A (p.Pro708=) rs759812655
NM_007078.2(LDB3):c.2155A>C (p.Lys719Gln) rs397517220
NM_007078.2(LDB3):c.2155A>G (p.Lys719Glu) rs397517220
NM_007078.2(LDB3):c.2164G>A (p.Ala722Thr) rs727505129
NM_007078.2(LDB3):c.230G>A (p.Ser77Asn) rs1554849117
NM_007078.2(LDB3):c.253C>T (p.Arg85Cys) rs780200228
NM_007078.2(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.2(LDB3):c.287T>C (p.Val96Ala) rs794729056
NM_007078.2(LDB3):c.295C>T (p.Pro99Ser) rs201693259
NM_007078.2(LDB3):c.322-1G>A rs794729059
NM_007078.2(LDB3):c.322-20C>T rs199536065
NM_007078.2(LDB3):c.328G>A (p.Ala110Thr) rs768737496
NM_007078.2(LDB3):c.338C>T (p.Thr113Met) rs563714303
NM_007078.2(LDB3):c.342C>T (p.Asn114=) rs151166414
NM_007078.2(LDB3):c.343G>A (p.Gly115Ser) rs397517222
NM_007078.2(LDB3):c.348C>T (p.Ser116=) rs1060504200
NM_007078.2(LDB3):c.352G>A (p.Val118Met) rs35507268
NM_007078.2(LDB3):c.356C>T (p.Ala119Val) rs397517223
NM_007078.2(LDB3):c.385A>G (p.Ser129Gly) rs794729057
NM_007078.2(LDB3):c.398C>T (p.Pro133Leu) rs200239096
NM_007078.2(LDB3):c.407C>T (p.Pro136Leu) rs772887402
NM_007078.2(LDB3):c.423C>A (p.Thr141=) rs1253491293
NM_007078.2(LDB3):c.442C>T (p.Arg148Trp) rs536186237
NM_007078.2(LDB3):c.450C>T (p.Ser150=) rs878854907
NM_007078.2(LDB3):c.465C>T (p.Leu155=) rs45516997
NM_007078.2(LDB3):c.468C>T (p.Ala156=) rs374233873
NM_007078.2(LDB3):c.469G>A (p.Glu157Lys) rs770678454
NM_007078.2(LDB3):c.492G>T (p.Pro164=) rs368407147
NM_007078.2(LDB3):c.493C>T (p.Arg165Trp) rs45610637
NM_007078.2(LDB3):c.494G>A (p.Arg165Gln) rs61857115
NM_007078.2(LDB3):c.529dupG (p.Ala177Glyfs) rs730880345
NM_007078.2(LDB3):c.530C>A (p.Ala177Asp) rs397517224
NM_007078.2(LDB3):c.530C>T (p.Ala177Val) rs397517224
NM_007078.2(LDB3):c.532C>G (p.Arg178Gly) rs730880128
NM_007078.2(LDB3):c.532C>T (p.Arg178Trp) rs730880128
NM_007078.2(LDB3):c.533G>A (p.Arg178Gln) rs143311349
NM_007078.2(LDB3):c.536A>G (p.Asp179Gly) rs794729058
NM_007078.2(LDB3):c.540A>G (p.Leu180=) rs1283051092
NM_007078.2(LDB3):c.548delC (p.Pro183Glnfs) rs1285270306
NM_007078.2(LDB3):c.54G>T (p.Gln18His) rs149348427
NM_007078.2(LDB3):c.550A>G (p.Lys184Glu) rs774886148
NM_007078.2(LDB3):c.567G>A (p.Ser189=) rs778777214
NM_007078.2(LDB3):c.575C>T (p.Pro192Leu) rs758182278
NM_007078.2(LDB3):c.576G>A (p.Pro192=) rs45543741
NM_007078.2(LDB3):c.600C>T (p.Gly200=) rs397517225
NM_007078.2(LDB3):c.617C>T (p.Thr206Ile) rs121908337
NM_007078.2(LDB3):c.646A>T (p.Met216Leu) rs765199175
NM_007078.2(LDB3):c.655C>T (p.Arg219Ter) rs727503123
NM_007078.2(LDB3):c.656G>A (p.Arg219Gln) rs530979771
NM_007078.2(LDB3):c.664G>A (p.Ala222Thr) rs139922045
NM_007078.2(LDB3):c.686G>T (p.Gly229Val) rs1131691665
NM_007078.2(LDB3):c.689+15T>C rs375094467
NM_007078.2(LDB3):c.689+9C>T rs727503124
NM_007078.2(LDB3):c.690-11_690-10delCT rs544039308
NM_007078.2(LDB3):c.690-4A>G rs45529531
NM_007078.2(LDB3):c.690-50G>C rs886038580
NM_007078.2(LDB3):c.714C>T (p.Ala238=) rs727503125
NM_007078.2(LDB3):c.732C>T (p.Pro244=) rs144509718
NM_007078.2(LDB3):c.733G>A (p.Val245Ile) rs573061464
NM_007078.2(LDB3):c.789G>A (p.Trp263Ter) rs876657847
NM_007078.2(LDB3):c.794G>A (p.Arg265His) rs45458895
NM_007078.2(LDB3):c.79C>T (p.Leu27Phe) rs1554844343
NM_007078.2(LDB3):c.805A>C (p.Asn269His) rs1367297073
NM_007078.2(LDB3):c.80T>C (p.Leu27Pro) rs1057517864
NM_007078.2(LDB3):c.81C>G (p.Leu27=) rs1554844351
NM_007078.2(LDB3):c.845C>T (p.Thr282Met) rs199811186
NM_007078.2(LDB3):c.859+14C>G rs748281629
NM_007078.2(LDB3):c.859+3G>A rs376313045
NM_007078.2(LDB3):c.860-15C>T rs727503126
NM_007078.2(LDB3):c.860-22_860-12del rs727504602
NM_007078.2(LDB3):c.891G>A (p.Arg297=) rs374336814
NM_007078.2(LDB3):c.896+6722G>A rs144445130
NM_007078.2(LDB3):c.896+6723G>A rs868365512
NM_007078.2(LDB3):c.896+6731C>T rs372789789
NM_007078.2(LDB3):c.896+6823C>T rs377726575
NM_007078.2(LDB3):c.897-10G>A rs77304928
NM_007078.2(LDB3):c.897-11C>T rs766463668
NM_007078.2(LDB3):c.897-14T>C rs763081924
NM_007078.2(LDB3):c.897-16G>C rs45513100
NM_007078.2(LDB3):c.899C>A (p.Thr300Asn) rs397517228
NM_007078.2(LDB3):c.900C>A (p.Thr300=) rs760071118
NM_007078.2(LDB3):c.909G>A (p.Glu303=) rs1476832174
NM_007078.2(LDB3):c.91C>T (p.Arg31Trp) rs367792378
NM_007078.2(LDB3):c.93+10C>A rs1222755412
NM_007078.2(LDB3):c.93+1G>T rs727505066
NM_007078.2(LDB3):c.93+7G>T rs397517229
NM_007078.2(LDB3):c.954C>T (p.Pro318=) rs45603139
NM_007078.2(LDB3):c.955G>A (p.Ala319Thr) rs151219713
NM_007078.2(LDB3):c.991G>A (p.Ala331Thr) rs749520121
NM_007078.2(LDB3):c.993G>A (p.Ala331=) rs140347820
NM_007078.3(LDB3):c.-1C>A
NM_007078.3(LDB3):c.1018G>C (p.Ala340Pro)
NM_007078.3(LDB3):c.1892C>A (p.Thr631Asn)
NM_007078.3(LDB3):c.336C>T (p.Asp112=)
NM_007078.3(LDB3):c.36C>A (p.Pro12=)
NM_007078.3(LDB3):c.5C>A (p.Ser2Tyr)
NM_007078.3(LDB3):c.610G>A (p.Ala204Thr)
NM_007078.3(LDB3):c.915G>A (p.Ala305=)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.